Application of BOP1 in prognosis prediction and treatment of bile duct cancer

By detecting BOP1 expression levels to predict the prognosis of cholangiocarcinoma and using BOP1 inhibitors for treatment, the problem of lack of effective molecular markers and drug targets in the treatment of cholangiocarcinoma was solved, and precise treatment and prognosis prediction were achieved.

CN120666027APending Publication Date: 2025-09-19UNIV OF SCI & TECH OF CHINA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510913031.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-03
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Cholangiocarcinoma is highly hidden and invasive in its early stages. Existing technologies lack effective molecular markers and drug targets, resulting in poor prognosis for patients and difficulty in achieving precise treatment.

Method used

BOP1 is used as a molecular marker to predict the prognosis of cholangiocarcinoma by detecting its expression level, and BOP1 inhibitors are used for treatment, including nucleic acid inhibitors and protein inhibitors to reduce the activity of BOP1.

Benefits of technology

High expression of BOP1 is closely related to poor prognosis in patients with cholangiocarcinoma. Knocking down or inhibiting BOP1 expression can inhibit cancer cell proliferation and growth, achieving precise treatment effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120666027A_ABST
    Figure CN120666027A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biomedicine, particularly relates to application of BOP1 in prognosis prediction and treatment of bile duct cancer, provides a product for predicting prognosis of bile duct cancer, and also provides a pharmaceutical composition for treating bile duct cancer. The application proves that the BOP1 can effectively predict the prognosis of the cholangiocarcinoma by combining bioinformatics analysis with clinical cases. Cell experiments and animal experiments prove that knock-down of the BOP1 can effectively inhibit proliferation and growth of bile duct cancer cells, and inhibition of expression of the BOP1 can achieve the effect of treating bile duct cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the field of biomedical technology, and specifically relates to the application of BOP1 in the prognosis prediction and treatment of bile duct cancer. Background Art

[0002] Cholangiocarcinoma (CCA) is a highly aggressive malignant tumor of the hepatobiliary system. It originates from bile duct epithelial cells and accounts for approximately 3% of gastrointestinal malignancies. Its aggressive nature is associated with a five-year survival rate of less than 10%. The peak age of onset is around 70 years, with slightly more men than women affected. Its incidence is second only to hepatocellular carcinoma (HCCA) among hepatobiliary malignancies. Based on the anatomical location of the lesion, it can be divided into three subtypes: intrahepatic cholangiocarcinoma (iCCA), perihilar cholangiocarcinoma (pCCA), and distal cholangiocarcinoma (dCCA). Each CCA subtype has distinct risk factors, clinical presentations, management strategies, and epidemiological trends. Over the past few decades, the age-standardized incidence of iCCA has steadily increased in most parts of the world.

[0003] Given the high occult nature of cholangiocarcinoma in its early stages, its high aggressiveness, intra- and inter-tumor heterogeneity and chemoresistance, and its poor prognosis, it is crucial to identify effective molecular markers and specific drug targets that influence cholangiocarcinoma prognosis in order to provide precise and personalized treatment options for patients and improve their prognosis. Summary of the Invention

[0004] In view of this, the primary purpose of this application is to provide the application of BOP1 in the prognosis prediction and treatment of bile duct cancer. This application proves through multiple studies that BOP1 can achieve prognosis prediction and treatment of bile duct cancer, and it has significant effects.

[0005] In order to achieve the above objectives, this application adopts the following technical solutions: In one aspect, the present application discloses a product for predicting the prognosis of bile duct cancer, wherein the product contains a reagent for detecting the expression level of BOP1 in a biological sample.

[0006] Another aspect of the present application discloses a system or device for predicting the prognosis of bile duct cancer, the system or device comprising: a data acquisition unit, configured to acquire the expression level of BOP1 in a sample; The data processing unit obtains the prognosis prediction result of bile duct cancer according to the expression of BOP1.

[0007] Another aspect of the present application discloses a pharmaceutical composition for treating bile duct cancer, wherein the pharmaceutical composition contains a BOP1 inhibitor.

[0008] Another aspect of the present application discloses at least one of the following applications: a: Use of a reagent for detecting the expression level of BOP1 in a biological sample or the product described above in the preparation of a tool for predicting the prognosis of cholangiocarcinoma; b: Use of the BOP1 inhibitor or the pharmaceutical composition described above in the preparation of a drug for treating bile duct cancer.

[0009] Beneficial effects of this application: The present application discloses the application of BOP1 in the prognosis prediction and treatment of cholangiocarcinoma. BOP1 is highly expressed in cholangiocarcinoma tissue, and the overall survival and disease-free survival of cholangiocarcinoma patients with high BOP1 expression are significantly shortened. High expression of BOP1 is closely related to the poor prognosis of cholangiocarcinoma patients. The prognosis of cholangiocarcinoma patients can be predicted by the expression of BOP1. If the patient's BOP1 expression level is high, it indicates a poor prognosis of cholangiocarcinoma.

[0010] At the same time, cell experiments and animal model experiments determined that BOP1 is a cancer-promoting gene for bile duct cancer. Knocking down or inhibiting the expression of BOP1 can inhibit the proliferation and growth of bile duct cancer cells, thereby achieving the effect of treating bile duct cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The results of the analysis of the high expression of BOP1 in cholangiocarcinoma and its correlation with the prognosis of patients are shown in Figure 2. Figure 1 Middle A is the result of TCGA database analysis (compared with normal tissue, p<0.05, t test); Figure 1 Middle B is the immunohistochemical staining of 32 tissue pairs from patients with cholangiocarcinoma and the statistical results bar graph (n = 32, p<0.001 ; Scale bar: 50 μm; Scoring method: H-score).

[0012] Figure 2 Figure 2 is the relationship between BOP1 expression level and survival prognosis of patients with cholangiocarcinoma, where: Figure 2 A is the overall survival curve of 32 pairs of cholangiocarcinoma patients (n = 32, Log-rank test, p = 0.0172 ); Figure 2 Middle B is the disease-free survival curve of 32 pairs of cholangiocarcinoma patients (n = 32, Log-rank test, p = 0.0032 ).

