Koi gender specific DNA marker and application thereof

Abstract

The invention belongs to the technical field of fish genetic sex identification and sex control in aquatic genetic breeding, and particularly discloses a cyprinus carpio sex specific DNA marker and application thereof. The method comprises the following steps: systematically positioning a sex determination site of Cyprinus carpio by virtue of a whole genome re-sequencing technology, and screening to obtain a cyprinus carpio sex specific DNA (Deoxyribose Nucleic Acid) marker; the genotype sex of the fancy carp is detected under the condition that excessive damage is not caused to the fancy carp body by cutting the fin ray to detect the DNA marker, the gentle and minimally invasive fish sex identification method is developed, the method can accurately identify the sex of the fancy carp, meanwhile, damage to the fish is reduced, and the method has important industrial value and is worthy of popularization and application. And a new thought is provided for development of a fancy carp sex control breeding technology.

Description

Technical Field

[0001] The invention belongs to the technical field of fish genetic sex identification and sex control in aquatic genetic breeding, and particularly relates to a koi sex-specific DNA marker and application thereof. Background Art

[0002] Koi (Cyprinus carpio), an important commercial fish in the Cypriniformes order, Cyprinidae family, and genus Cyprinus, are renowned for their sleek physique, vibrant colors, varied patterns, and majestic swimming style. They are known as "living jewels in the water" and "swimming works of art," and possess both high ornamental and economic value. This species has an XX / XY sex determination system, with females possessing homozygous (XX) sex chromosomes and males possessing heterozygous (XY) sex chromosomes. In natural reproduction, females produce only eggs containing X chromosomes, while males can produce sperm containing either X or Y chromosomes. Fertilization results in either XX female or XY male offspring. In artificial breeding, parental sex selection and family establishment are key steps in selecting high-quality seedlings.

[0003] However, koi fish take two to three years to reach sexual maturity, making it difficult to identify their sex through traditional external morphological characteristics during the larval and fingerling stages. This lack of discernible morphological sex characteristics leads to high errors in traditional identification methods, while identification through gonads requires damaging the fish. This technical bottleneck has severely hampered research progress in artificial breeding and improved stock selection of koi fish.

[0004] Currently, there are no systematic reports on the screening of sex-specific molecular markers and genetic sex determination in koi, both domestically and internationally. Therefore, developing rapid identification techniques based on sex-specific molecular markers and establishing agarose gel electrophoresis analysis methods suitable for on-site testing in aquaculture are of great theoretical and practical significance for achieving precise sex ratio control, identifying sex chromosomes, and studying the mechanisms of sex determination. This technological breakthrough will become a key technical support for promoting the high-quality development of the koi aquaculture industry. Summary of the Invention

[0005] The present invention aims to provide a koi sex-specific DNA marker and its application. The koi sex-specific DNA marker is discovered by screening microsatellite primers for male and female koi fish; and the DNA marker is applied to koi genetic sex identification.

[0006] In order to achieve the above object, the specific technical solutions adopted by the present invention are as follows:

[0007] In a first aspect, the present invention provides a koi sex-specific DNA marker, which is a SNP site located at position 14697 of koi chromosome 18 (ChrB18), specifically the T / A polymorphic site at position 390 of the sequence shown in SEQ ID NO: 1; the genotype of females at this site is TT (the sequencing peak is a single T signal), and the genotype of males at this site is AT (the sequencing peak is an A / T double peak signal).

[0008] In a second aspect, the present invention provides primers for amplifying the above-mentioned koi sex-specific DNA markers, wherein the sequences of the primers are:

[0009] Forward primer: AGAGGGGTCCAATTATGTCC (SEQ ID NO: 2);

[0010] Reverse primer: GGTAGGGTTGCCACTATTCC (SEQ ID NO: 3).

[0011] In a third aspect, the present invention provides a kit containing primers for the above-mentioned koi sex-specific DNA markers.

[0012] In a fourth aspect, the present invention provides the use of the above-mentioned koi sex-specific DNA markers, primers or kits in koi sex identification.

[0013] In a fifth aspect, the present invention provides a method for identifying the sex of koi, comprising the following steps:

[0014] S1. Take the koi carp sample to be tested and cut off the fins for DNA extraction;

[0015] S2. PCR amplification of the extracted DNA was performed using primers with sequences as shown in SEQ ID NOs: 2-3;

[0016] S3. The PCR amplification products are detected by agarose gel electrophoresis, and the size of the electrophoretic bands in the electrophoretic pattern is used to determine whether the sample is female or male.

