DNA (deoxyribonucleic acid) cloning method suitable for long fragments and ultra-long fragments

Abstract

The invention provides a cloning method suitable for long-fragment and ultra-long-fragment DNA (deoxyribonucleic acid), which comprises the following steps: amplifying a target gene by adopting an amplification primer pair, and introducing a partial sequence of a downstream connecting gene into a 3'end of an obtained amplification product and / or introducing a partial sequence of an upstream connecting gene into a 5 'end of the obtained amplification product; cutting and carving the amplification product by adopting sgRNA-guided Cas9 mutant protein to obtain a cut and carved product of a single-chain cantilever with 20-30 basic groups at the tail end; repeating the steps to obtain a nicking product of another target gene connected with the target gene; and mixing all the cut products, and connecting by adopting ligase to obtain a connecting product. According to the method provided by the invention, the accuracy and efficiency of long-fragment and ultra-long-fragment DNA cloning can be improved.

Description

Technical Field

[0001] The present application relates to the field of biosynthesis technology, and in particular to a cloning method suitable for long and ultra-long DNA fragments. Background Art

[0002] Molecular cloning and DNA assembly are key technologies widely used in genetic engineering. With the development of multi-omics technologies and functional genomics, more and more genomes, biosynthetic pathways, and functional genes have been elucidated, and the demand for cloning larger or more complex DNA molecules is increasing in various fields. To date, a variety of DNA assembly strategies have been designed and developed. These include restriction fragment ligation-based methods such as BioBrick, Golden Gate cloning, DNA polymerase-dependent circular polymerase extension cloning, overlap extension (OE) PCR cloning, exonuclease-based sequence-independent nonenzymatic ligation (SLIC), In-Fusion, Gibson Assembly, site-specific recombination-based Gateway cloning, and Cre / loxP-based assembly. These methods have promoted the development of molecular cloning technology.

[0003] Synthetic biology and genetic engineering of complex, multi-trait or metabolic pathways often require cloning long DNA fragments. The most commonly used methods are Golden Gate cloning. Golden Gate cloning is a "seamless" cloning strategy mediated by type IIS restriction endonucleases. Type IIS restriction endonucleases, such as Bsa I, cleave DNA outside of their recognition sites, generating single-stranded DNA fragments that are then sequentially inserted into the target structure using a ligase. However, because the complementary single-stranded ends are only 4 bp, this method results in low ligation accuracy and efficiency. Therefore, developing efficient methods for ligating or assembling multiple DNA fragments is crucial. Summary of the Invention

[0004] The purpose of this application is to provide a cloning method for long and ultra-long DNA fragments with high accuracy and efficiency. The specific technical solution is as follows:

[0005] The first aspect of the present application provides a cloning method applicable to long and ultra-long DNA fragments, comprising the steps of:

[0006] Amplifying the target gene using an amplification primer pair, wherein the 3' end of the obtained amplification product has a partial sequence of the downstream connected gene introduced and / or the 5' end has a partial sequence of the upstream connected gene introduced;

[0007] The amplified product is nicked using a Cas9 mutant protein guided by sgRNA to obtain a nicked product with a single-stranded overhang of 20-30 bases at the end;

[0008] Repeat the above steps to obtain another target gene nicking product connected to the target gene;

[0009] All the nicking products are mixed and ligated using a ligase to obtain a ligation product.

[0010] In some embodiments of the present application, the number of bases from the first base of the first NGG sequence starting from the 3' end to the 3' end of the amplified product is 20-30 and / or the number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end of the amplified product is 20-30; wherein, the N is selected from any one base of A, T, C and G.

[0011] In some embodiments of the present application, the number of bases of all target genes is greater than 100; preferably, when both the 5' end and the 3' end of the target gene need to be connected to other genes, the number of bases of the target gene is greater than 200.

[0012] In some embodiments of the present application, the cloning method applicable to long and ultra-long DNA fragments meets any of the following conditions:

[0013] (1) The nth to n-3th bases from the 3' end of the target gene are NGG, the m-3th to mth bases from the 5' end of another target gene connected to the target gene are CCN, and n+m=20-30;

[0014] (2) If the condition of (1) is not met, any codon encoding tryptophan or arginine within the nth base starting from the 3' end of the target gene is replaced with NGG; and / or

[0015] Replace any codon encoding proline within the mth base starting from the 5' end of another target gene connected to the target gene with CCN;

[0016] (3) If the conditions of (1) and (2) are not met, constructing a spacer sequence of at least 20 bases at the 3' end of the target gene by exogenous introduction without changing the function of the recombinant protein; and / or

[0017] Under the premise of not changing the function of the recombinant protein, a spacer sequence containing at least 20 bases is constructed at the 5' end of another target gene connected to the target gene by exogenous introduction, so that the modified target gene and the other target gene connected to the target gene meet the conditions of (1) or (2).

