Biosensor based on 3D DNA Walker and UEDC and application

Abstract

The invention discloses a biosensor based on 3D DNA Walker and UEDC and application, and relates to the technical field of biosensors, the biosensor comprises WB-LS (at) SMBs, Nb.BbvCI, a 10 * CutSmart buffer solution, an auxiliary chain A solution and ultrapure water, the sequence of the auxiliary chain A is SEQ ID NO.1 in a sequence table; according to the biosensor based on the 3D DNA Walker and the UEDC and the application of the biosensor, non-sugar substances are detected by utilizing a common glucometer through the biosensor, high-sensitivity detection can be performed on HIV-DNA, the detection range is wide, accurate detection can be performed from 5 pM to 20 nM, and the detection line is as low as 0.3 pM; and the biosensor has good base mismatch recognition capability, so that false positive or false negative results caused by base mismatch are effectively avoided, and the detection accuracy and reliability are improved.

Description

Technical Field

[0001] The present invention relates to biosensor technology, and in particular to a biosensor based on 3D DNA Walker and UEDC and its application. Background Art

[0002] Human immunodeficiency virus (HIV) attacks CD4 helper T lymphocytes in the human immune system, leading to serious infections and malignant tumors. Existing HIV detection methods, such as ELISA and immunoblotting, suffer from window period issues, while PCR technology is complex and time-consuming, limiting its application.

[0003] To overcome these limitations, biosensor technologies such as colorimetry and fluorescence have been used for HIV DNA detection. However, these methods often require specialized expertise, bulky equipment, and complex procedures, making them difficult to implement in resource-poor settings. Point-of-care (POCT) devices, due to their portability, low cost, and ease of use, have emerged as a solution. Among these, glucose meters (PGMs) are widely used for non-glucose target detection. However, traditional PGM-based detection methods have limited detection capabilities.

[0004] DNA walker signal amplification technology, particularly 3D DNA walker nanomachines, has attracted considerable attention due to its rapid response and robust amplification capabilities. However, early 3D DNA nanomachines suffered from limited signal strength, and bipedal or multipedal DNA walkers posed a risk of derailment. To improve sensitivity, cascade amplification strategies have been proposed, and entropy-driven catalysis (EDC) reactions have attracted attention due to their high predictability and fidelity. However, traditional EDC reactions produce a large number of waste chains, which affect amplification efficiency. Therefore, the present invention aims to develop a biosensor to address the low sensitivity, complex operation, and bulky instrumentation of existing HIV-DNA detection methods, while also overcoming the limitations of existing DNA walker technology and improving detection efficiency and accuracy. Summary of the Invention

[0005] The purpose of the present invention is to provide a biosensor based on 3D DNA Walker and UEDC and its application to solve the above-mentioned deficiencies in the prior art.

[0006] In order to achieve the above objectives, the present invention provides the following technical solution: a biosensor based on 3D DNA Walker and UEDC, wherein the biosensor includes WB-LS@SMBs, Nb.BbvCI, 10×CutSmart buffer, auxiliary chain A solution and ultrapure water, and the auxiliary chain A sequence is SEQ ID NO.1 in the sequence list.

[0007] Furthermore, the preparation method of the biosensor comprises the following steps:

[0008] S1. First, dissolve the walking strand W, blocking strand B, connecting strand L, and auxiliary strand A in TE buffer to obtain a walking strand solution, a blocking strand solution, a connecting strand solution, and an auxiliary strand A solution;

[0009] S2. Denature the walking chain solution at 95°C for 10 min, then cool to 25°C at a rate of 1°C / min. Mix equal volumes of the walking chain solution and the blocking chain solution at a molar concentration ratio of 1:1.2, and incubate at 37°C for 1 h to obtain the WB solution.

[0010] S3. Denature the ligation strand solution at 95°C for 10 min, then cool to 25°C at a rate of 1°C / min. Then, mix equal volumes of the ligation strand solution and S-invertase, and incubate at 37°C for 1 h to obtain the LS-invertase solution.

