Method for detecting pullulan produced by bacterial strain by using qRT-PCR (quantitative reverse transcription-polymerase chain reaction) technology

Abstract

The invention provides a method for monitoring the synthesis efficiency of pullulan in a fermentation process of aureobasidium pullulans in real time based on a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) technology. A quantitative correlation model of gene expression abundance and polysaccharide yield is established by specifically detecting transcription dynamics of key genes (such as GluK-1, PGM-2, UGT-1 and AmAGS2-2) for synthesizing pullulan polysaccharide. Compared with chemical detection means such as high performance liquid chromatography (HPLC), the method has the advantages of high sensitivity, short time consumption and multi-target parallel analysis, and an innovative molecular tool is provided for intelligent monitoring and yield increase in the industrial fermentation process.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for detecting pullulan production by a strain using qRT-PCR technology. Background Art

[0002] Pullulan is a linear polysaccharide produced extracellularly by strains of the genus Aureobasidium. It consists of a repeating unit structure consisting of two maltotriose units linked by α-(1→4) glycosidic bonds, with the maltotriose units linked by α-(1→6) glycosidic bonds to form a linear glucan. Due to its unique structure, pullulan possesses unique physicochemical properties. Research has shown that it is a low-viscosity, non-toxic, non-mutagenic, and non-carcinogenic polymer. These unique properties have potential applications in the food, pharmaceutical, and biomedical fields.

[0003] The chemical structure of pullulan was determined as early as the 1960s. With the recent development and widespread use of high-throughput sequencing technology, its biosynthetic pathway, related enzymes, and genes have been extensively studied. Aureobasidium pullulans converts glucose into glucose-6-phosphate under the action of hexokinase (GluK). Glucose-6-phosphate is then converted to glucose-1-phosphate by phosphoglucomutase (PGM). Glucose-1-phosphate and uridine triphosphate are then converted to UDP-glucose by UDP-glucose pyrophosphoylase (UGP). UDP-glucose is then converted to maltose and isomaltose by glucosyltransferase (UGT). These are then polymerized by pullulan synthase (PUL) to form high-molecular-weight pullulan. Subsequently, the degree of polymerization of pullulan is modified by α-amylase, glucoamylase, and pullulanase to form low-molecular-weight pullulan.

[0004] When detecting pullulan production during fermentation of Aureobasidium pullulans, offline detection techniques are typically used, such as chemical detection methods such as high-performance liquid chromatography (HPLC), but these methods have a certain hysteresis. In order to improve the efficiency of detecting pullulan production by strains, the present invention establishes a correlation model between gene expression abundance and polysaccharide yield by specifically detecting the transcriptional dynamics of key genes for pullulan synthesis, thereby monitoring the synthesis of pullulan during fermentation of Aureobasidium pullulans based on real-time fluorescence quantitative PCR (qRT-PCR). Summary of the Invention

[0005] The present invention provides a method for detecting pullulan production by a strain by utilizing real-time fluorescence quantitative PCR (qRT-PCR) technology. The method comprises the following steps: in the process of fermenting and producing pullulan by the strain, detecting the transcription level of a key enzyme for pullulan synthesis by utilizing a real-time fluorescence quantitative PCR (qRT-PCR) method, thereby reflecting the fermentation level of pullulan; the strain is Aureobasidium pullulans; the key enzyme for pullulan synthesis is selected from one or any combination of GluK-1 (glucokinase), PGM-2 (α-phosphoglucomutase), UGT-1 (glucosyltransferase), and AmAGS2-2 (glucan synthase); and an increase in the transcription level of the key enzyme for pullulan synthesis reflects an increase in the level of pullulan production by the strain.

[0006] In one embodiment, the strain is Aureobasidium pullulans with a deposit number of ATCC 15233.

[0007] In one embodiment, the key enzyme for pullulan synthesis is selected from one or any combination of GluK-1, UGT-1, and AmAGS2-2.

