Conjugate vaccine for Brucella as well as preparation and application of conjugate vaccine

Abstract

The invention provides a conjugate vaccine for Brucella as well as preparation and application of the conjugate vaccine, and relates to the technical field of biological medicines. The conjugate vaccine provided by the invention contains a conjugate of a brucella outer membrane vesicle (OMV) and a brucella GroEL protein. Through screening and verification, it is found that compared with coupling with other immune reaction proteins, a synergistic effect can be generated only when OMV and GroEL are coupled, and the immune effect is optimal. Meanwhile, the nucleotide sequence for coding the Brucella GroEL protein is optimized, the protein expression quantity is greatly improved compared with that before optimization, and more importantly, the immunogenicity of the antigen is improved, so that the protective efficacy of the vaccine on Brucella infection is also enhanced. The vaccine prepared by the invention is higher in safety, easier to distinguish natural infection from vaccination, high in stability, wider in application range and suitable for preparing products for preventing Brucella.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a combined vaccine for Brucella and its preparation and application. Background Art

[0002] Brucellosis is a zoonotic disease caused by Brucella bacteria, posing a serious threat to animal husbandry and human health. Vaccination is an important means of preventing brucellosis. Currently, research and application of brucellosis vaccines focus on animal vaccines, with the main types of vaccines including live attenuated vaccines and subunit vaccines.

[0003] Live attenuated vaccines are the predominant type of vaccine, including S19 (also known as A19 vaccine), Rev.1, RB51, S2, and M5. These vaccines use active pathogens, activating the immune system much like a natural infection, and can stimulate a more robust immune response than other vaccines. However, these vaccines have safety concerns, including potential miscarriage in pregnant animals and allergic reactions in humans. Subunit vaccines, such as recombinant and polysaccharide vaccines, are made using only the specific parts of bacteria that the immune system needs to recognize. Recombinant vaccines utilize genetic recombination techniques to insert antigen-encoding DNA into bacterial or mammalian cells, followed by purification of the synthesized antigens to produce vaccines. Currently reported Brucella immune-reactive proteins that can be used to prepare recombinant vaccines include Flu-BA, L7 / L12, Omp16, Bp 26, TF, Omp19, Cu–ZnSOD, BLS, PrpA, LPS, BCSP31, GroEL, GroESDnaK, the cell division protein FtsZ, the 50s ribosomal protein L10, and the invasion protein B. Polysaccharide vaccines are based on the immunogenicity of bacterial capsular polysaccharides, produced by purifying specific polysaccharides. However, the immune efficacy of recombinant and polysaccharide vaccines is limited, limiting their widespread application. This is why the present invention was developed. Summary of the Invention

[0004] To solve the above problems, the present invention provides a combined vaccine, which is obtained by coupling Brucella GroEL protein with Brucella-derived OMVs. The vaccine is safer, easier to distinguish between natural infection and vaccination, and has strong stability. The coupled vaccine has a synergistic effect and is more effective than the combination of the two. It has application potential in the prevention and treatment of brucellosis.

[0005] The first object of the present invention is to provide a conjugate vaccine comprising a conjugate of Brucella outer membrane vesicles and Brucella GroEL protein.

[0006] Furthermore, the Brucella outer membrane vesicles and the Brucella GroEL protein are coupled via a connecting component, and the connecting component comprises adipic dihydrazide.

[0007] Furthermore, the gene sequence encoding the Brucella GroEL protein is shown in SEQ ID NO.2.

[0008] Furthermore, the mass ratio of the Brucella outer membrane vesicles to the Brucella GroEL protein is (1-3): (1-3).

[0009] Further, the preparation method of the Brucella outer membrane vesicles comprises the step of separating from the culture supernatant of Brucella. Specifically, Brucella is cultured to secrete OMVs, bacterial cells and cell debris are removed by methods including but not limited to centrifugation and / or filtration, culture supernatant is obtained, and the OMVs therein are purified (such as centrifugation, filtration, etc.) to obtain the purified outer membrane vesicles.