[0017] Furthermore, in step S2, the reaction system for PCR amplification is: Primer STAR max premix 25 μl, DEPC water 22 μl, two 10 μM primers 1 μl each, and DNA template 1 μl.

[0018] Furthermore, in step S2, the reaction procedure of PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 15 s, annealing at 59°C for 20 s, extension at 72°C for 20 s, 35 cycles; final extension at 72°C for 10 min.

[0019] Furthermore, in step S3, the method for determining the sex of the sample based on the size of the electrophoretic bands in the electrophoretic pattern is as follows: if there is only an electrophoretic band of 745 bp, it is female; if there are three electrophoretic bands of 745 bp, 320 bp and 425 bp, it is male.

[0020] The present invention has the following beneficial effects:

[0021] The present invention detects the genotypic sex of koi by clipping fin rays and detecting DNA markers without causing excessive damage to the koi body, thus developing a gentle and minimally invasive method for fish sex identification. This method not only reduces damage to fish, but also provides a scientific basis for producing all-female offspring. The research on this identification technology has important industrial value and also provides new ideas for the development of koi sex-controlled breeding technology. Based on whole genome sequencing technology, this study significantly expanded the library of koi sex-related molecular markers, laying an important foundation for analyzing its sex determination mechanism and promoting sex-controlled breeding. This achievement not only has important practical value for the koi aquaculture industry, but also provides a technical paradigm that can be used as a reference for the study of sex markers of other economic fish.

[0022] At the industrial application level, breakthroughs in early sex identification technology have enabled breeders to implement precise management strategies, such as optimizing feeding regimens and controlling stocking density based on gender differences, significantly improving breeding efficiency and economic benefits. Furthermore, this technology helps maintain gender balance in koi populations and prevent genetic degradation caused by sex imbalances. For high-value koi strains, cultivating single-sex populations (e.g., all-female populations) through sex control technology can fully leverage their growth advantages and ornamental properties, further tapping into market potential.

[0023] From the perspectives of both theoretical value and application prospects, research on koi sexing technology has dual significance: first, developing minimally invasive and efficient sexing methods not only meets animal welfare requirements but also provides technical support for the green development of aquaculture. Second, the establishment and optimization of relevant technical systems provides important insights for the evolutionary study of sex determination mechanisms in teleost fishes and their cross-species applications. In the future, as the accuracy and efficiency of molecular marker screening continue to improve, sexing technology is expected to become a key driver of the transformation and upgrading of the aquaculture industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : Flowchart of the method for screening specific DNA markers for male and female koi.

[0025] Figure 2 : Example 1 SNP density distribution diagram during DNA marker screening.

[0026] Figure 3: KEGG analysis results in the DNA marker screening process of Example 1.

[0027] Figure 4 : GO analysis results in the DNA marker screening process of Example 1.

[0028] Figure 5 : Example 1 Chromosome location map of candidate genes during DNA marker screening.

[0029] Figure 6 : The electrophoresis results of the DNA markers screened and verified in Example 2 to detect the sex of koi. DETAILED DESCRIPTION

[0030] The present invention uses bioinformatics methods to compare and identify specific DNA markers between male and female koi. Using this marker, amplification of the two fish reveals specific DNA fragments in males, while fragments of this size are absent in females. This difference in fragment size between male and female fish can be used to determine sex.

[0031] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0032] Example 1: Screening of DNA markers

[0033] This example provides a method for screening specific DNA markers between male and female koi fish, and systematically locates the sex-determining locus of koi fish through whole genome resequencing technology. The process is as follows: Figure 1 The specific process is as follows:

[0034] 1. Sample processing and sequencing

[0035] Genomic DNA was extracted from male and female koi fish; the extracted DNA was sequenced using a whole-genome resequencing platform to generate massive amounts of raw sequencing data.