[0013] Figure 3The results show the effects of BOP1 knockdown on gene expression, protein levels and cell growth in QBC939 cell lines. Figure 3 A in the figure shows the results of qPCR detection of BOP1 gene expression level (t test, p<0.001 ); Figure 3 Middle B is a Western Blot analysis of BOP1 protein expression in QBC939 cell lines after BOP1 knockdown. Figure 3 Middle C shows the images and corresponding statistical graphs (t-test, p = 0.0025 ).

[0014] Figure 4 The results show the effect of BOP1 knockdown on the colony formation ability of QBC939 and RBE cell lines. Figure 4 A is the result of the cell colony formation experiment of QBC939 cell line and the corresponding mathematical statistics (t test, p<0.001 ); Figure 4 Middle B is the result of the cell colony formation experiment using RBE cell line and the corresponding mathematical statistics (t test, p<0.001 ).

[0015] Figure 5 The results show the effect of BOP1 knockdown on the proliferation of QBC939 and RBE cell lines, among which, Figure 5 A is the cell proliferation curve of the CCK-8 cell proliferation assay of the QBC939 cell line (t test, p<0.01 ); Figure 5 Middle B is the cell proliferation curve of the CCK-8 cell proliferation assay of the RBE cell line (t test, p<0.001 ).

[0016] Figure 6 The results show the effect of BOP1 knockdown on the growth of subcutaneous tumors in QBC939 cell line in nude mice. Figure 6 A in the middle is the tumor proliferation curve ( p<0.001 ); Figure 6 Middle B shows the tumor morphology on day 28 of the experiment; Figure 6 C in the middle is for Figure 6 Middle B Tumor volume measurement results after autopsy (t test, p = 0.0099 ). Figure 6 D is Figure 6 The weight of the tumor after autopsy (t test, p = 0.00121 ). DETAILED DESCRIPTION

[0017] The following will clearly and completely describe the embodiments of the present application. The technical solutions in the embodiments described below are exemplary and are only possible technical implementations of the present application, not all possible implementations. Those skilled in the art can fully combine the embodiments of the present application to obtain other embodiments without creative work, and these embodiments are also within the scope of protection of the present application.

[0018] The first aspect of the present application discloses a product for predicting the prognosis of bile duct cancer, wherein the product contains a reagent for detecting the expression level of BOP1 in a biological sample.

[0019] BOP1 (Block of proliferation 1) is a highly conserved non-ribosomal protein primarily localized to the nucleolus and involved in ribosome biogenesis and cell proliferation regulation. The BOP1 described in this application encompasses full-length, unprocessed BOP1, as well as any form of BOP1 derived from cellular processing. The BOP1 described in this application can be derived from humans or any other vertebrate species, including but not limited to mammals, such as primates or rodents (e.g., rats and mice).

[0020] In this application, the prognosis refers to the expectation regarding medical development (e.g., the possibility of long-term survival, disease-free survival rate, etc.), including a good prognosis or a poor prognosis. The good prognosis includes disease remission such as a disease-free state, and disease improvement such as bile duct cancer regression or stabilization; the poor prognosis includes disease progression such as recurrence, bile duct cancer growth, metastasis, and drug-resistant mortality.

[0021] In this application, the expression level generally refers to the amount of a biomarker or biomarker in a biological sample or specimen. Expression generally refers to the process by which information (e.g., genetic code and / or epigenetic information) is converted into structures that exist and function in cells. This can be the expression level of a gene, such as mRNA, or a protein.

[0022] In this application, the product refers to an in vitro detection product, and specific examples include but are not limited to a kit or a chip.

[0023] As an example, the product is a kit. A kit is a set of components provided in the context of a system for sequencing nucleotides and / or isolating nucleotide sequences and / or diagnosing a subject suffering from a disease or infection based on the presence, absence, and / or amount of expressed nucleotide sequences from a sample or cell. The kit can be a gene kit or a protein kit. In addition to the necessary reagents for detecting BOP1 expression levels, the kit may also contain components such as wash solutions, buffers, enzymes, controls, additives, instructions, or containers, depending on the detection technique. The specific configuration can be tailored to the needs.

[0024] In the present application, the biological sample is a bile duct cancer tissue of a subject, and the bile duct cancer is suitably intrahepatic bile duct cancer. The subject includes but is not limited to mammals, such as primates and rodents, and suitably, the subject suffers from bile duct cancer.

[0025] In the present application, the reagent for detecting the expression level of BOP1 contains primers that specifically amplify the BOP1 gene, a probe that specifically recognizes the BOP1 gene, or a binding agent that specifically binds to the protein encoded by BOP1.

[0026] Here, a primer refers to a short nucleic acid sequence, which usually has a short free 3' terminal hydroxyl group, which can form base pairs with a complementary template and serve as the starting point for replicating the template.

[0027] A probe is a molecule that can bind to a specific sequence or subsequence or other portion of another molecule. Unless otherwise indicated, a probe generally refers to a polynucleotide probe that can bind to another polynucleotide (often referred to as a target polynucleotide) through complementary base pairing.

[0028] A binding agent refers to a naturally occurring or non-naturally occurring molecule that specifically binds to a target. Specific examples of specific binding agents in this application include, but are not limited to, proteins, peptides, nucleic acids, carbohydrates, and lipids.

[0029] As an example, the reagent for detecting the expression level of BOP1 in the present application contains a binding agent that specifically binds to the protein encoded by BOP1, for example, it can be a receptor for protein BOP1, an antibody against protein BOP1, a peptide antibody against protein BOP1, a bispecific dual binding agent or a bispecific antibody form, without special limitations.

[0030] A second aspect of the present application discloses a system or device for predicting the prognosis of bile duct cancer, the system or device comprising: a data acquisition unit, configured to acquire the expression level of BOP1 in a sample; The data processing unit obtains the prognosis prediction result of bile duct cancer according to the expression of BOP1.