[0010] Furthermore, the particle size of the outer membrane vesicles is 50nm-1000nm, such as 60nm, 80nm, 100nm, 110nm, 130nm, 150nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, 550nm, 600nm, 650nm, 700nm, 750nm, 800nm, 850nm, 900nm, 950nm, etc.

[0011] Furthermore, the Brucella includes but is not limited to Brucella A19 strain, M5 strain or S2 strain.

[0012] Furthermore, the preparation method of the conjugate vaccine includes: using cyanogen bromide (CNBr) as an oxidant, adipic dihydrazide (ADH) as an intermediate bridge, and carbodiimide (EDAC) as a coupling reagent for coupling.

[0013] Furthermore, the Brucella GroEL protein is produced by introducing the encoding gene into a prokaryotic organism (such as Escherichia coli).

[0014] Furthermore, in actual use, the conjugate vaccine can be emulsified.

[0015] Furthermore, the combined vaccine may also include an adjuvant.

[0016] Furthermore, in the combined vaccine, the mass ratio of the conjugate to the adjuvant is (1-10): (10-1).

[0017] Furthermore, the adjuvant includes a bidirectional adjuvant, preferably ISA206 VG adjuvant.

[0018] Furthermore, the preparation method of the Brucella conjugate vaccine specifically comprises the following steps:

[0019] S1. Cultivate Brucella, obtain the culture supernatant, and isolate outer membrane vesicles;

[0020] Preparation of Brucella GroEL protein;

[0021] S2, coupling the outer membrane vesicles obtained in step S1 with Brucella GroEL protein to obtain a conjugate;

[0022] S3. Mix the conjugate with an adjuvant and emulsify to obtain the Brucella conjugate vaccine.

[0023] Furthermore, the step of preparing the Brucella GroEL protein includes: inserting a DNA sequence encoding the Brucella GroEL protein into an expression vector to obtain a recombinant plasmid, introducing the recombinant plasmid into a host cell to obtain a recombinant cell, and culturing the recombinant cell to produce the Brucella GroEL protein.

[0024] The vaccine of the present invention has the following advantages over the Brucella live vaccine commonly used on the market:

[0025] 1. Higher safety. (1) No risk of live bacteria: The vaccine of the present invention does not contain live pathogens, but only contains specific antigens (recombinant proteins, polysaccharides, etc.), so it will not cause Brucella infection and is particularly suitable for animals with weak immune systems or pregnant animals. (2) No risk of environmental release: Weak strains in live vaccines may be transmitted to the environment or other animals through animal excrement or secretions, but the vaccine of the present invention completely avoids this problem.

[0026] 2. Easier to distinguish between natural infection and vaccination. Diagnostic compatibility: After vaccination with live vaccines, animals may produce antibodies similar to those produced by natural infection (such as O antigens), which can interfere with serological tests (such as tube agglutination tests). However, the vaccine of this invention selects specific antigens, which can be used to distinguish between vaccinated and infected animals through differential detection methods (such as the DIVA strategy), facilitating epidemic monitoring.

[0027] 3. Stability and storage advantages. (1) No need for cold chain: The vaccine of the present invention is more tolerant to temperature fluctuations, reducing the requirements for cold chain transportation and storage, and is more suitable for resource-limited areas. (2) Longer shelf life: The vaccine of the present invention does not contain live microorganisms and has a longer shelf life.

[0028] 4. Wider scope of application. (1) Can be used in pregnant animals: Live vaccines may cause miscarriage in pregnant animals (such as Rev-1 vaccine is unsafe for pregnant animals), while the vaccine of the present invention does not have this risk. (2) Potential for human use: Live vaccines are potentially pathogenic to humans (such as S19 or Rev-1 vaccine) and are limited to animal use; the vaccine of the present invention is safer and may be developed into a preventive vaccine for humans in the future.

[0029] 5. More controllable immune mechanisms. (1) Targeted immune response: The vaccine of the present invention precisely designs immune responses against specific antigens, which can reduce unnecessary inflammatory responses. (2) Reduced side effects: Live vaccines may cause fever or local inflammation, while the adverse reactions of the vaccine of the present invention (such as swelling at the injection site) are generally milder.