[0008] In one embodiment, the nucleic acid sequence of GluK-1 is shown as SEQ ID No.1; the nucleic acid sequence of PGM-2 is shown as SEQ ID No.2; the nucleic acid sequence of UGT-1 is shown as SEQ ID No.3; and the nucleic acid sequence of AmAGS2-2 is shown as SEQ ID No.4.

[0009] In one embodiment, qRT-PCR is used to detect the relative transcription level of a key enzyme in pullulan synthesis, wherein the relative transcription level is the relative transcription level compared with an internal reference, preferably, β-actin.

[0010] In the art, conventional methods can be used to calculate the relative transcription level of the key enzymes for pullulan synthesis compared with the internal reference; for example, using 2 -ΔΔCt Calculation method.

[0011] In one embodiment,

[0012] The forward and reverse primers for amplifying GluK-1 were as follows: atgacaaccgcgtcaaataa, caacatcaccaccgatcaaga;

[0013] The forward and reverse primers for amplifying PGM-2 were as follows: atgagcgtcaagactgtttcc, ctgaatagtgctccttctggaa;

[0014] The forward and reverse primers for amplifying UGT-1 were as follows: tgcgatatcagcacctggca, ccgagttgaacgaagttttgag;

[0015] The forward and reverse primers for amplifying AmAGS2-2 are as follows: cactctactcctctttatcacaagc, gcattctccagttggaagga.

[0016] In one embodiment, the carbon source in the culture medium for the fermentation of the strain is sucrose.

[0017] In one embodiment, the concentration of the carbon source is 5 g / L-8 g / L, preferably 8 g / L.

[0018] In one embodiment, the transcription level of the key enzymes for pullulan synthesis is detected during fermentation for 24-72 hours; preferably, the fermentation is performed for 48 hours.

[0019] In one embodiment, the culture medium for the fermentation of the strain further comprises K2HPO4, YEAST EXTRACT, MgSO4 and NaCl.

[0020] In one embodiment, the fermentation temperature of the strain is 25°C-35°C, preferably, at 28°C.

[0021] In one embodiment, the level of pullulan produced by the strain is determined to be elevated by any one or more of the following methods (1) to (4):

[0022] (1) the relative transcription level of GluK-1 is at least 400-fold, for example, at least 450-fold, at least 500-fold or higher, compared to the control group;

[0023] (2) the relative transcription level of PGM-2 is at least 15-fold, for example, at least 20-fold, at least 25-fold, at least 30-fold or higher, compared to the control group;

[0024] (3) the relative transcription level of UGT-1 is at least 50 times, for example, at least 60 times, at least 65 times, at least 70 times or more, compared to the control group;

[0025] (4) The relative transcription level of AmAGS2-2 is at least 400 times, for example, at least 450 times, at least 500 times or higher, compared with the control group.

[0026] In one embodiment, the control group is the relative transcription level of each target gene (GluK-1, PGM-2, UGT-1, or AmAGS2-2) at the start of fermentation. For example, the relative transcription level of each gene at the time of inoculation after the strain activation treatment.

[0027] In the present invention, the transcription level of key enzymes for pullulan synthesis in Aureobasidium pullulans is monitored by using real-time fluorescence quantitative PCR (qRT-PCR) technology to reflect the production level of pullulan. The relative transcription level of GluK-1 (glucokinase), PGM-2 (α-phosphoglucomutase), UGT-1 (glucosyltransferase) or AmAGS2-2 (glucan synthase) reaches 15-400 times or higher than that of the internal reference, reflecting an increase in the level of pullulan production by the strain. At this time, the amount of pullulan produced by the strain reaches 6 g / L or more, for example, 7 g / L, 8 g / L, 9 g / L, 10 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 : Transcriptional analysis of key genes for pullulan synthesis under different carbon sources.