[0011] S4, washing 10 mL of magnetic SMBs with PBS solution five times, and then dispersing them in 30.5 mL of PBS to obtain a magnetic bead solution;

[0012] S5. After thoroughly mixing the WB solution and LS-invertase solution at a ratio of 1:20, add the mixture to the magnetic bead solution and react on a shaker at 37°C for 1 h to obtain the final product.

[0013] S6. The final product was washed five times with PBS solution and then resuspended in 40 mL of PBS solution to obtain a mixture WB-LS@SMBs;

[0014] S7. Mix 12 μL of 50 nM WB-LS@SMBs, 1 μL of 10 U / μL Nb.BbvCI, 4 μL of 10× CutSmart buffer, and 2 μL of 200 nM A to obtain a biosensor.

[0015] Furthermore, the pH of the TE buffer in S1 is 8.0, which is a mixed solution of 10 mM Tris-HCl and 1 mM EDTA; the walking chain W in S1 is SEQ ID NO.2 in the sequence listing, the closing chain B in S1 is SEQ ID NO.3 in the sequence listing, and the connecting chain L in S1 is SEQ ID NO.4 in the sequence listing.

[0016] Furthermore, the magnetic beads SMBs described in S4 are streptavidin-modified magnetic beads containing 0.1% bovine serum albumin, 0.05% NaN3 and 0.05% Tween-20, with a radius of 0.5 μm, a concentration of 4 mg / mL and a pH value of 7.4.

[0017] Furthermore, the pH value of the PBS solution in S4 and S6 is 7.4, which is a mixed solution of 136.89 mM NaCl, 2.67 mM KCl, 8.10 mM Na2HPO4 and 1.76 mM KH2PO4.

[0018] Furthermore, the method for using the biosensor is:

[0019] Add 1 μL of the sample to be tested and 20 μL of ultrapure water to the biosensor, react at 37°C for 70 minutes, separate the final product by centrifugation, and obtain a supernatant; add sucrose to 10 μL of the supernatant, react at 55°C for 50 minutes, and obtain a reacted solution; aspirate 2 μL of the reacted solution and use a blood glucose meter to detect HIV-DNA.

[0020] Furthermore, the sample to be tested is a serum sample.

[0021] Furthermore, the amount of sucrose added is 2 μL.

[0022] Furthermore, the concentration of the sucrose is 0.5M.

[0023] Application of a biosensor based on 3D DNA Walker and UEDC in HIV-DNA detection.

[0024] Compared with existing technologies, the present invention provides a biosensor based on 3D DNA Walker and UEDC and its application. Through the biosensor, it is possible to use a common blood glucose meter to detect non-sugar substances. This breaks through the limitation of traditional blood glucose meters that can only detect sugar substances, greatly expands the application range of blood glucose meters, enables them to be used for HIV-DNA detection, and provides a new technical means for the field of point-of-care testing (POCT).

[0025] The biosensor is capable of highly sensitive detection of HIV-DNA over a wide detection range, from 5pM to 20nM, with a detection threshold as low as 0.3pM. This allows for timely and accurate detection of HIV-DNA even in the early stages of infection, when viral loads are low, providing strong technical support for early diagnosis and timely intervention of HIV infection.

[0026] This biosensor has good base mismatch recognition capabilities, which is particularly important in the field of genetic testing. It can effectively avoid false positive or false negative results caused by base mismatches, improve the accuracy and reliability of detection, and show good anti-interference ability in human serum. There is no need for tedious pretreatment of samples to remove interfering substances. Accurate detection can be completed directly in actual biological samples, which greatly simplifies the detection process, saves time and labor costs, and improves detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments described in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0028] Figure 1 A schematic diagram of the preparation principle of a biosensor provided in an embodiment of the present invention;

[0029] Figure 2 A schematic diagram of a feasibility test of a biosensor according to an embodiment of the present invention;

[0030] Figure 3 A schematic diagram of the experimental condition optimization results provided by an embodiment of the present invention;

[0031] Figure 4 A schematic diagram of detection range detection provided by an embodiment of the present invention;

[0032] Figure 5 Schematic diagram of the repeatability and stability experimental results provided by the embodiment of the present invention;

[0033] Figure 6 A schematic diagram of selective analysis test results provided by an embodiment of the present invention;

[0034] Figure 7 A schematic diagram of the amplification efficiency detection results provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0035] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings.