[0030] 6. Biosafety and regulatory advantages. (1) No biosafety concerns: The vaccine of this invention does not require the handling of live pathogens, and the production and use processes are more in line with biosafety regulations. (2) Lower approval threshold: Vaccines that do not contain live bacteria are generally easier to pass regulatory approval, especially in the field of human medicine.

[0031] In summary, the vaccine of the present invention has advantages in safety, diagnostic compatibility and precise immunization, and is suitable for scenarios where epidemic monitoring is strict or the risk of miscarriage needs to be avoided (such as breeding animals and pregnant animals).

[0032] The second object of the present invention is to provide the use of the combined vaccine in the preparation of products against Brucella infection.

[0033] Furthermore, the product can at least be used to resist infection by Brucella A19 strain and Brucella M28 strain.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The present invention combines and screens Brucella outer membrane vesicles containing multiple immunogenic substances (such as polysaccharides and proteins) and couples them with GroEL proteins as antigens to prepare Brucella vaccines. The immune effect is greatly improved compared with the combined use of the two. The sequence of GroEL protein is further optimized to improve the immunogenicity of the antigen, which can effectively induce the body to produce an immune response. The immune effect is better than that of commercial attenuated live vaccines, and the vaccine has cross-protection against infection with different strains. The vaccine is suitable for preparing products for preventing Brucella. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0037] Figure 1 This is the OMV-SDS-page result.

[0038] Figure 2 This is the OMV protein quantification curve.

[0039] Figure 3 This is an electron microscope image of OMV.

[0040] Figure 4 This is the identification result of the optimized GroEL protein recombinant plasmid.

[0041] Figure 5 Comparison of protein expression levels before and after optimization; lane A: empty well; lanes BF: protein standards; lane G: before GroEL optimization; lane H: after GroEL optimization. DETAILED DESCRIPTION

[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0043] The main reagents, instruments, etc. used in the following examples and their purchase information and material sources are as follows:

[0044] Table 1 Reagents

[0045]

[0046] Table 2 Instruments and equipment

[0047]

[0048] The A19 vaccines used in the following examples are all Brucellosis live vaccines A19-ΔVirB12 strains produced by Tiankang Biotechnology Co., Ltd.

[0049] Example 1 OMV preparation

[0050] (1) Preparation of A19 bacterial suspension

[0051] Inoculate 5 ml of LB medium with a single colony of Brucella A19 and incubate at 37°C in a shaker at 160 rpm for 36 hours. Take 1 ml of the culture grown in LB medium and inoculate it into a 500 ml culture flask (containing 100 ml of LB) and continue incubating at 37°C under the same conditions for 24 hours. Add the entire culture to a 3000 ml culture flask (containing 1500 ml of LB). Continue incubating at 37°C under the same conditions for 48 hours. Filter the supernatant using a 0.22 μm membrane filter. The filtered supernatant can be stored at 4°C for up to 24 hours.

[0052] (2) OMV preparation

[0053] Collect OMVs from the filtered supernatant by centrifugation at 38,400 × g for 2 hours at 10°C. After centrifugation, the centrifuge bottle should contain a small, but clearly visible, white, slightly turbid pellet. Discard the supernatant (the OMV pellet will soon begin to suspend) and resuspend the OMV pellet in a total volume of 10 ml of sterile PBS by pipetting. Filter the OMV suspension using a 0.45 μm syringe filter and centrifuge at 34,500 × g for 45 minutes at 10°C in a single centrifuge tube to collect the OMVs. Discard the supernatant and resuspend the OMV pellet in 5 ml of sterile PBS by vortexing.

[0054] (3) SDS-page identification

[0055] The prepared OMV protein was identified by SDS-page electrophoresis. Figure 1 .

[0056] (4) BCA protein quantification

[0057] The OMV protein was quantified by BCA protein quantification kit, and the OMV protein concentration was 1898.81ug / ml. Figure 2 and Table 3.

[0058] Table 3 Protein quantification results

[0059]

[0060] (5) Electron microscopy

[0061] The prepared OMV suspension sample was pipetted onto a copper mesh with a support film. Depending on the sample concentration in the suspension, excess liquid was removed from the edge of the droplet with filter paper. The staining solution was then dripped onto the sample for 3-5 minutes. The stain was then removed with filter paper, dried, and observed under a transmission electron microscope. The "saucer-like" appearance observed under the electron microscope is the morphology of OMVs, with a size between 90-120 nm. Figure 3 .