[0031] Compared with normal samples (such as adjacent cancer samples), if the expression level of BOP1 in cholangiocarcinoma tissue is high, it indicates a poor prognosis for cholangiocarcinoma.

[0032] The third aspect of the present application provides a pharmaceutical composition for treating bile duct cancer, wherein the pharmaceutical composition contains a BOP1 inhibitor.

[0033] In the application, the inhibitor refers to any substance that can reduce the activity of BOP1 protein, reduce the expression of BOP1 gene or protein, and inhibit the transcription and translation of BOP1 gene. These substances can be nucleic acid inhibitors or protein inhibitors, thereby reducing or downregulating the expression of BOP1 to achieve the treatment of bile duct cancer.

[0034] Nucleic acid inhibitors can be interfering molecules that target BOP1 or its transcripts and are capable of inhibiting BOP1 gene expression or transcription. Specific examples include, but are not limited to, shRNA (short hairpin RNA), siRNA (small interfering RNA), dsRNA, microRNA, antisense nucleic acid, or constructs capable of expressing or forming such shRNA, small interfering RNA, dsRNA, microRNA, or antisense nucleic acid. In some specific examples, the nucleic acid inhibitor is shRNA; for example, the sequence of the shRNA is shown in SEQ ID NO. 1, 2, or 3.

[0035] The protein inhibitor may be a substance that specifically binds to the BOP1 protein, for example, an antibody or ligand that can inhibit the activity of the BOP1 protein.

[0036] It is understood that the pharmaceutical composition in the present application further includes at least one pharmaceutically acceptable excipient.

[0037] These excipients include, but are not limited to, carriers, binders, disintegrants, diluents, surfactants, lubricants, fillers, etc. Specific excipients can be selected according to the dosage form and in accordance with the corresponding guidelines, and will not be described in detail here.

[0038] A fourth aspect of the present application provides at least any one of the following applications: a: Use of a reagent for detecting the expression level of BOP1 in a biological sample or the product described above in the preparation of a tool for predicting the prognosis of cholangiocarcinoma; b: Use of a BOP1 inhibitor or the pharmaceutical composition described above in the preparation of a drug for treating bile duct cancer.

[0039] The present application is further illustrated below through specific examples. It should be noted that the following specific examples are only for illustrative purposes and do not limit the scope of the present application in any way.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0041] In addition, unless otherwise specified, methods without specific conditions or steps are generally carried out according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer, and the reagents and materials used are all commercially available.

[0042] Example 1 Expression of BOP1 in cholangiocarcinoma and its application in prognosis prediction of cholangiocarcinoma In this example, the expression of BOP1 in cholangiocarcinoma was analyzed using online databases and clinical cases.

[0043] 1.1 Analysis of BOP1 expression in cholangiocarcinoma and normal tissues using the TCGA database The corresponding datasets were searched in the TCGA database (The Cancer Genome Atlas database, website: https: / / www.cancer.gov / ccg / ) using Ensembl ID: ENSG00000261236.5. Expression data of 36 cholangiocarcinoma cases and 9 adjacent cancer cases were downloaded, and the online tool GEPIA was used for data analysis and screening.

[0044] The results are as follows Figure 1 As shown in Figure 2, it can be seen that the expression of BOP1 in cholangiocarcinoma tissue is significantly higher than that in normal tissue ( Figure 1 This indicates that BOP1 is highly expressed in cholangiocarcinoma tissues, suggesting that it may play a negative role in the occurrence and development of cholangiocarcinoma.

[0045] 1.2 Collection of clinical cases to analyze the high expression of BOP1 in cholangiocarcinoma and its correlation with patient prognosis 1.2.1 Sample Collection For this study, clinical samples of cholangiocarcinoma tissue and corresponding adjacent normal tissue were collected from the Department of Hepatobiliary Surgery at the First Affiliated Hospital of the University of Science and Technology of China (Anhui Provincial Hospital). After removal, the specimens were preserved in formalin for embedding and paraffin sectioning and then stored in liquid nitrogen for tissue protein extraction. A cDNA microarray containing 64 cancer and adjacent tissue samples (32 pairs) was obtained from Shanghai Xinchao Biotechnology Co., Ltd. This study was approved by the Medical Research Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China, approval number 2024-KY-337.

[0046] 1.2.2 Immunohistochemical staining Immunohistochemical staining was performed on 32 pairs of clinical samples. The specific steps are as follows: (1) Baking: Place the sample horizontally and bake at 60℃ for 30 minutes, then place it vertically and bake at 65℃ for 2 hours.

[0047] (2) Dewaxing and hydration: Soak the sections in xylene for 5 minutes, repeat 3 times; transfer the sections to 100% ethanol and soak for 5 minutes; soak the sections in 95%, 90%, 85%, and 80% ethanol in sequence, each for 5 minutes; rinse the sections with double-distilled water or PBST 3 times, each for 5 minutes.

[0048] (3) Inactivation of endogenous peroxidase: Soak in 3% hydrogen peroxide solution for 10 minutes; wash the sections with PBST three times, 5 minutes each time.

[0049] (4) Antigen retrieval: Prepare antigen retrieval solution (add 4.75 ml of citric acid antigen retrieval stock solution to 500 ml of double-distilled water); place the sections in the antigen retrieval solution and boil for 5 minutes; cool naturally to room temperature and then wash with PBST three times, each for 5 minutes.

[0050] (5) Tissue delineation: Use an immunohistochemistry pen to delineate the tissue area on the slice and place it in a humidified box to prevent water evaporation.

[0051] (6) Blocking: Prepare blocking solution with goat serum (Vector lab, Germany) and PBST in a ratio of 1:9; add 100 μl of blocking solution to each section and block at room temperature for 30 minutes to 1 hour; discard the blocking solution after blocking and wash the sections with PBST three times, each time for 5 minutes.