[0036] Example 1:

[0037] See also Figure 1 A biosensor based on 3D DNA Walker and UEDC includes WB-LS@SMBs, Nb.BbvCI, 10×CutSmart buffer, auxiliary chain A solution and ultrapure water, where the auxiliary chain A is SEQ ID NO.1 in the sequence table.

[0038] Nb.BbvCI is a nicking endonuclease that cleaves only one strand of a double-stranded DNA substrate. Its recognition sequence is CCTCAGC and it is expressed in an Escherichia coli strain carrying an engineered BbvCI restriction enzyme gene from Bacillus brevis. It exhibits 100% activity in CutSmart buffer, facilitating double enzyme digestion.

[0039] The sequence of auxiliary chain A is: GAGGAGGCGTCCGTACTGCTAGAGATTTTCCAC.

[0040] The biosensor uses the upgraded entropy-driven catalytic reaction (UEDC) as the inner loop and the LS-converting enzyme as the outer loop, which are simultaneously fixed on the magnetic beads. Once the target (HIV-DNA) is introduced, the exposed fulcrum will be recognized by HIV-DNA, and with the help of the A chain, the inner loop will be fully activated, which will cause a sudden increase in the local concentration walking around the UEDC. The large amount of released W chains will capture the surrounding LS-converting enzymes as much as possible, thereby successfully activating the outer loop. With the participation of Nb.BbvCI, a large amount of L-converting enzyme will be released from the magnetic beads, and the signal that can be detected by the blood glucose meter (PGM) will be significantly enhanced. The prepared biosensor ensures a one-step operation of the entire reaction and shortens the detection time. More importantly, the method exhibits good anti-interference ability and good mismatch recognition ability in human serum samples, and has good HIV-DNA analysis performance.

[0041] The preparation method of the biosensor comprises the following steps:

[0042] S1. First, the walking strand W, the blocking strand B, the connecting strand L, and the auxiliary strand A are respectively dissolved in TE buffer to obtain a walking strand solution, a blocking strand solution, a connecting strand solution, and an auxiliary strand A solution; the TE buffer has a pH of 8.0 and is a mixed solution of 10 mM Tris-HCl and 1 mM EDTA; the walking strand W is SEQ ID NO. 2 in the sequence listing, the blocking strand B is SEQ ID NO. 3 in the sequence listing, and the connecting strand L is SEQ ID NO. 4 in the sequence listing;

[0043] The sequence of walking chain W is: AAAAAAAAAAAAATGTGGAAAATCTCTAGCAGTACGGACGCCTCCTCCTTTTGCTGAGGAGGCGTA;

[0044] The closed chain B sequence is: TTTTTTCAGACTGCTAGAGATTTT;

[0045] The sequence of the connecting chain L is: TTTTTTCAGACTGCTAGAGATTTT;

[0046] S2. Denature the walking chain solution at 95°C for 10 min, then cool to 25°C at a rate of 1°C / min. Mix equal volumes of the walking chain solution and the blocking chain solution at a molar concentration ratio of 1:1.2, and incubate at 37°C for 1 h to obtain the WB solution.

[0047] S3. Denature the ligation strand solution at 95°C for 10 min, then cool to 25°C at a rate of 1°C / min. Then, mix equal volumes of the ligation strand solution and S-invertase, and incubate at 37°C for 1 h to obtain the LS-invertase solution.

[0048] S4. Wash 10 mL of magnetic beads SMBs with PBS solution 5 times, and then disperse them in 30.5 mL of PBS to obtain a magnetic bead solution; the magnetic beads SMBs are streptavidin-modified magnetic beads containing 0.1% bovine serum albumin, 0.05% NaN3 and 0.05% Tween-20, with a radius of 0.5 μm, a concentration of 4 mg / mL, and a pH of 7.4; the pH of the PBS solution is 7.4, and it is a mixed solution of 136.89 mM NaCl, 2.67 mM KCl, 8.10 mM Na2HPO4 and 1.76 mM KH2PO4.