[0029] Figure 2 Determination of strain biomass and pullulan production under different carbon source fermentation conditions. A. Biomass of Aureobasidium pullulans measured under culture conditions with different glycerol concentrations as the carbon source; B. Biomass of Aureobasidium pullulans measured under culture conditions with different sucrose concentrations as the carbon source; C. Pullulan production measured under culture conditions with different glycerol concentrations as the carbon source; D. Pullulan production measured under culture conditions with different sucrose concentrations as the carbon source.

[0030] Figure 3 : Transcriptional analysis of key genes in pullulan synthesis under different carbon source concentrations for 48 h.

[0031] Figure 4 : Transcriptional analysis of key genes for pullulan synthesis under different time gradients under 8% carbon source. DETAILED DESCRIPTION

[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above disclosed technical content to modify and produce equivalent embodiments with equivalent variations. Any simple modification or equivalent variation of the following embodiments made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0033] Test method:

[0034] 1. Activation culture of pullulan-producing strain Aureobasidium pullulans ATCC 15233

[0035] Transfer the strain stored at -80°C to seed culture medium and activate it until the logarithmic growth phase reaches OD = 1.2-1.5. After about 15 hours, inoculate 5% of the strain into the fermentation medium. The components of each culture medium are as follows:

[0036] Seed culture medium (g / L): glucose 5.0, KH2PO4 0.5, NaCl 1.0, (NH4)2SO4 1.0, Na2HPO4 1.5, MgSO4·7H2O 0.2 (added last), natural pH, sterilized at 115℃ for 20 min.

[0037] Fermentation medium (g / L): 80.0% sucrose / glycerol, 6.0% K₂HPO₄, 0.9% YEAST EXTRACT, 0.5% MgSO₄, 4.0% NaCl, initial pH 6.5, autoclaved at 115°C for 20 min. Fermentation was carried out at 28°C, 200 rpm for 72 h, with periodic sampling.

[0038] 2. Biomass determination

[0039] Take 1 mL of fermentation broth into a disposable cuvette and measure the OD600 value.

[0040] 3. Extraction of total mRNA

[0041] After centrifuging the bacterial solution at 12000 r / min for 10 minutes, remove the supernatant and surface sediment, collect the remaining bacterial sediment in a 1.5 mL EP tube, add appropriate amount of quartz sand and 1 mL TRIzol reagent, use a tissue disruptor at 60 Hz for 30 seconds to break the cell wall, let it stand at room temperature for 10 minutes, centrifuge at 12000 r / min and 4°C for 15 minutes, the solution will be separated into layers, and RNA will be in the supernatant; aspirate the supernatant into a new 1.5 mL RNA-free Add an equal volume of isopropanol to the EP tube, gently invert it upside down 7-8 times, let it stand at room temperature for 20 minutes, centrifuge it at 12000r / min and 4℃ for 10 minutes, and discard the supernatant; add 1mL75% ethanol (prepared with DEPC water), gently invert it to mix, centrifuge it at 12000r / min and 4℃ for 5 minutes, discard the supernatant, let it stand for 10 minutes, and repeat this step; add 20-50uLDEPC water to dissolve the mRNA, measure the concentration for the next step or store it at -80℃.

[0042] 4. Reverse transcription of mRNA into cDNA

[0043] Reverse transcription was performed using the FastKing One-Step Genomic cDNA First-Strand Synthesis Premix Kit.

[0044] 5. qRT-PCR

[0045] Aureobasidium pullulans strain ATCC15233 was cultured in fermentation medium for a period of time. Cells were harvested to extract total RNA and synthesize cDNA through reverse transcription. The key enzymes selected for pullulan synthesis and the primers used for qRT-PCR are shown in Tables 1 and 2 below. β-actin was used as an internal control.

[0046] Use the formula RATE=2 -ΔΔCt The relative transcription levels of key genes involved in pullulan synthesis were calculated under different carbon sources.

[0047] Specifically: the experimental data were standardized using the internal reference gene β-actin and the transcriptional level data were compared with the control group; the control group was a bacterial sample that was in the logarithmic growth phase after activation treatment at the starting time of the inoculation operation.