[0036] 2. Data analysis and candidate gene screening

[0037] Based on WGS technology, 40 koi were tested for genomic variation. The test results showed an average sequencing depth of 12.97× and a coverage of over 98%. 3,091,165,146 clean reads were obtained for male samples and 3,089,671,702 clean reads were obtained for female samples. The Q30 values ​​were both above 96.6%, and the data quality met the requirements for subsequent analysis. The SNP density distribution diagram is shown below. Figure 2 As shown, by integrating KEGG pathway annotation and GO functional enrichment analysis ( Figure 3-4), systematically analyze the functions of genes associated with the screening sites, focusing on key pathways and biological processes such as sex hormone metabolism and sex determination, and screen out core genes related to sex determination as candidate targets based on multi-dimensional literature evidence, and screen out candidate genes wnt7ba, mprs30, sox6 and gnrhr4 ( Figure 5 ).

[0038] 3. Verification and result analysis

[0039] The SNP sites on the candidate genes were verified through PCR-RFLP and Sanger sequencing. PCR-RFLP involves designing primers to amplify the DNA fragment containing the SNP site, digesting the PCR product with enzymes, and performing electrophoresis to identify male and female band differences. Sanger sequencing involves directly sequencing the PCR product and comparing peaks to verify the SNP genotype. Ultimately, SNP3 was identified as a marker for distinguishing male and female koi.

[0040] In summary, this example screened out the DNA marker SNP 3, which is located at position 14697 of chromosome 18 (ChrB18) of koi carp, specifically the T / A polymorphic site at position 390 of the sequence shown in the following SEQ ID NO: 1; the genotype of female koi at this site is TT (sequencing peak is a single T signal), and the genotype of male koi at this site is AT (sequencing peak is an A / T double peak signal).

[0041] AGAGGGGTCCAATTATGTCCTGTCATGAATTTCAGTTGAAAAATTCTTTAGAATATCTACTAATGAGCTGTATTGGAAAATGAATGTCATATAGGTTTTAAATGACTTGAGGGTGAGTAAATTATGACAAATTTGCATTTGTGGGTAAACTATACCTTTAAATACTGTAGTGAAGTAAAATACTTGTATAAAAA CATATTTTCACTGCAAATTTATTAAAAATCATCTTGTTTTACAGTATCATCAAAGGAAGTCCACTTACGGCGTTCCAACAGCAACATCCCAAAGGCCCGTATGAGGACTTTGAAAATGAGCATAGTCATAGTGACCTCTTTCATAGTTTGCTGGACACCATACTACTTGCTGGGTCTCTGGTACTGGTTCCTTCC TGAGGATTTAGAAGAGACTGTTTCTCACTCACTCACTCACATACTGTTTATTTTCGGACTCTTTAATGCGATTCTGGATCCCATCACTTATGGCCTCTTCACCATCCAAAAGGACTGAAGCGCTACTGTCGCAATGCGGTTGTACTAACCGAGTCAGAGAATAATTCAATCATGACGGGCT

[0042] CAATGAAATGCTCACCATCCCCATTTCGCATGAAAAGAGTGACCCAGACCA

[0043] GTGCAGGAGCTGTCCCAGAGCAGAATGCGGTGAGTGGGGAAGATAAGAATCAAGCTGACAGTGAAAACAAGGAATAGTGGCAACCCTACCAATCC (SEQ ID NO: 1)

[0044] Example 2: DNA marker effect verification

[0045] In this example, the DNA markers screened in Example 1 were used to identify the sex of koi. The tail fin of the koi sample to be tested was cut off, DNA was extracted, and PCR verification was performed. The sex was determined based on the bands. The specific process is as follows:

[0046] 1. Primer design

[0047] Primers were designed for the DNA marker SNP 3 screened in Example 1. The primer sequences are shown in Table 1.

[0048] Table 1 Primer information for SNP 3 marker

[0049]

[0050] 2. Sample DNA Extraction

[0051] Ten female and ten male koi were used as experimental subjects. Fin rays were clipped from each koi and genomic DNA was extracted from the tail fin tissue using a DNA extraction kit (TIANamp Genomic DNA Kit) following the manufacturer's instructions. The specific steps are as follows:

[0052] (1) After thawing the fin ray tissue block, wash it with physiological saline to remove impurities, and take about 0.5g of sample and place it in a 1.5ml centrifuge tube.

[0053] (2) Add 0.45 ml of TES and mix well. Then add 50 ul of SDS (10%) and 5.0 ul of proteinase K (20 mg / ml). Mix well and incubate at 56°C for 4-6 hours, shaking every 2 hours.

[0054] (3) After standing at room temperature, add an equal volume of saturated phenol (500 μl), mix well, and centrifuge at 10,000 rpm for 10 minutes to separate the aqueous and organic phases. Pipette the upper aqueous phase into a new 1.5 ml centrifuge tube.