[0049] S5. After thoroughly mixing the WB solution and LS-invertase solution at a volume ratio of 1:20, add the mixture to the magnetic bead solution and react on a shaker at 37°C for 1 h to obtain the final product.

[0050] S6. The final product was rinsed five times with PBS solution and then resuspended in 40 mL of PBS solution to obtain a mixture WB-LS@SMBs; the pH value of the PBS solution was 7.4, which was a mixed solution of 136.89 mM NaCl, 2.67 mM KCl, 8.10 mM Na2HPO4 and 1.76 mM KH2PO4.

[0051] The final product was washed five times with PBS to remove excess primers and then resuspended in 40 mL of PBS. Due to the excellent specificity between streptavidin and biotin, the biotin-modified probes were strongly bound to the SMBs, resulting in a mixture containing 50 nM WB and 1 μM LS-converting enzyme, WB-LS@SMBs.

[0052] S7. Mix 12 μL of 50 nM WB-LS@SMBs, 1 μL of 10 U / μL Nb.BbvCI, 4 μL of 10× CutSmart buffer, and 2 μL of 200 nM auxiliary chain A solution to obtain a biosensor.

[0053] The method of using the biosensor is as follows: add 1 μL of the sample to be tested and 20 μL of ultrapure water to the biosensor, react at 37°C for 70 minutes, separate the final product by centrifugation, and obtain a supernatant. The obtained supernatant containing free S-converting enzyme is used for signal detection; add 2 μL of 0.5M sucrose to 10 μL of the supernatant, react at 55°C for 50 minutes to obtain a reacted solution; aspirate 2 μL of the reacted solution and use a blood glucose meter to detect HIV-DNA.

[0054] See also Figure 1 , WB (as the backbone of the inner cycle) and LS-converting enzyme (as the substrate of the outer cycle) are simultaneously anchored on magnetic beads (MBs) through specific streptavidin-biotin interactions in the pre-experimental stage. When HIV-DNA is introduced into the sensing system, it can bind to Toheld 1, which exposes 6nt bases in the walking chain W, through toehold-mediated strand displacement reactions (TMSDRs), and induce the walking chain W to release the closed chain B. Due to the dissociation of the closed chain B, Toheld 2, which was initially blocked in the walking chain W, is exposed. It can be captured by the auxiliary chain A, and further leads to the release of the neck sequence of the walking chain W and the target DNA sequence. The released walking chain W starts the outer cycle, and the target DNA sequence enters a new round of inner cycle, prompting more walking chains W to be free.

[0055] Compared to conventional entropy-driven catalysis (CEDC), it produces no waste strands, avoiding energy loss. A single UEDC reaction can release a large amount of target DNA. The released walking strand W then rapidly captures the unbound substrate strand S surrounding the tether (the sequence of substrate strand S is: TCGTGTCTCATTAGTTATTCTCATCCTCCTCAGCAAAAGTATCTCAGTCA), forming the recognition sequence for Nb.BbvCI.

[0056] With the involvement of Nb.BbvCI, the outer loop is fully activated, resulting in the separation of the S-invertase from the MB. Subsequently, the recovered walking strand W continuously migrates along the adjacent, uncut LS-invertase, forming a large amount of stable double-stranded DNA (dsDNA). This repeated cleavage by Nb.BbvCI results in the release of a large amount of invertase-modified S strands into the system. After centrifugation, the supernatant (containing invertase, which converts sucrose to glucose, ultimately capturing the signal) is aspirated and the signal output is detected using the PGM.

[0057] Example 2:

[0058] See also Figure 2 This embodiment provides a technical solution based on the first embodiment: feasibility experiment verification of the biosensor.