[0048] 6. Pullulan yield determination

[0049] Centrifuge 25 mL of fermentation broth at 8000 rpm for 20 minutes to remove cells. Add two times the amount of ethanol to the supernatant, and maintain it at 4°C for 12 hours to precipitate pullulan from the culture supernatant. Centrifuge the precipitate at 8000 rpm for 20 minutes at 4°C, dry it at 80°C overnight, and then weigh it.

[0050] Table 1. Key enzymes in the synthesis of pullulan

[0051]

[0052] Table 2. qRT-PCR primer design

[0053]

[0054]

[0055] Experimental results:

[0056] Aureobasidium pullulans ATCC 15233 was cultured for 48 hours under fermentation conditions with 8% glycerol and sucrose as carbon sources, respectively. Real-time fluorescence quantitative PCR was used to detect the relative transcription levels of key enzymes involved in pullulan synthesis using the primers listed in Table 2.

[0057] like Figure 1 As shown, Figure 1As shown, 8% sucrose can induce the relative transcription levels of key genes in metabolic pathways. Transcription levels of each target gene were normalized using the internal reference gene β-actin (i.e., relative transcription levels), and the relative transcription data for each gene were compared with those of a control group. The control group consisted of bacterial samples in the logarithmic growth phase after activation treatment at the start of the inoculation procedure. Transcription of the GluK, PGM, UGT, and AmAGS2 genes was significantly induced, while transcription levels of the UGP and PUL genes were relatively low. Regarding isozyme genes, GluK-1 transcription was found to be upregulated compared to GluK-2, PGM-2 transcription was upregulated compared to PGM-1, and UGT-1 transcription was upregulated compared to UGT-2. Transcription levels of both AmAGS2-1 and AmAGS2-2 were relatively high, especially AmAGS2-2.

[0058] Budding Aureobasidium pullulans can express pullulan in large quantities using sucrose as a substrate. To further demonstrate the relationship between the differences in the transcription levels of key enzymes (GluK-1, PGM-2, UGT-1, and AmAGS2) in the pullulan synthesis process and pullulan synthesis, Budding Aureobasidium pullulans ATCC 15233 was cultured using glycerol and sucrose for different time periods.

[0059] The fermentation conditions of Aureobasidium pullulans ATCC 15233 were 1%, 5% and 8% glycerol or sucrose as carbon sources for 24h, 48h and 72h. Figure 2 As shown. Figure 2 As shown in A and 2B, under the fermentation conditions of 1%, 5% and 8% glycerol and sucrose as carbon sources for 24h, 48h and 72h, it was found that the biomass of the budding Aureobasidium strain was not much different, and the highest biomass level was reached at 48 hours. This shows that the budding Aureobasidium strain can use glycerol and sucrose for rapid growth, and the change of carbon source and culture time has no effect on the growth of the strain. However, the pullulan yield is affected by the type and concentration of substrate ( Figure 2 C and 2D). Under glycerol conditions, the yield of pullulan was low and remained almost constant with prolonged reaction time. However, under sucrose culture conditions, the yield of pullulan increased with increasing sucrose concentration and prolonged culture time, reaching a maximum yield of 9.06 g after 72 hours of culture on 8% sucrose.

[0060] Combine Figure 1 and Figure 2 The results showed that the transcription levels of key enzymes (GluK-1, PGM-2, UGT-1, AmAGS2) in the pullulan synthesis process in Aureobasidium pullulans were positively correlated with the production level of pullulan.

[0061] In order to further verify the transcription levels of the above key enzymes at different stages, the transcription levels of different enzymes fermented under different carbon source gradients for 48 hours were detected by real-time fluorescence quantitative PCR. Figure 3 As shown in the figure, under fermentation conditions that can produce high pullulan (fermentation of Aureobasidium pullulans using sucrose as substrate), GluK-1, PGM-2, UGT-1, AmAGS2 (especially GluK-1, UGT-1 and AmAGS2-2) can show significantly increased transcription levels compared with other enzymes in the pullulan synthesis process, especially under the condition of 8% substrate concentration.