[0052] (7) Primary antibody incubation: Dilute the primary antibody Normal Goat Serum (005-000-121, Jackson ImmunoResearch) with blocking solution at a ratio of 1:50 to 1:200 according to the instructions: Add the diluted primary antibody solution, add 1-2 drops to each section, cover with sealing film: Place the sections in a humidified box and incubate in a refrigerator at 4°C overnight.

[0053] (8) Secondary antibody incubation: The next day, the sections were removed and washed three times with PBST for 5 minutes each time. Goat Anti-Rabbit IgG Antibody (H+L) (BA-1000, Vector lab, Germany) was diluted with blocking solution at a ratio of 1:200 and added dropwise to the sections. The sections were incubated at room temperature for 1 hour, and then washed three times with PBST for 5 minutes each time.

[0054] (9) ABC complex incubation: prepare ABC solution (add 2.5 ml PBS to a 5 ml light-proof EP tube, add 1 drop of solution A and 1 drop of solution B respectively, and vortex thoroughly to mix); add 100 μl ABC solution to the slice and cover with sealing film; incubate at room temperature for 30 minutes, and then wash with PBST three times, each time for 5 minutes.

[0055] (10) DAB color development: Prepare DAB solution (add 2.5 ml double-distilled water, 1 drop of DAB Buffer, 1 drop of horseradish peroxidase, and 2 drops of peroxidase to a 5 ml light-proof EP tube and shake thoroughly to mix); add DAB solution dropwise to the sections and observe the color development under a microscope. When the tissue turns brownish-yellow, immediately wash thoroughly with PBST to terminate the reaction.

[0056] (11) Nuclear staining: Immerse the sections in hematoxylin solution and stain for 30-90 seconds; rinse several times with double-distilled water or tap water to remove excess hematoxylin solution.

[0057] (12) Dehydration and sealing: Immerse the slices in 75%, 95%, and 100% ethanol in turn for 5 minutes each time; transfer to xylene and immerse for 3 times for 5 minutes each time; take out the slices and place them in a fume hood for 30 minutes to dry; seal the slices with a drop of neutral resin, observe and photograph them under a microscope after air drying, and use the H-score to score.

[0058] Scoring criteria: Positive cell percentage: no staining = 0, 0-1% = 1, 2%-10% = 2, 11%-30% = 3, 31%-70% = 4, 71%-100% = 5; Staining intensity: no staining = 0, weak staining = 1, moderate staining = 2, and strong staining = 3. The positive cell percentage score and the staining intensity score were added together to form a comprehensive score.

[0059] The results are as follows Figure 1 As shown in the results of immunohistochemical staining, it can be clearly seen that BOP1 is expressed in cholangiocarcinoma tissue ( Figure 1 The staining intensity in B) is significantly higher than that in adjacent normal tissues. The statistical results are shown in Figure 2. Figure 1 As shown in the bar graph in B ( p <0.001; scale bar: 50 μm; scoring method: H-score).

[0060] 1.2.3 Survival Curve (Kaplan-Meier Curve) Analysis The overall survival curve and disease-free survival curve of 32 pairs of cholangiocarcinoma patients under "1.2.1" were analyzed. Figure 2 shown.

[0061] In the overall survival curve analysis, the overall survival (OS) of the BOP1 high expression group was significantly shorter than that of the low expression group (n = 32; Log-rank test, p = 0.0172)( Figure 2 In the disease-free survival curve analysis, the disease-free survival (DFS) of the BOP1 high expression group was also significantly shorter than that of the BOP1 low expression group (n = 32; Log-rank test, p = 0.0032)( Figure 2 Middle B).

[0062] Based on the results of "Item 1.1" and "Item 1.2" in this example, it is proved that BOP1 is highly expressed in bile duct cancer tissue, and the overall survival and disease-free survival of bile duct cancer patients with high BOP1 expression are significantly shortened, indicating that BOP1 is a cancer-promoting gene, and its high expression is closely related to the poor prognosis of bile duct cancer patients. The prognosis of bile duct cancer patients can be predicted by the expression of BOP1. If the BOP1 expression level in the patient's bile duct cancer tissue is high, it indicates a poor prognosis of bile duct cancer.

[0063] Example 2 Application of BOP1 in the Treatment of Cholangiocarcinoma (Cell Experiment) In this example, a BOP1 knockdown cholangiocarcinoma cell line was constructed, and the therapeutic effect of BOP1 on cholangiocarcinoma was verified through three-dimensional cell culture, cell colony formation, and CCK8 cell experiments.

[0064] 2.1 Experimental Materials The QBC939 cell line was a kind gift from Professor Wang Shuguang of the Army Medical University of the Chinese People's Liberation Army. RBE and 293T cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. Cells were cultured in Dulbecco's Membrane Medium (DMEM) supplemented with 10% fetal bovine serum, 1% penicillin, and streptomycin in a cell culture incubator at 37°C and 5% CO2. Experiments were performed using cells with normal growth rates and good viability. Cell culture was maintained in a sterile environment, with regular medium changes and passage at a 1:3 ratio.

[0065] Among them, DMEM cell culture medium (high glucose) (G4511, Sigma), fetal bovine serum (F8687, Sigma).

[0066] 2.2 Experimental methods 2.2.1 Cell culture (1) Cell recovery After removing the previously frozen cells from the -80°C freezer, quickly thaw them in a 37°C water bath. After thawing, add 1 ml of fresh culture medium to the cell processing station and centrifuge at 1000 rpm for 3 minutes. Discard the supernatant, resuspend, and culture.