[0059] To fully verify the feasibility and effectiveness of the constructed biosensor scheme, the following experiments were conducted: Four different conditions were tested: a blank control group (a) using only the biosensor without any target substance (HIV-DNA); a control group (b) without the addition of auxiliary chain A to the biosensor system, aiming to examine the key role of auxiliary chain A in signal transduction and amplification; a control group (c) without the addition of Nb.BbvCI to explore its essential role in signal cleavage and release; and a control group (d) with all components, including the target substance HIV-DNA, added to the biosensor to simulate actual detection scenarios and evaluate overall detection performance. Signals from each experimental group were accurately measured and recorded using a blood glucose meter (PGM).

[0060] See also Figure 2 , when and only when the target substance (HIV-DNA) is successfully introduced into the biosensor system, the signal intensity detected by PGM reaches the highest value. Compared with the blank control group without the addition of the target substance, the signal intensity is increased by about 6.94 times. This significant signal difference intuitively shows that the constructed biosensor scheme is highly feasible and effective, and can achieve specific recognition and signal amplification for the HIV-DNA target substance. This not only verifies the scientific nature of the scheme in the detection principle, but also highlights its strong operability and reliability in practical applications, providing a solid foundation and strong support for further clinical sample testing and on-site rapid diagnosis of AIDS.

[0061] Example 3:

[0062] See also Figure 3 This embodiment provides a technical solution based on the first embodiment: an experiment to optimize the preparation conditions of the biosensor.

[0063] In order to further improve the sensitivity of the scheme, a series of experimental condition optimizations were carried out. The specific optimization scheme is as follows:

[0064] Refer to 3(a). The ratio of WB to LS-convertase was finely adjusted. Various ratios, including 1:1, 1:5, 1:10, 1:20, 1:25, and 1:30, were tested to find the optimal combination of the two to achieve the best signal output.

[0065] Refer to 3(b). For the dosage of Nb.BbvCI, we set up multiple experimental groups with different dosages, including 0, 5, 10, 15, and 20 U. By comparing the biosensor responses at different dosages, we determined the optimal dosage that ensured sufficient enzymatic cleavage and stable signal output.

[0066] Refer to 3(c) to optimize the UEDC reaction time. We set multiple time points, such as 10, 20, 30, 40, 50, and 60 minutes, to observe the effects of different reaction times on signal amplification, thereby determining the most suitable reaction time.

[0067] Refer to 3(d). The Nb.BbvCI digestion time was investigated, and multiple time gradients, such as 0, 10, 20, 30, 40, and 50 min, were set to determine the optimal digestion time to ensure sufficient substrate reaction and prevent subsequent signal detection from being affected by excessive digestion.

[0068] Refer to 3(e) to study the ratio of auxiliary chain A to WB. We tested various ratios, including 0.5, 0.75, 1, 1.25, 1.5, and 1.75, to find the dosage of auxiliary chain A that best performs in signal transduction and amplification.

[0069] Refer to 3(f) to optimize the sucrose concentration and set multiple concentration gradients such as 0.1, 0.25, 0.5, 0.75, and 1 M to provide the best substrate environment for signal detection.

[0070] After systematically optimizing the various experimental conditions described above, the optimal combination of experimental parameters was ultimately determined: a WB to LS-invertase ratio of 1:20, a Nb.BbvCI dosage of 10 U, a UEDC reaction time of 40 minutes, a Nb.BbvCI digestion time of 30 minutes, a ratio of auxiliary chain A to WB of 5:4, and a sucrose concentration of 0.5 M. This series of optimization measures significantly improved the sensitivity of the biosensor, laying a solid foundation for subsequent practical applications.

[0071] Example 4:

[0072] See also Figure 4 This embodiment provides a technical solution based on the first embodiment: the biosensor detects the detection range.

[0073] In order to verify the detection range of the biosensor, 5 pM, 10 pM, 50 pM, 100 pM, 5 nM and 20 nM HIV DNA were added to the biosensor, and the changes in the PGM signal value were monitored.

[0074] See also Figure 4 , the calculation formula of the detection line is as follows:

[0075] Y=3.27logC Target +11.44, of which R 2 =0.994, C target is the concentration of HIV DNA;

[0076] The detection range is 5pM~20nM; the detection limit (LOD) is: 0.34pM (calculated based on 3σ).