[0062] In addition, the transcription levels of the above key enzymes of Aureobasidium brevicornum at different culture times under 8% substrate concentration were further tested. Figure 4 As shown. Under fermentation conditions that enable high pullulan production (fermentation of Aureobasidium pullulans using sucrose as a substrate), GluK-1, PGM-2, UGT-1, and AmAGS2 (especially GluK-1, UGT-1, and AmAGS2-2) exhibited significantly elevated transcription levels compared to other enzymes involved in pullulan biosynthesis, particularly at an 8% substrate concentration for 48-72 hours.

[0063] The above results indicate that in the process of pullulan production by Aureobasidium pullulans, monitoring the transcription levels of GluK-1, PGM-2, UGT-1, and AmAGS2 (especially GluK-1, UGT-1, and AmAGS2-2) using real-time fluorescence quantitative PCR technology can reflect the pullulan synthesis efficiency during Aureobasidium pullulans fermentation.

[0064] The above embodiments are intended only to illustrate the technical concepts and features of the present invention. Their purpose is to enable those skilled in the art to understand the contents of the present invention and implement them accordingly. They are not intended to limit the scope of protection of the present invention. Any equivalent changes or modifications made in accordance with the spirit of the present invention are intended to be covered by the scope of protection of the present invention.

Claims

1. A method for detecting pullulan production by a strain using real-time fluorescence quantitative PCR (qRT-PCR) technology, wherein the method comprises detecting the transcription level of a key enzyme in pullulan synthesis by real-time fluorescence quantitative PCR (qRT-PCR) during the process of pullulan fermentation by the strain to reflect the fermentation level of pullulan; characterized in that: The strain is Aureobasidium Pullulans, and the key enzyme for pullulan synthesis is selected from one or any several of GluK-1 (glucokinase), PGM-2 (α-phosphoglucomutase), UGT-1 (glucosyltransferase), and AmAGS2-2 (glucan synthase); an increase in the transcription level of the key enzyme for pullulan synthesis reflects an increase in the level of pullulan production produced by the strain through fermentation.

2. The method according to claim 1, characterized in that The key enzyme for pullulan synthesis is selected from one or any combination of GluK-1, UGT-1, and AmAGS2-2.

3. The method according to claim 1 or 2, characterized in that The nucleic acid sequence of the GluK-1 is shown in SEQ ID No. 1; the nucleic acid sequence of the PGM-2 is shown in SEQ ID No. 2; the nucleic acid sequence of the UGT-1 is shown in SEQ ID No. 3; and the nucleic acid sequence of the AmAGS2-2 is shown in SEQ ID No.

4.

4. The method according to claim 1 or 2, characterized in that qRT-PCR was used to detect the relative transcription levels of key enzymes in pullulan synthesis, where the relative transcription levels were compared with those of the internal control.

5. The method according to claim 4, characterized in that Preferably, the internal reference is β-actin.

6. The method according to claim 1 or 2, characterized in that The carbon source in the culture medium for the fermentation of the strain is sucrose.

7. The method according to claim 1 or 2, characterized in that After 24 h to 72 h of fermentation, the transcription levels of key enzymes involved in pullulan synthesis were detected.

8. The method according to claim 1 or 2, characterized in that The fermentation temperature of the strain is 25°C-35°C, preferably 28°C.

9. The method according to claim 1 or 2, characterized in that The increase in the level of pullulan produced by the strain can be determined by any one or more of the following methods (1)-(4): (1) the relative transcription level of GluK-1 is at least 400-fold higher than that of the control group; (2) the relative transcription level of PGM-2 is at least 15-fold higher than that of the control group; (3) the relative transcription level of UGT-1 is at least 50-fold compared to the control group; (4) The relative transcription level of AmAGS2-2 was at least 400 times higher than that of the control group.

10. The method according to claim 9, characterized in that The control group is the relative transcription level of each target gene at the starting time point of the strain fermentation.

Images