[0062] Example 2 Preparation of Brucella GroEL recombinant protein

[0063] (1) Construction and identification of recombinant bacteria

[0064] The plasmid construct pET28a-GroEL was purified from an overnight culture of E. coli DH5α cells. The construct was transformed into recipient E. coli BL21(ED3) cells. Cells containing the recombinant plasmid were plated on Luria-Bertani (LB) agar medium containing kanamycin and identified. The gene sequence encoding GroEL is shown in SEQ ID NO. 1. The primers used to amplify GroEL are as follows:

[0065] F-GroEL: 5'-ATGGCTGCAAAAGACGTAAA-3'

[0066] R-GroEL: 5'-GCCGCAAGGCCATGCTCGAA-3'

[0067] SEQ ID NO.1:

[0068] ATGGCTGCAAAAGACGTAAAATTCGGCCGCACTGCGCGCGAAAAGATGCTGCGCGGCGTCGATATCCTCGCTGACGCTGTTAAGGTCACGCTCGGCCCGAAGGGCCGCAATGTCGTTATCGAGAAGTCCTTCGGCGCTCCGCGCATCACCAAGGACGGCGTTTCGGTCGCCAAGGAAGTCGAACTGGAAGACAAGTTTGAAAACATGGGCGCACAGATGCTGCGCGAAGTGGCTTCCAAGACCAACGATACTGCCGGTGACGGCACCACGACCGCGACCGTTCTCGGTCAGGCCATCGTTCAGGAAGGCGCCAAGGCCGTTGCCGCTGGCATGAACCCGATGGACCTGAAGCGCGGCATCGACCTCGCTGTCAACGAAGTTGTGGCTGAGCTGCTGAAGAAGGCCAAAAAGATCAACACTTCGGAAGAAGTTGCCCAGGTTGGCACCATCTCTGCCAACGCCGAAGCCGAAATCGGCAAGATGATCGCCGAAGCGATGCAGAAGGTCGGCAACGAAGGCGTCATCACGGTTGAAGAAGCCAAGACCGCCGAAACCGAACTCGAAGTCGTCGAAGGCATGCAGTTCGACCGCGGCTACCTGTCGCCTTACTTCGTCACCAACCCTGAAAAGATGGTTGCTGACCTCGAAGACGCCTACATCCTTCTGCACGAAAAGAAGCTCTCGAACCTTCAGGCTCTCCTGCCGGTTCTCGAAGCTGTCGTCCAGACCTCCAAGCCGCTTCTCATCATTGCTGAAGACGTCGAAGGCGAAGCTCTTGCAACGCTCGTCGTCAACAAGCTGCGCGGCGGCCTGAAGATTGCTGCCGTCAAGGCTCCGGGCTTCGGCGATCGCCGCAAGGCCATGCTCGAA

[0069] (2) Optimization of protein expression and identification

[0070] A single colony of transformed cells was cultured overnight in 5 ml of LB broth containing kanamycin (100 μl / ml) at 37°C with continuous shaking (200 rpm). After 12 hours, 500 μl of the culture was removed and incubated in 200 ml of LB broth. The cells were incubated in a shaker at 37°C for 200 rpm until an OD600 of 0.6 was reached. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM for expression of the GroEL recombinant protein. The cells were cultured at 37°C with shaking at 200 rpm for 4 hours. The protein yield was analyzed on 12% SDS-PAGE. After induction, the cells were centrifuged at 8000 rpm for 20 minutes, the supernatant discarded, and the pellet retained. The pellet was resuspended in 1 M Na2HPO4 and disrupted three times using a high-pressure cell disruptor (1600 Pa, 25 Pa, and 12000 rpm for 10 minutes). The supernatant was retained and the pellet discarded. The purified protein was folded.

[0071] (3) Sequence optimization

[0072] The sequence encoding the GroEL protein, SEQ ID NO.1, was optimized. The optimized gene sequence is shown in SEQ ID NO.2. The primers for amplifying the optimized GroEL are:

[0073] F-GroEL: 5'-ATGGCAGCTAAAGACGTTAA-3';

[0074] R-GroEL: 5'-GCCGTAAAGCGATGCTGGAG-3'.