[0018] In some embodiments of the present application, when the 3' end of the amplified product needs to be nicked, the downstream primer in the amplification primer pair includes an exogenous sequence, a binding sequence, and a regulatory sequence; wherein the number of bases of the binding sequence is x, 3≤x≤27; the number of bases of the regulatory sequence is y, 15≤x+y≤27; the number of bases of the exogenous sequence is z, 20≤x+z≤30, z≥n; and / or

[0019] When the 5' end of the amplified product needs to be nicked, the upstream primer in the amplification primer pair includes an exogenous sequence, a binding sequence and a regulatory sequence; wherein the number of bases of the binding sequence is x, 3≤x≤27; the number of bases of the regulatory sequence is y, 15≤x+y≤27; and the number of bases of the exogenous sequence is z, 20≤x+z≤30, z≥m.

[0020] In some embodiments of the present application, the sgRNA includes a promoter sequence, an amplification product sequence, and a sequence that binds to a reverse primer.

[0021] In some embodiments of the present application, the promoter sequence in the sgRNA is shown as SEQ ID NO.9, and the sequence bound to the reverse primer is shown as SEQ ID NO.10.

[0022] In some embodiments of the present application, the amplified product sequence in the sgRNA is a sequence of 20 bases from the first base of the NGG sequence to the 5' end of the amplified product; or,

[0023] The complementary sequence of the amplified product comprises 20 bases from the last base of the GGN sequence to the 5' end.

[0024] In some embodiments of the present application, the Cas9 mutant protein comprises D10A and / or H840A.

[0025] In some embodiments of the present application, the mixing is mixing all the cutting products in an equal molar ratio.

[0026] In some embodiments of the present application, the cloning method applicable to long and ultra-long DNA fragments further includes the steps of: constructing a recombinant plasmid using the ligation product and a vector, and then transfecting it into competent cells for expanded culture.

[0027] Beneficial effects of this application:

[0028] The present application provides a cloning method suitable for long and ultra-long DNA fragments. By utilizing the characteristic that the Cas9 mutant protein can only produce single-stranded nicks on the target DNA chain, combined with a specific sgRNA, sticky ends with a length of 20bp-30bp or even 20bp-40bp are generated at the 3' and / or 5' ends of the DNA chain; compared with traditional four-base sticky ends, the ultra-long sticky ends used in the present application facilitate the recognition and connection between DNA chains, thereby improving the accuracy and efficiency of long and ultra-long DNA fragment cloning.

[0029] Of course, it is not necessary to achieve all the advantages described above at the same time when implementing any product or method of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other embodiments can also be obtained based on these drawings.

[0031] Figure 1 This is a schematic diagram of the incision method when two target genes are connected in one embodiment of the present application;

[0032] Figure 2 Schematic diagram of the cutting method of the intermediate connecting gene in another embodiment of the present application;

[0033] Figure 3 This is a gel electrophoresis diagram of the connection product after the two target genes in Example 1 of the present application are connected. DETAILED DESCRIPTION

[0034] The following will be combined with the accompanying drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the embodiments described are only part of the embodiments of the present application, rather than all the embodiments. All other embodiments obtained by those skilled in the art based on this application are within the scope of protection of this application.

[0035] The present application provides a cloning method applicable to long and ultra-long DNA fragments, which includes the following steps:

[0036] S1: Amplify the target gene using an amplification primer pair, and introduce a partial sequence of the downstream connected gene into the 3' end of the obtained amplification product and / or introduce a partial sequence of the upstream connected gene into the 5' end;

[0037] S2: using sgRNA-guided Cas9 mutant protein to nick the amplified product to obtain a nicked product with a single-stranded overhang of 20-30 bases at the end;

[0038] S3: Repeat the above steps to obtain another target gene nicking product connected to the target gene;

[0039] S4: All the nicking products are mixed and ligated using a ligase to obtain a ligation product.