[0067] (2) Cell culture and passage In this experiment, RBE, QBC939, and 293T cells were cultured in complete DMEM supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin mixture, and 1% sodium pyruvate, with a pH range of 7.2 to 7.4. Cell density and medium color changes were monitored daily, and fresh medium was replaced as appropriate. Cells were passaged when confluence reached 80%. First, the old medium was removed, and any remaining medium was gently rinsed along the edge of the culture dish with PBS buffer. After gentle shaking, the PBS was removed, and 0.25% trypsin was added. The cells were digested at 37°C until a predominantly rounded appearance was observed under a microscope. An equal volume of medium was then added to terminate the digestion process. Cells were harvested and centrifuged at 1000 rpm for 3 minutes. The supernatant was discarded, and the cells were resuspended in 1 ml of medium and plated onto a new culture dish containing medium. The cells were evenly distributed by shaking. Finally, the culture dish was placed in a 37°C, 5% CO2 incubator for continued incubation.

[0068] (3) Cryopreservation of cells Harvest cells using the previous steps and add freezing solution (90% fetal bovine serum and 10% dimethyl sulfoxide). Gently pipette to evenly resuspend the cells, then transfer the cell suspension into sterile cryovials. Place these cryovials in a gradient cooling box and store them in a -80°C freezer overnight. For short-term storage, they can remain in the -80°C freezer. For long-term storage, transfer the cryovials to a liquid nitrogen tank after 48 hours for long-term freezing.

[0069] 2.2.2 Construction of BOP1 knockdown QBC939 cell line 2.2.2.1 Three short hairpin RNA (shRNA) sequences targeting BOP1 were designed. The sequence information is shown in the following table:

[0070] 2.2.2.2 Recombinant vector Using the pLKO.1-Puro vector (Addgene, ID#8453), the pLKO.1-Puro vector was double-digested with AgeI and EcoRI to linearize the vector. The shRNAs described in the table above were synthesized and annealed (95°C to room temperature with slow cooling) to form double-stranded DNA fragments with sticky ends. The annealed product was ligated to the linearized vector using T4 ligase and transformed into competent cells.

[0071] 2.2.2.3 Lentiviral packaging (1) Select 293T cell lines in the active proliferation phase and then culture them overnight under appropriate conditions to ensure that the cells adhere to the wall and grow.

[0072] (2) Prepare 250 μl of Opti-MEM medium and add 2 μg of PLKO1 plasmid carrying the target gene sequence to it. At the same time, mix 3 μg of psPAX2 plasmid and 2 μg of pMD2 plasmid to ensure that all components are evenly dispersed.

[0073] (3) Take another 250 μl of Opti-MEM medium, mix it thoroughly with an appropriate amount of Lipo 3000 reagent, and then let it stand for 5 minutes to allow the liposomes to fully encapsulate the DNA.

[0074] (4) Combine the Opti-MEM culture media prepared in step (2) and step (3) and incubate at room temperature for 20 minutes to promote the formation and stabilization of the DNA-liposome complex.

[0075] (5) Remove the old culture medium from the cell culture dish inoculated the day before, gently wash once with PBS buffer, then add the DNA-liposome complex Opti-MEM culture medium mixture prepared above, supplement with serum-containing DMEM culture medium and culture.

[0076] (6) After 8 hours, the medium was replaced with fresh serum-containing DMEM to remove unbound DNA-liposome complexes and reduce cytotoxicity.

[0077] (7) 48 hours after transfection, collect the viral supernatant produced by 293T cells. At this point, the cell culture medium should appear light yellow, indicating the release of viral particles. Transfer the viral fluid to a 15 ml centrifuge tube and centrifuge at 1000 rpm / min for 10 minutes to remove cell debris.

[0078] (8) Filter the supernatant using a 0.22 μm pore size filter to further remove impurities. The filtered virus solution is divided into cell cryopreservation tubes and each tube is transferred to a -80°C freezer for long-term storage for subsequent experimental use.

[0079] 2.2.2.4 Lentivirus infection (1) Before lentiviral infection, ensure that the cells have been passaged at least twice to adapt to the in vitro culture environment and restore their proliferation ability.

[0080] (2) The selected cells were accurately counted, and then 200,000 cells were evenly inoculated into a six-well culture plate and placed in a cell culture incubator for overnight culture to promote cell adhesion and growth.

[0081] (3) The next day, gently remove the old culture medium and wash the cells twice with PBS buffer to remove residual serum components and impurities in the culture medium.

[0082] (4) Add 1 ml DMEM, 1 ml fresh virus solution, and 2 μl Polybrim.

[0083] (5) After 8 hours, the culture medium was discarded and the cells were washed twice again with PBS buffer, and then replaced with fresh DMEM complete culture medium to support subsequent cell growth and recovery.

[0084] (6) 48 hours after cell infection, the puromycin screening process begins. The screening concentration must be determined in advance through gradient concentration screening, with the lowest concentration that causes complete cell death in the untreated control group within 48 hours as the standard. The screening process lasts for about one week until all control group cells die. At the same time, the cell transfection efficiency is verified by real-time PCR to provide a reliable cell model for subsequent experiments.

[0085] 2.2.3 RNA sample preparation (1) After treating the cells according to experimental requirements, wash the cells three times with PBS.

[0086] (2) Prepare lysis buffer according to the ratio of lysate buffer to β-mercaptoethanol (1000:20). Add 500 μl of lysis buffer to 1 million cells per EP tube and place on ice for 10 minutes.

[0087] (3) Add 300 μl of anhydrous ethanol to each sample EP tube and shake for 10 seconds to ensure that the two are fully mixed.

[0088] (4) Transfer the mixture to an RNA purification column, centrifuge at 12,000 g / min for 1 minute, and discard the supernatant.

[0089] (5) Add 700 μl of Wash Buffer 1 to the purification column, centrifuge at 12,000 g / min for 1 minute, and discard the supernatant.

[0090] (6) Add 600 μl of Wash Buffer 2 to the purification column, centrifuge at 12,000 g / min for 1 minute, and discard the supernatant.

[0091] (7) Add 250 μl Wash Buffer 2 again, centrifuge at 12,000 g / min for 3 minutes, and discard the supernatant.

[0092] (8) Place the purification column in a labeled sterile 1.5 ml EP tube, add 50 μl of DEPC water, and let it stand at room temperature for 2 minutes.