[0075] Identification of the GroEL protein recombinant plasmid after sequence optimization is shown in Figure 4 (M is a marker, lanes 1 and 2 represent the recombinant plasmids before and after optimization, respectively, and the molecular weight of the GroEL gene is 870 bp before and after optimization). Recombinant bacteria were constructed and recombinant proteins were prepared in the same manner as above.

[0076] SEQ ID NO.2:

[0077] ATGGCAGCTAAAGACGTTAAGTTCGGTCGCACCGCACGTGAAAAAATGCTGCGTGGTGTGGATATCCTGGCGGATGCTGTTAAAGTTACTCTGGGTCCGAAAGGTCGTAACGTCGTTATTGAGAAAAGCTTCGGCGCTCCGCGTATCACCAAAGACGGTGTGTCTGTCGCCAAAGAGGTCGAACTGGAAGATAAATTCGAGAACATGGGTGCTCAGATGCTGCGTGAAGTTGCCTCTAAGACGAACGATACTGCGGGTGATGGTACCACCACTGCTACGGTACTGGGTCAGGCGATTGTTCAGGAAGGTGCAAAGGCGGTGGCGGCTGGTATGAACCCGATGGACCTGAAGCGTGGTATTGACCTGGCAGTGAATGAGGTGGTCGCTGAACTGCTGAAAAAAGCGAAGAAAATTAACACCAGCGAAGAGGTAGCACAGGTTGGTACCATCAGCGCTAACGCAGAAGCAGAGATCGGCAAAATGATCGCAGAAGCGATGCAAAAAGTAGGTAACGAGGGCGTCATTACCGTCGAAGAAGCGAAGACCGCAGAGACCGAACTGGAAGTTGTAGAAGGCATGCAGTTCGATCGTGGCTACCTGTCCCCGTACTTCGTAACCAACCCGGAAAAGATGGTAGCAGATCTGGAGGATGCCTACATTCTGCTGCACGAAAAAAAACTGTCCAACCTGCAGGCTCTGCTGCCGGTTCTGGAGGCTGTAGTTCAAACCTCTAAACCACTGCTGATCATCGCAGAAGACGTTGAAGGTGAAGCGCTGGCTACTCTGGTAGTCAACAAACTGCGTGGCGGTCTGAAGATTGCGGCGGTAAAAGCGCCGGGTTTTGGCGACCGCCGTAAAGCGATGCTGGAG

[0078] (4) Comparison of protein expression levels before and after optimization

[0079] GroEL protein was purified using affinity chromatography Ni-NTA column and folded using Pierce Protein Refolding Kit (Thermoscientific No. 89867). SDS-page electrophoresis was performed on the target protein before and after optimization, and their expression levels were compared. It was found that the expression level of the optimized protein was significantly higher than that before optimization. Figure 5 .

[0080] Example 3 Chemical coupling of GroEL to OMV outer membrane vesicles.

[0081] The purified protein GroEL (after optimization) was dialyzed at 4°C for 48 hours, filtered and sterilized, and stored at 4°C for later use. Take 2.5 ml of OMV (10 mg) prepared in Example 1, add an equal mass of CNBr, stir to react, and use 0.1M NaOH to maintain pH 10.8. Under high pH conditions, CNBr (cyanogen bromide) reacts with the hydroxyl groups on the polysaccharide sugar chain to form cyanate. After the above reaction is carried out for 10 minutes, add 70 mg of adipic dihydrazide (ADH), maintain pH 8.5 with 0.1M NaOH, and react at 4°C overnight to allow ADH to react with cyanate to form an isourea bond to generate OMV-ADH hydrazide derivatives. The reaction mixture is then placed in a dialysis bag and dialyzed in 0.2M NaCl for 48 hours to remove unreacted CNBr, ADH, or reaction intermediates. The pH of the dialysate was then adjusted to 5.7 with hydrochloric acid, and the carrier protein GroEL prepared above was added to make the mass of the dialysate and GroEL equal (m:m = 1:1). EDAC (carbodiimide) was then added to a final concentration of 0.1 M, and the pH was maintained at 5.7 with hydrochloric acid. The dialyzate was stirred at 2-8°C for 48 hours to allow the carboxyl group of the carrier protein to undergo a condensation reaction with the amino group of the OMV-ADH hydrazide derivative to form OMV-ADH-GroEL, and the dialysate was then collected.