[0040] The cloning method provided in the present application is applicable to long and ultra-long DNA fragments. It can be to connect two target genes, such as connecting gene A and gene B end to end; it can also be to connect multiple target genes, such as connecting gene A, gene B and gene C in sequence, or connecting gene A, gene B, gene C and gene D in sequence. The present application does not have any special restrictions on the number of target genes, as long as the purpose of the invention of the present application can be achieved.

[0041] The present application does not impose any particular restrictions on the specific length of long fragments and ultra-long fragments of DNA, as long as the purpose of the invention of the present application can be achieved, for example, containing 200 or more bases (bp).

[0042] In S2 of the present application, the preparation method of sgRNA is not particularly limited. For example, it can be prepared by an in vitro transcription method, specifically by using the "sgRNA One-Step In Vitro Transcription Kit" of Guangdong Huankai Microbiology Technology Co., Ltd. After the reaction is completed, an appropriate amount of DNase I needs to be added to remove DNA.

[0043] In S2 of this application, the Cas9 mutant protein needs to only produce single-stranded nicks on the target DNA strand.

[0044] In S3 of the present application, repeating the above steps to obtain a nicking product of another target gene connected to the target gene refers to repeating S1 and S2 in sequence.

[0045] In S4 of the present application, there is no particular limitation on the type of ligase. For example, T4 ligase can be used for ligation.

[0046] This application utilizes the characteristic that the Cas9 mutant protein can only produce single-stranded nicks on the target DNA chain, and is combined with a specific sgRNA to produce sticky ends of 20bp-30bp or even 20bp-40bp in length at the 3' and / or 5' ends of the DNA chain. Compared with traditional four-base sticky ends, the ultra-long sticky ends used in this application facilitate the recognition and connection between DNA chains, thereby improving the accuracy and efficiency of long and ultra-long DNA cloning. In addition, the cloning method for long and ultra-long DNA fragments provided in this application can generate single-stranded cantilevers of any length of more than 8bp after reasonable design.

[0047] In some embodiments of the present application, the number of bases from the first base of the first NGG sequence starting from the 3' end to the 3' end of the amplified product is 20-30 and / or the number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end of the amplified product is 20-30; wherein, the N is selected from any one base of A, T, C and G.

[0048] In the present application, when two target genes, gene A (upstream connecting gene) and gene B (downstream connecting gene), are connected: gene A is amplified using the first amplification primer pair, and a partial sequence of gene B is introduced into the 3' end of the obtained amplification product, and the number of bases from the first base of the first NGG sequence (PAM) starting from the 3' end to the 3' end of the amplification product is 20-30;

[0049] Gene B is amplified using the second amplification primer pair. The 5' end of the obtained amplification product has a partial sequence of gene A introduced therein, and the number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end in the amplification product is 20-30.

[0050] In S1 of this application, when the three target genes, gene A' (upstream connection gene), gene B' (middle connection gene) and gene C' (downstream connection gene), are connected in sequence:

[0051] Gene A' is amplified using the first amplification primer pair, and a partial sequence of gene B' is introduced into the 3' end of the obtained amplification product, and the number of bases from the first base of the first NGG sequence starting from the 3' end to the 3' end of the amplification product is 20-30;

[0052] Gene B' is amplified using the second amplification primer pair, and the resulting amplified product has a partial sequence of gene A' introduced at the 5' end and a partial sequence of gene C' introduced at the 3' end; and the number of bases in the amplified product from the last base of the first CCN sequence starting from the 5' end to the 5' end is 20-30, and the number of bases in the amplified product from the first base of the first NGG sequence starting from the 3' end to the 3' end is 20-30;

[0053] The third amplification primer pair is used to amplify gene C', and the 5' end of the obtained amplification product has a partial sequence of gene B' introduced, and the number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end in the amplification product is 20-30.

[0054] In some embodiments of the present application, the number of bases of all target genes is greater than 100. Preferably, when both the 5' end and the 3' end of the target gene need to be connected to other genes, the number of bases of the target gene is greater than 200. For example, the number of bases of the target gene can be 110, 150, 200, 300, 400, 500, 1000, 1500, 2000, 3000, 5000, 10000, or a range consisting of any two values ​​therebetween.

[0055] In the present application, when the two target genes, gene A (upstream connecting gene) and gene B (downstream connecting gene), are connected: the number of bases of gene A and gene B are both greater than 100; when the three target genes, gene A' (upstream connecting gene), gene B' (middle connecting gene) and gene C' (downstream connecting gene), are connected in sequence: the number of bases of gene A' and gene C' are both greater than 100, and the number of bases of gene B' is greater than 200.