[0093] (9) Centrifuge at 12,000 g / min for 1 minute, collect the flow-through, and use Nanodrop 2000 to determine the RNA concentration and perform the corresponding reverse transcription.

[0094] 2.2.4 Real-time fluorescence quantitative PCR (1) Reaction system Takara TB Green Premix Ex Taq II, total volume 20 μl. The specific amounts of each reagent are shown in the following table:

[0095] The nucleotide sequence of the forward primer is AATACCTGCTCAGCGAGGAGGA, and the nucleotide sequence of the reverse primer is GTTCCTGGATGAAGCGTCCGTA.

[0096] (2) Reaction conditions: Step ①: 96°C, 2 minutes, 1 cycle; Step ②: 96°C, 30 seconds → 59°C, 30 seconds, 45 cycles; Step ③: 96°C, 14 seconds → 59°C, 59 seconds → 96°C, 14 seconds (3) Data analysis Experimental results using 2 -ΔΔCT Methods The fold differences of relative expression levels between groups were calculated, and each group of data was repeated at least 3 times to ensure the reliability and statistical significance of the results.

[0097] 2.2.5 Western Blot Prepare protein samples: When the coverage of adherent cells reached 80%, trypsin was used to digest and collect the cells, and then the cells were resuspended in an appropriate amount of PBS and the cell number was counted. The PBS was removed by centrifugation at 1000 rpm for 3 min, and then the cells were counted every 10 5Add 30 μl of RIPA lysis buffer per 10 cells and lyse the cells on ice for 10 minutes. Centrifuge for 3 minutes, transfer the supernatant to a new EP tube, add an equal volume of 2× SDS loading buffer, vortex thoroughly, and heat in a 95°C metal bath for 10 minutes to ensure complete protein denaturation. Mix thoroughly and centrifuge again. The sample can be stored at -20°C for short-term use or at -80°C for long-term storage.

[0098] Western blot analysis: (1) Prepare SDS-PAGE polyacrylamide gel: Select the appropriate separation gel concentration according to the molecular weight of the target protein and assemble a 1.5 mm thick gel plate. Prepare the separation gel according to the formula shown in the table below. After adding TEMED, invert the container to mix evenly and quickly pour it into the gel plate, ensuring that the liquid surface is about 1.5 cm away from the short side. Then use a pipette to slowly inject 1 ml of anhydrous ethanol along the long side to smooth the gel surface and remove bubbles. After the separation gel is completely solidified, pour out the ethanol and then prepare the stacking gel according to the formula in the table below. Pour it on top of the solidified separation gel and place a comb. After the gel is completely solidified, it can be used.

[0099] Table 1 Separation gel configuration system

[0100] (2) Electrophoresis: Prepare SDS-PAGE electrophoresis buffer (1× concentration), and at this time, place the prepared gel device vertically in the electrophoresis tank and pour the electrophoresis buffer; add an equal amount of protein sample to each loading well; the initial voltage is 80 volts, then increase the voltage to 120 volts, maintain constant voltage and continue electrophoresis until the bromophenol blue indicator is close to 0.5 cm from the bottom of the gel, at which time the electrophoresis process is stopped.

[0101] (3) Transfer: Prepare and pre-cool the transfer buffer. After electrophoresis, immerse the sponge pad, filter paper, and methanol-activated PVDF membrane in the pre-cooled buffer. Assemble the transfer apparatus in the order (sponge pad - filter paper - gel - PVDF membrane - filter paper - sponge pad) and secure with clips to ensure there are no bubbles. Place the gel on the negative electrode side and the PVDF membrane on the positive electrode side. Pour the transfer buffer until it covers the transfer clips, and then transfer the membrane at a constant voltage of 130 volts for 90 minutes.

[0102] (4) Cutting the target band: After the transfer is completed, place the PVDF membrane in the Ponceau red dye solution. The protein binding area will appear red. According to the instructions of the protein marker, cut the membrane at the target protein position and mark it. Then use the pre-prepared TBST (1×) to wash the membrane.

[0103] (5) Blocking treatment: Use TBST buffer to prepare a 5% concentration of skim milk blocking solution. After it is fully dissolved, immerse the membrane in the blocking solution and shake it slowly on a shaker at room temperature for 1 hour. After blocking, wash the membrane with TBST buffer on a shaker for 3 times, each time for 5 minutes.

[0104] (6) Primary antibody incubation: After preparing the primary antibody Abcam Anti-BOP1 antibody (ab86652), add it to the membrane and incubate with slow shaking at room temperature for 4 hours, or incubate with slow shaking at 4°C overnight. After incubation, the primary antibody was recovered and the membrane was washed three times with TBST buffer with rapid shaking for 10 minutes each time.

[0105] (7) Secondary antibody incubation: Select the secondary antibody HRP-conjugated Goat Anti-Rabbit IgG (H+L) (10857, Proteintech) based on the primary antibody and dilute according to the instructions. Immerse the strips completely in the secondary antibody dilution solution and incubate on a shaker at room temperature for 1 hour. After completion, wash with TBST buffer on a shaker at room temperature for 5 minutes, for a total of 5 times.

[0106] (8) Development: Mix solution A and solution B in a 1:1 ratio to prepare a chemiluminescent substrate, which is ready for immediate use. In a dark environment, evenly coat the membrane with the substrate, and then use a chemiluminescent development device to capture the image.

[0107] 2.2.6 Three-dimensional cell culture (1) Thaw the Matrigel vial in ice at 4°C overnight before use. After thawing, swirl the vial to ensure mixing.

[0108] (2) Add 200 μL / well of Matrigel (8-11 mg / mL) to a pre-cooled 24-well plate, spread it quickly and evenly with a pipette tip, and incubate at 37°C for 30 minutes to allow the Matrigel to gel.

[0109] (3) Wash the cells once with PBS, digest with trypsin, and prepare a single-cell suspension. Centrifuge at 125 × g for 5 minutes at room temperature to pellet the cells.