[0082] Example 4 Vaccine Preparation and Protection Efficacy Verification

[0083] OMV-ADH-GroEL (before optimization), OMV-ADH-GroEL (after optimization), GroEL, OMV, and OMV-ADH-PrpA (before optimization) antigens were slowly added to the ISA206 VG adjuvant (stirring at 350 r / min) at a mass ratio of 1:1 (OMV-ADH-PrpA and OMV-ADH-GroEL were prepared in the same way, the only difference being that the GroEL coding sequence was replaced by the PrpA coding sequence), and the mixture was stirred at 150-350 r / min for 10-20 minutes.

[0084] A19 vaccine was diluted to 2.5-3 billion and injected subcutaneously into 5 guinea pigs; the prepared 5 groups of vaccines were injected subcutaneously into the groin of 5 guinea pigs, 50 μg / pig, and boosted with the same dose and method 14 to 21 days after injection. 21 days after booster immunization, 5 guinea pigs in the immunized group and 5 guinea pigs in the blank control group were infected with Brucella M28 strain at 1-10×10 2 CFU / head, injected subcutaneously in the groin. All guinea pigs were autopsied 21 days after infection. Target organs (submandibular, anterior shoulder, groin, spleen) were ground and isolated. 0.1 ml of the tissue homogenate was evenly spread on Brucella selective culture medium and incubated at 37°C in a constant temperature incubator for 5-7 days. The growth of bacterial colonies was observed. The results are as follows:

[0085] Table 4 Protection efficiency

[0086]

[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A conjugate vaccine, characterized in that The combined vaccine contains a conjugate of Brucella outer membrane vesicles and Brucella GroEL protein.

2. The conjugate vaccine according to claim 1, characterized in that The Brucella outer membrane vesicle and the Brucella GroEL protein are coupled via a connecting component; the connecting component comprises adipic dihydrazide.

3. The conjugate vaccine according to claim 1, characterized in that The nucleotide sequence encoding the Brucella GroEL protein is shown in SEQ ID NO.

2.

4. The conjugate vaccine according to claim 1, characterized in that In the conjugate, the mass ratio of Brucella outer membrane vesicles to Brucella GroEL protein is (1-3): (1-3).

5. The conjugate vaccine according to claim 1, characterized in that The preparation method of the Brucella outer membrane vesicles comprises the steps of isolating from the culture supernatant of Brucella; Preferably, the method comprises the following steps: culturing Brucella to secrete OMVs, removing bacterial cells and cell debris by a method including centrifugation and / or filtration to obtain a culture supernatant, and purifying the OMVs therein to obtain purified outer membrane vesicles; Preferably, the particle size of the outer membrane vesicles is 50nm-1000nm.

6. The conjugate vaccine according to claim 1, characterized in that The preparation method of the conjugate vaccine comprises: using cyanogen bromide as an oxidant, adipic dihydrazide as an intermediate bridge, and carbodiimide as a coupling reagent for coupling.

7. The conjugate vaccine according to claim 1, characterized in that The Brucella includes one or more of Brucella A19 strain, Brucella M5 strain or Brucella S2 strain.

8. The conjugate vaccine according to claim 1, characterized in that The Brucella GroEL protein is produced by introducing the coding gene into prokaryotes; the prokaryotes include Escherichia coli.

9. The conjugate vaccine according to claim 1, characterized in that The combined vaccine also includes an adjuvant; and includes at least one of the following features: (1) The mass ratio of the conjugate to the adjuvant is (1-10): (10-1); (2) The adjuvant includes a bidirectional adjuvant, preferably ISA206 VG adjuvant.

10. Use of the conjugate vaccine according to any one of claims 1 to 9 in the preparation of a product for resisting Brucella infection.

Images