[0056] This application controls the length of the target gene within the above range to ensure the expected connection product. The longer the target gene sequence, the more stable the single-stranded cantilever produced by the cutting, and the better the subsequent connection effect.

[0057] In some embodiments of the present application, the target gene used in the cloning method for long and ultra-long DNA fragments and another target gene linked to the target gene meet any of the following conditions:

[0058] (1) The nth to n-3th bases from the 3' end of the target gene are NGG, the m-3th to mth bases from the 5' end of another target gene connected to the target gene are CCN, and n+m=20-30; for example, the value of n+m can be 20, 22, 24, 26, 28, 30 or a range consisting of any two values ​​therebetween; in this application, the values ​​of n and m are both natural numbers;

[0059] (2) If the condition of (1) is not met, any codon encoding tryptophan or arginine within the nth base starting from the 3' end of the target gene is replaced with NGG; and / or

[0060] Replace any codon encoding proline within the mth base starting from the 5' end of another target gene connected to the target gene with CCN;

[0061] (3) If the conditions of (1) and (2) are not met, constructing a spacer sequence of at least 20 bases at the 3' end of the target gene by exogenous introduction without changing the function of the recombinant protein; and / or

[0062] Under the premise of not changing the function of the recombinant protein, a spacer sequence containing at least 20 bases is constructed at the 5' end of another target gene connected to the target gene by exogenous introduction, so that the modified target gene and the other target gene connected to the target gene meet the conditions of (1) or (2).

[0063] The present application does not particularly limit the upper limit of the length of the constructed spacer sequence, as long as it does not affect the biological activity of the recombinant protein. For example, the spacer sequence comprises 21 bases, 24 bases, 27 bases, 30 bases, or a range consisting of any two values ​​therebetween.

[0064] In the present application, (1) when two target genes, gene A (upstream connecting gene) and gene B (downstream connecting gene), are connected: the bases from the nth to the n-3th starting from the 3' end of gene A are NGG, the bases from the m-3th to the mth starting from the 5' end of gene B are CCN, and n+m=20-30.

[0065] When the three target genes, gene A' (upstream connecting gene), gene B' (middle connecting gene) and gene C' (downstream connecting gene) are connected in sequence: the bases from the n1th to the n1-3th bases starting from the 3' end of gene A' are NGG, the bases from the m1-3th to the m1th bases starting from the 5' end of gene B' are CCN, and n1+m1=20-30; the bases from the n2th to the n2-3th bases starting from the 3' end of gene B' are NGG, the bases from the m2-3th to the m2th bases starting from the 5' end of gene C' are CCN, and n2+m2=20-30.

[0066] (2) a) When connecting two target genes, gene A (upstream connecting gene) and gene B (downstream connecting gene), if the condition in (1) is not satisfied: any codon encoding tryptophan or arginine within the nth base starting from the 3' end of gene A is replaced with NGG, and gene B remains unchanged; or

[0067] Gene A remains unchanged, and any codon encoding proline within the mth base starting from the 5' end of gene B is replaced with CCN; or

[0068] Any codon encoding tryptophan or arginine within the nth base starting from the 3' end of gene A is replaced with NGG; and any codon encoding proline within the mth base starting from the 5' end of gene B is replaced with CCN.

[0069] b) When the three target genes, gene A' (upstream connection gene), gene B' (middle connection gene), and gene C' (downstream connection gene), are connected in sequence:

[0070] ① If gene A' and gene B' do not meet the condition (1): replace any codon encoding tryptophan or arginine within the nth base starting from the 3' end of gene A' with NGG, and gene B' remains unchanged; or

[0071] Gene A' remains unchanged, and any codon encoding proline within the mth base starting from the 5' end of gene B' is replaced with CCN; or

[0072] Any codon encoding tryptophan or arginine within the nth base starting from the 3' end of gene A' is replaced with NGG; and any codon encoding proline within the mth base starting from the 5' end of gene B' is replaced with CCN.

[0073] ② If gene B' and gene C' do not meet the condition (1): replace any codon encoding tryptophan or arginine within the nth base starting from the 3' end of gene B' with NGG, and gene C' remains unchanged; or

[0074] Gene B' remains unchanged, and any codon encoding proline within the mth base starting from the 5' end of gene C' is replaced with CCN; or

[0075] Any codon encoding tryptophan or arginine within the nth base from the 3' end of gene B' is replaced with NGG, and any codon encoding proline within the mth base from the 5' end of gene C' is replaced with CCN.