[0110] (4) Resuspend the cells in complete culture medium (DMEM + 10% FBS) and adjust the cell density to 3×10 5 250 μL of cell suspension was added to a Matrigel-coated 24-well plate and incubated at 37°C for 30 minutes.

[0111] (5) Cool the complete MDCK culture medium on ice and add 10% Matrigel matrix (final concentration: 0.8-1.1 mg / mL) to the final volume. Take 250 μL of the Matrigel matrix / culture medium mixture and gently add it to the 24-well plate.

[0112] (6) Continue culturing for 4 to 7 days, replacing the Matrigel matrix / culture medium mixture every 2 days.

[0113] (7) Observe cell morphology using a confocal microscope.

[0114] 2.2.7 Cell colony formation assay (1) Cell treatment and inoculation Take cells that are in good growth condition and, depending on the experimental requirements, seed 1000–3000 cells from the cell suspension into a 6-well plate. Add 2 ml of fresh DMEM to each well. After seeding, shake the dish or 6-well plate to ensure that the cells are evenly spread.

[0115] (2) Cell culture Change the culture medium every two days and observe the cell growth status to avoid contamination. Depending on the experimental requirements, start collecting samples 7 to 10 days after seeding or when colonies are clearly formed.

[0116] (3) Fixation and staining Remove the culture plate, aspirate the medium, and wash with PBS. Add 1 ml of methanol to each well for 30 minutes. After fixation, add 1 ml of crystal violet stain (prepared in methanol) and stain at room temperature for 2 hours (the staining time can be adjusted depending on the condition of the cells). Recover the crystal violet solution and gently rinse the culture plate with distilled water to remove excess stain until the background is clear.

[0117] (4) Drying and taking photos Air the culture plate to ensure there is no excess liquid. Use a developer to photograph the stained cell colonies.

[0118] 2.2.8 CCK-8 assay (1) Cell preparation and inoculation The cells to be tested were taken and routinely trypsinized before counting.

[0119] The cells were seeded at a density of 10,000 per well in a 96-well plate, with 6 replicate wells set up. Subsequent experiments were performed after the cells were cultured until they adhered to the wall.

[0120] (2) CCK-8 reaction solution treatment Aspirate the old culture medium and add 10 μl of CCK-8 solution to each well. Add 90 μl of fresh culture medium to a total of 100 μl. Mix the reaction mixture thoroughly, avoiding bubbles and ensuring even distribution of the reagents throughout the wells. Place the 96-well plate in an incubator and continue incubation for 2 hours.

[0121] (3) Absorbance measurement After the incubation period, remove the 96-well plate and wrap it in tin foil to protect it from light. Measure the absorbance using a microplate reader at a wavelength of 450 nm. After the measurement, add fresh culture medium as needed and continue culturing the cells.

[0122] (4) Multiple measurements Repeat the above steps starting from the second day of the experiment and record the absorbance value at each time point.

[0123] The results in Example 2 show that a BOP1 knockdown QBC939 cell line was constructed by stably transfecting three specific shRNA sequences, and its transfection efficiency was tested. The mRNA expression levels of the control group and knockdown group cells transfected with the blank vector were tested, and the qPCR results showed that ( Figure 3 Middle A), compared with the control group, the BOP1 mRNA expression in the three knockdown groups decreased by 62.3%, 71.5% and 58.7%, respectively ( p <0.001). Western Blot analysis was performed on the two groups of cells ( Figure 3 (B) Results show a significant decrease in BOP1 protein expression in the knockdown group compared to the control group, further confirming the knockdown effect. Subsequent experimental results, unless otherwise noted, were performed using the BOP1 knockdown QBC939 or RBE cell lines constructed with shRNA#2.

[0124] The effect of BOP1 on the proliferation of cholangiocarcinoma cells was observed through 3D cell culture experiments. The relevant experiments were conducted using BOP1 knockdown QBC939 cells and blank control cells. The results showed that the tumor sphere formation ability of the BOP1 knockdown group was significantly weakened, and the sphere diameter was smaller than that of the control group ( p <0.01), suggesting that BOP1 knockdown can significantly inhibit tumor cell proliferation characteristics ( Figure 3 Middle C).

[0125] Figure 4 The results of the colony formation experiment were presented. The experimental results showed that the number of colonies in the BOP1 knockdown group was significantly reduced compared with the control group, and the colonies were smaller and looser in structure ( Figure 4 Middle A). Repeated validation in the RBE cell line showed that the colony formation ability of the BOP1 knockdown group was significantly lower than that of the control group ( Figure 4Middle B) indicates that BOP1 knockdown cells have impaired long-term proliferation capacity compared with non-knockdown cells.

[0126] also, Figure 5 The results of the CCK-8 assay are presented. In the QBC939 and RBE cell lines, cells with successful BOP1 knockdown and control cells were cultured and assayed using the CCK-8 cell proliferation assay. The OD values ​​of the two groups were measured on days 1, 2, 3, 4, 5, 6, and 7, and statistical analysis was performed. The results showed that the proliferation rate of the BOP1 knockdown group in both the QBC939 and RBE cell lines was significantly reduced compared to the control group. On day 7 of culture, the OD value of the QBC939 knockdown group was significantly lower than that of the control group ( p <0.01) ( Figure 5 A), RBE cell line also showed a similar trend ( p <0.001) ( Figure 5 Middle B), indicating that BOP1 knockdown can inhibit the proliferation of cholangiocarcinoma cells.

[0127] Example 3 Application of BOP1 in the treatment of cholangiocarcinoma (animal experiment) 3.1 Subcutaneous xenograft study (1) Selection and preparation of mice: BALB / c nude mice, 4-week-old males, weighing 20 ± 2 g, were purchased from the Shanghai SLAC Animal Laboratory. Before the experiment, the mice needed to be acclimatized to the environment, maintaining a temperature of 20–22°C and a humidity of 50%–60%. Standard feed and water were provided to ensure that the mice were in good health.