[0077] Embodiment 5:

[0078] See also Figure 5 This embodiment provides a technical solution based on the first embodiment: experimental detection of repeatability and stability of the biosensor.

[0079] Repeatability experiment: Three different concentrations of target DNA (5pM, 50pM and 1000pM) were selected, and three independent repeated tests were performed for each concentration of target DNA. Figure 5 (a), the relative standard deviation (RSD) was 4.2% at 5pM, 3.5% at 50pM, and 4.7% at 1000pM. Such low RSD values ​​indicate that the biosensor has excellent reproducibility across different concentration ranges and can stably detect target DNA samples of the same concentration, providing strong assurance for the reliability of the experimental data.

[0080] Stability test: To verify the long-term stability of the biosensor, the prepared biosensor was stored at 4°C and tested regularly. 5 nM target DNA was added and tested every 2 days for 12 days. Figure 5 (b) After 12 days, the PGM signal decreased by only 3.1%. This demonstrates that the biosensor, under appropriate storage conditions, can maintain its stable detection performance over a long period of time, without significant signal attenuation. This characteristic is of great significance for the storage, transportation, and long-term use of biosensors in practical applications.

[0081] In summary, through detailed evaluation of repeatability and stability experiments, it can be clearly seen that this biosensor not only has good repeatability and can provide stable and reliable results in multiple tests, but also exhibits excellent stability under appropriate storage conditions, meeting the basic requirements of practical applications for biosensor performance, and laying a solid foundation for its widespread application in the field of HIV-DNA detection.

[0082] Example 6:

[0083] See also Figure 6 This embodiment provides a technical solution based on the first embodiment: the biosensor selectively analyzes and detects:

[0084] The experiment selected 5nM concentrations of single-base HIV-DNA mutations (SM), double-base HIV-DNA (DM) mutations, non-complementary sequences (including BR1CA gene sequence, p53 gene sequence), HIV-DNA and a mixed system containing these DNAs for detection.

[0085] The SM sequence is: ACTGCTAGAGATTTTCCACTT;

[0086] The DM sequence is: ACTGCTAGAGATTTTACACTT;

[0087] The BRCA1 sequence is: GAGCATACATAGGGTTTCTCTTGGTTT;

[0088] The p53 sequence is: CAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTG;

[0089] The HIV-DNA sequence is: ACTGCTAGAGATTTTCCACAT;

[0090] See also Figure 6 , when faced with these structurally similar or completely different gene sequences, the constructed biosensor demonstrated excellent recognition capabilities. It can accurately distinguish true HIV-DNA, and only produces very low background signals for HIV-DNA with single-base or double-base mutations and other non-related gene sequences (such as BRCA1, p53), with almost no cross-reactions. Even in a complex mixed system, the biosensor can still accurately identify and detect HIV-DNA without being affected by other interfering substances. This excellent selective analysis result fully demonstrates the advantages of this scheme in the efficient selective detection of HIV-DNA in practical applications, ensuring that the target viral DNA sequence can be reliably identified in complex biological samples, and providing a strong guarantee for the accurate diagnosis of HIV infection.

[0091] Embodiment seven:

[0092] See also Figure 7 This embodiment provides a technical solution based on the first embodiment: the biosensor amplification efficiency detection:

[0093] In the experiment, the biosensor was compared with the 3D DNA Walker amplification strategy alone and the cascade amplification strategy combining CEDC and 3D DNA Walker, and its amplification efficiency was accurately quantified.

[0094] The preparation method of the 3D DNA walker combined with CEDC biosensor (3D DNA walker@CEDC) is as follows:

[0095] Equimolar concentrations of DNA single strand P, DNA single strand Q, and DNA single strand R were denatured at 95°C for 10 min, then slowly cooled to room temperature (cooled for more than 8 hours) to obtain a PQR triplex mixed solution, which was stored at 4°C for later use;

[0096] The sequence of the single-stranded DNA P is: TTTTTTACTGCTAGAG;

[0097] The sequence of the single-stranded DNA Q is: AAAAAAAAAAAAATGTGGAAAATGACTGTGAGATGAGGCTGAGGTACG;

[0098] The sequence of the single-stranded DNA R is: TTACACGAAAATCTCTAGCAGTCACGGCCTCATCTCACAGTCAT;

[0099] The ligation chain L solution was denatured at 95°C for 10 min and then cooled to 25°C at a rate of 1°C / min. The ligation chain L solution and S-invertase were then mixed at an equimolar concentration ratio and incubated at 37°C for 1 h to obtain an LS-invertase solution.