[0055] (4) Add an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) mixture, mix thoroughly by inversion, and centrifuge at 10,000 rpm for 10 minutes. Transfer the upper layer to a new 1.5 ml centrifuge tube.

[0056] (5) Add an equal volume of chloroform-isoamyl alcohol (24:1), mix well, and centrifuge at 10,000 rpm for 10 minutes. Transfer the supernatant to a new 1.5 ml centrifuge tube.

[0057] (6) Add 2.5 volumes of -20°C pre-cooled anhydrous ethanol to precipitate the DNA.

[0058] (7) Use a high-speed centrifuge at 12,000 rpm for 10 minutes to remove ethanol.

[0059] (8) After washing with 75% ethanol at -20°C, centrifuge at 10,000 rpm for 5 minutes to remove the ethanol and dry the DNA at 55°C.

[0060] (9) Add appropriate amount of TE to dissolve the DNA and store at -20℃ for later use.

[0061] 3. PCR amplification

[0062] PCR amplification was performed using the designed primers and the extracted DNA. The PCR amplification reaction system is shown in Table 2, and the PCR amplification reaction procedure is shown in Table 3.

[0063] Table 2 PCR amplification reaction system

[0064]

[0065] Table 3 PCR amplification reaction program

[0066]

[0067] 4. Determine gender by electrophoresis

[0068] In order to verify the accuracy of the SNP3 site as a sex-specific marker, the PCR product was recovered, and the recovered product was digested with a high-fidelity enzyme and then separated and analyzed by 1% agarose gel electrophoresis (120 V, 35 min).

[0069] The results showed that a 745 bp amplicon was amplified in 10 females; and a 745 bp amplicon was amplified in 10 males, accompanied by two specific amplicon fragments of 320 bp and 425 bp. Figure 6 The results showed that the corresponding banding patterns based on sex-specific molecular markers were completely consistent with the sex determined by observation of reproductive products (sperm / egg), confirming that SNP3 can be used as a specific molecular marker for koi sex identification. Subsequent studies will continue to expand the sample size to verify the genetic stability of heterozygous individuals.

[0070] This specific implementation is merely an explanation of the present invention and is not a limitation of the present invention. Any changes made by those skilled in the art after reading the specification of the present invention will be protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A koi sex-specific DNA marker, characterized in that: The polymorphic site is located at position 14697 of chromosome 18 of koi carp, specifically at position 390 of the sequence shown in SEQ ID NO: 1; the genotype of females at this site is TT, and the genotype of males at this site is AT.

2. A primer for amplifying the koi sex-specific DNA marker according to claim 1, characterized in that: The sequences of the primers are: Forward primer: AGAGGGGTCCAATTATGTCC; Reverse primer: GGTAGGGTTGCCACTATTCC.

3. A kit containing primers for the koi sex-specific DNA marker according to claim 2.

4. Use of the koi sex-specific DNA marker according to claim 1, the primer according to claim 2, or the kit according to claim 3 in koi sex identification.

5. A method for identifying the sex of koi, characterized in that: The following steps are involved: S1. Take the koi carp sample to be tested and cut off the fins for DNA extraction; S2. performing PCR amplification on the extracted DNA using the primers described in claim 2; S3. The PCR amplification products are detected by agarose gel electrophoresis, and the sample is determined to be female or male based on the size of the electrophoretic bands in the electrophoretic pattern.

6. The method for identifying the sex of koi according to claim 5, wherein: In step S2, the reaction system for PCR amplification is: Primer STAR max premix 25 μl, DEPC water 22 μl, two 10 μM primers 1 μl each, and DNA template 1 μl.

7. The method for identifying the sex of koi according to claim 5, wherein: In step S2, the reaction program of PCR amplification is as follows: preliminary denaturation at 94°C for 5 min; denaturation at 94°C for 15 s, annealing at 59°C for 20 s, and extension at 72°C for 20 s, for 35 cycles; and final extension at 72°C for 10 min.

8. The method for identifying the sex of koi according to claim 5, wherein: In step S3, the method for determining the sex of the sample based on the size of the electrophoretic bands in the electrophoretic pattern is as follows: if there is only an electrophoretic band of 745 bp, it is female; if there are three electrophoretic bands of 745 bp, 320 bp and 425 bp, it is male.

Images