[0128] (2) Preparation of Matrigel: Thaw the required amount of Matrigel at 4°C overnight one day in advance.

[0129] (3) Cell preparation (BOP1 knockdown QBC939 cells from Example 2 and blank vector-transfected cells served as blank control groups): Culture a sufficient number of cells in good condition. To ensure optimal cell condition, select cells in the logarithmic growth phase for transplantation. Harvest cells using trypsin digestion. Typically, use 0.25% trypsin solution to digest the cells on the culture plate. Wait until the cells are completely detached, then add complete culture medium to terminate digestion.

[0130] (4) Preparation of cell suspension: Resuspend in pre-cooled PBS and count to ensure that the cell concentration is 2×10 7 cells / mL.

[0131] (5) Mixing and inoculating cells with Matrigel: Take out the pre-thawed Matrigel and pre-cooled pipette tip and place them on ice to ensure that the Matrigel remains at a low temperature during the operation; mix the cell suspension with Matrigel in a 1:1 ratio to keep the final concentration at 1×10 7 cells / mL. This ratio ensures sufficient support for tumor growth after transplantation. Twelve nude mice were randomly divided into two groups (BOP1 knockdown group and control group). The control group consisted of a PLKO.1 cell line transfected with an empty shRNA vector, with six mice in each group. Well-growing cells (BOP1 knockdown QBC939 cells and blank control QBC939 cells) were selected. 0.1 mL of the cell suspension was drawn up using a 1 mL sterile syringe and injected subcutaneously into the right axilla of each mouse. During injection, ensure the sterility of the needle and avoid excessive damage to the mouse. Inject slowly and evenly to avoid cell clumping.

[0132] (6) Regular observation and measurement of tumor growth: Regularly observe the growth of the tumor and record the volume of the subcutaneous tumor. The tumor volume is measured using a vernier caliper, and the long diameter (a) and short diameter (b) of the tumor are measured every other day.

[0133] The formula for calculating tumor volume is: V=0.52×a×b 2 , where a is the long diameter of the tumor and b is the short diameter, both measured in mm³. By regularly recording tumor volume, we can monitor tumor growth curves in real time and evaluate the therapeutic efficacy of different experimental groups.

[0134] (7) Removal and analysis of tumor tissue after the experiment: After the experiment, the mice were killed by cervical dislocation. The dissection was performed carefully to peel off the skin and muscles to expose the tumor tissue. After the tumor was removed, the tumor was weighed and the data was recorded. The tumor tissue was neatly arranged and photographed to provide a reference for subsequent morphological analysis.

[0135] (8) Tissue fixation and subsequent analysis: 4% paraformaldehyde is a commonly used tissue fixative that can be used to fix the removed tumor tissue. The tumor tissue is immersed in formaldehyde fixative for 24 hours to ensure that the internal structure of the tissue is stably preserved.

[0136] (9) Tumor growth curve drawing and data analysis: Data analysis was performed using software such as GraphPad 8. The measured tumor volume data was input into the software to draw the growth curve of the mouse subcutaneous tumor.

[0137] The tumor size was measured and recorded every 4 days during tumor growth and analyzed. The results showed that the growth rate of tumor volume in the BOP1 knockdown group was slower than that in the control group ( p <0.001) ( Figure 6 Middle A), anatomical image ( Figure 6 Middle B) Visually shows that the tumor volume of the knockdown group is smaller. After the tumor was removed, the tumor weight and volume of the BOP1 knockdown group and the control group were measured. The results showed that the final tumor volume of the BOP1 knockdown group was reduced compared with the control group ( p <0.01) ( Figure 6 Middle C), tumor weight decreased ( p <0.01) ( Figure 6 Middle D).

[0138] Based on the above experimental results, it can be concluded that BOP1 can not only predict the prognosis of cholangiocarcinoma, but also knocking down or silencing BOP1 can play a therapeutic effect on cholangiocarcinoma, providing a new treatment option for cholangiocarcinoma and has important clinical significance.

[0139] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are merely examples, and any embodiments having substantially the same structure and effect as the technical concept within the scope of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the present application, any other embodiments that can be conceived by those skilled in the art and that combine some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. A product for predicting the prognosis of bile duct cancer, characterized in that: The product contains a reagent for detecting the expression level of BOP1 in a biological sample.

2. The product according to claim 1, characterized in that The product is a kit or a chip.

3. The product according to claim 1, characterized in that The reagent contains primers for specifically amplifying the BOP1 gene, a probe for specifically recognizing the BOP1 gene, or a binding agent for specifically binding to a protein encoded by BOP1.

4. The product according to claim 1, characterized in that The biological sample is bile duct cancer tissue of a subject.

5. The product according to claim 1, characterized in that The bile duct cancer is intrahepatic bile duct cancer.

6. A system or device for predicting the prognosis of bile duct cancer, characterized in that: The system or device comprises: a data acquisition unit, configured to acquire the expression level of BOP1 in a sample; The data processing unit obtains the prognosis prediction result of bile duct cancer according to the expression of BOP1.

7. A pharmaceutical composition for treating bile duct cancer, characterized in that: The pharmaceutical composition contains an inhibitor of BOP1.

8. The pharmaceutical composition according to claim 7, wherein The inhibitor is a nucleic acid inhibitor or a protein inhibitor.

9. The pharmaceutical composition according to claim 7, wherein The inhibitor is a nucleic acid inhibitor, and the nucleic acid inhibitor is shRNA; Preferably, the nucleotide sequence of the shRNA is shown as SEQ ID NO. 1, 2 or 3.

10. Application of at least one of the following: a: Use of a reagent for detecting the expression level of BOP1 in a biological sample or the product according to any one of claims 1 to 5 in the preparation of a tool for predicting the prognosis of cholangiocarcinoma; b: Use of a BOP1 inhibitor or the pharmaceutical composition according to any one of claims 7 to 9 in the preparation of a drug for treating bile duct cancer.