[0100] 10 mL of magnetic beads SMBs were washed 5 times with PBS solution and then dispersed in 30.5 mL of PBS to obtain a magnetic bead solution; the magnetic beads SMBs were streptavidin-modified magnetic beads containing 0.1% bovine serum albumin, 0.05% NaN3 and 0.05% Tween-20, with a radius of 0.5 μm, a concentration of 4 mg / mL, and a pH of 7.4; the PBS solution had a pH of 7.4 and was a mixed solution of 136.89 mM NaCl, 2.67 mM KCl, 8.10 mM Na2HPO4 and 1.76 mM KH2PO4.

[0101] The PQR triplex mixed solution and LS-converting enzyme solution were thoroughly mixed at a molar concentration ratio of 1:20, added to the magnetic bead solution, and reacted on a shaker at 37°C for 1 hour to obtain the final product; the final product was rinsed five times with PBS solution and then resuspended in 40 mL of PBS solution to obtain the mixture PQR-LS@SMBs.

[0102] 12 μL of 50 nM PQR-LS@SMBs, 1 μL of 10 U / μL Nb.BbvCI, 4 μL of 10× CutSmart buffer, and 2 μL of 200 nM auxiliary chain N solution were mixed to obtain a 3D DNA walker combined with CEDC biosensor (3D DNAwalker@CEDC).

[0103] The auxiliary chain N sequence is: ATGACTGTGAGATGAGGCCGTGACTGCTAGAGATTTTC.

[0104] See also Figure 7 a. When the cascade amplification strategy combining UEDC and 3D DNA Walker (Walker+UEDC) was used, the amplification efficiency was significantly improved by approximately 1.35 times compared to the strategy using 3D DNA Walker alone (Walker alone); see Figure 7 b. Compared with 3D DNA walker@CEDC (Walker+CEDC), the detection performance is improved by about 1.07 times. This significant improvement shows that by introducing UEDC as the inner loop and synergizing with the outer loop of 3D DNA Walker, the signal amplification effect can be effectively enhanced. This cascade strategy fully utilizes the advantages of UEDC's efficient signal amplification, and at the same time combines the powerful target recognition and conversion capabilities of 3D DNA Walker to make the entire biosensor more powerful and sensitive in signal output. Such synergy not only improves the sensitivity of detection, but also enhances the stability and reliability of the detection signal, providing solid technical support for the biosensor to achieve high-sensitivity and high-specificity HIV-DNA detection in practical applications, making it expected to more accurately identify and quantify target viral DNA sequences in complex biological samples.

[0105] Embodiment 8:

[0106] This embodiment provides a technical solution based on the first embodiment: the biosensor is added with a recovery experiment.

[0107] To further validate the anti-interference ability of the constructed biosensor strategy in complex samples, a spike-recovery experiment was conducted using human serum samples as a complex matrix. Specifically, HIV-DNA fragments at different concentrations (10pM, 100pM, and 1000pM) were spiked into 10% diluted human serum, and the resulting recovery rates were calculated using a linear regression equation.

[0108]

[0109] As can be seen from the above table, the recovery rate of this method in serum is between 96.3% and 100.4%, and the RSD is between 1.3% and 4.3%, indicating that the biosensor is less susceptible to interference in complex matrix analysis and has application potential in the analysis of actual samples.

[0110] The above description is merely illustrative of certain exemplary embodiments of the present invention. It goes without saying that those skilled in the art will be able to modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the above drawings and description are illustrative in nature and should not be construed as limiting the scope of protection of the claims.

Claims

1. A biosensor based on 3D DNA Walker and UEDC, characterized in that: The biosensor comprises WB-LS@SMBs, Nb.BbvC I, 10×CutSmart buffer, auxiliary chain A solution and ultrapure water, wherein the auxiliary chain A is SEQ ID NO.1 in the sequence table.

2. A biosensor based on 3D DNA Walker and UEDC according to claim 1, characterized in that: The preparation method of the biosensor comprises the following steps: S1. First, dissolve the walking strand W, blocking strand B, connecting strand L, and auxiliary strand A in TE buffer to obtain a walking strand solution, a blocking strand solution, a connecting strand solution, and an auxiliary strand A solution; S2. Denature the walking chain solution at 95°C for 10 min, then cool to 25°C at a rate of 1°C / min. Mix equal volumes of the walking chain solution and the blocking chain solution at a molar concentration ratio of 1:1.2, and incubate at 37°C for 1 h to obtain the WB solution. S3. Denature the ligation strand solution at 95°C for 10 min, then cool to 25°C at a rate of 1°C / min. Then, mix equal volumes of the ligation strand solution and S-invertase, and incubate at 37°C for 1 h to obtain the LS-invertase solution. S4, washing 10 mL of magnetic SMBs with PBS solution five times, and then dispersing them in 30.5 mL of PBS to obtain a magnetic bead solution; S5. After thoroughly mixing the WB solution and LS-invertase solution at a ratio of 1:20, add the mixture to the magnetic bead solution and react on a shaker at 37°C for 1 h to obtain the final product. S6. The final product was washed five times with PBS solution and then resuspended in 40 mL of PBS solution to obtain a mixture WB-LS@SMBs; S7. Mix 12 μL of 50 nM WB-LS@SMBs, 1 μL of 10 U / μL Nb.BbvC I, 4 μL of 10× CutSmart buffer, and 2 μL of 200 nM auxiliary chain A solution to obtain a biosensor.

3. The biosensor based on 3D DNA Walker and UEDC according to claim 2, characterized in that: The pH of the TE buffer in S1 is 8.0, which is a mixed solution of 10 mM Tris-HCl and 1 mM EDTA; the walking chain W in S1 is SEQ ID NO.2 in the sequence listing, the closing chain B in S1 is SEQ ID NO.3 in the sequence listing, and the connecting chain L in S1 is SEQ ID NO.4 in the sequence listing.

4. The biosensor based on 3D DNA Walker and UEDC according to claim 2, characterized in that: The magnetic beads SMBs described in S4 are streptavidin-modified magnetic beads containing 0.1% bovine serum albumin, 0.05% NaN3 and 0.05% Tween-20, with a radius of 0.5 μm, a concentration of 4 mg / mL and a pH value of 7.

4.

5. The biosensor based on 3D DNA Walker and UEDC according to claim 2, characterized in that: The pH value of the PBS solution in S4 and S6 is 7.4, which is a mixed solution of 136.89 mM NaCl, 2.67 mM KCl, 8.10 mM Na2HPO4 and 1.76 mM KH2PO4.

6. The biosensor based on 3D DNA Walker and UEDC according to claim 1, characterized in that: The method for using the biosensor is as follows: Add 1 μL of the sample to be tested and 20 μL of ultrapure water to the biosensor, react at 37°C for 70 minutes, separate the final product by centrifugation, and obtain a supernatant; add sucrose to 10 μL of the supernatant, react at 55°C for 50 minutes, and obtain a reacted solution; aspirate 2 μL of the reacted solution and use a blood glucose meter to detect HIV-DNA.

7. The biosensor based on 3D DNA Walker and UEDC according to claim 6, characterized in that: The sample to be tested is a serum sample.

8. The biosensor based on 3D DNA Walker and UEDC according to claim 6, characterized in that: The amount of sucrose added was 2 μL.

9. The biosensor based on 3D DNA Walker and UEDC according to claim 6, characterized in that: The concentration of sucrose is 0.5M.

10. Use of the biosensor based on 3D DNA Walker and UEDC according to any one of claims 1 to 9 in HIV-DNA detection.

Images