[0076] (3) a) When connecting two target genes, gene A (upstream link gene) and gene B (downstream link gene):

[0077] If the corresponding conditions of (1) and (2) are not met: construct a spacer sequence containing at least 20 bases at the 3' end of gene A by exogenous introduction without changing the function of the recombinant protein, and gene B remains unchanged, so that the modified gene A and gene B meet the conditions of (1) or (2); or

[0078] Gene A remains unchanged, and a spacer sequence containing at least 20 bases is constructed at the 5' end of gene B by exogenous introduction without changing the function of the recombinant protein, so that gene A and the modified gene B meet the conditions of (1) or (2); or

[0079] Under the premise of not changing the function of the recombinant protein, a spacer sequence containing at least 20 bases is constructed at the 3' end of gene A by exogenous introduction, and under the premise of not changing the function of the recombinant protein, a spacer sequence containing at least 20 bases is constructed at the 5' end of gene B by exogenous introduction, so that the modified gene A and the modified gene B meet the conditions of (1) or (2).

[0080] b) When the three target genes, gene A' (upstream connection gene), gene B' (middle connection gene), and gene C' (downstream connection gene), are connected in sequence:

[0081] ① If gene A' and gene B' do not meet the conditions of (1) and (2), without changing the function of the recombinant protein, a spacer sequence containing at least 20 bases is constructed at the 3' end of gene A' by exogenous introduction, and gene B' remains unchanged, so that the modified gene A' and gene B' meet the conditions of (1) or (2); or

[0082] Gene A' remains unchanged, and a spacer sequence containing at least 20 bases is constructed at the 5' end of gene B' by exogenous introduction without changing the function of the recombinant protein, so that gene A' and the modified gene B' meet the conditions of (1) or (2); or

[0083] Under the premise that the function of the recombinant protein is not changed, a spacer sequence containing at least 20 bases is constructed at the 3' end of gene A' by exogenous introduction. Under the premise that the function of the recombinant protein is not changed, a spacer sequence containing at least 20 bases is constructed at the 5' end of gene B' by exogenous introduction. The modified gene A' and the modified gene B' meet the conditions of (1) or (2).

[0084] ② If gene B' and gene C' do not meet the conditions of (1) and (2), without changing the function of the recombinant protein, a spacer sequence containing at least 20 bases is constructed at the 3' end of gene B' by exogenous introduction, and gene C' remains unchanged, so that the modified gene B' and gene B' meet the conditions of (1) or (2); or

[0085] Gene B' remains unchanged, and a spacer sequence containing at least 20 bases is constructed at the 5' end of gene C' by exogenous introduction without changing the function of the recombinant protein, so that gene B' and the modified gene C' meet the conditions of (1) or (2); or

[0086] Under the premise that the function of the recombinant protein is not changed, a spacer sequence containing at least 20 bases is constructed at the 3' end of gene B' by exogenous introduction, and under the premise that the function of the recombinant protein is not changed, a spacer sequence containing at least 20 bases is constructed at the 5' end of gene C' by exogenous introduction, so that the modified gene B' and the modified gene C' meet the conditions of (1) or (2).

[0087] In some embodiments of the present application, when the 3' end of the amplified product needs to be nicked, the downstream primer in the amplification primer pair includes an exogenous sequence, a binding sequence and a regulatory sequence; wherein the number of bases of the binding sequence is x, 3≤x≤27; the number of bases of the regulatory sequence is y, 15≤x+y≤27; the number of bases of the exogenous sequence is z, 20≤x+z≤30, z≥n (the upstream primer can be conventionally involved); and / or

[0088] When the 5' end of the amplified product needs to be nicked, the upstream primer in the amplification primer pair includes an exogenous sequence, a binding sequence and a regulatory sequence; wherein the number of bases of the binding sequence is x, 3≤x≤27; the number of bases of the regulatory sequence is y, 15≤x+y≤27; the number of bases of the exogenous sequence is z, 20≤x+z≤30, z≥m (the downstream primer can be conventional).

[0089] In the present application, the values ​​of x, y and z are all natural numbers, among which the value of x can be 3, 5, 10, 15, 22, 27 or a range consisting of any two values ​​therebetween; the value of x+y can be 15, 17, 19, 21, 23, 25, 27 or a range consisting of any two values ​​therebetween; the value of x+z can be 20, 22, 24, 26, 28, 30 or a range consisting of any two values ​​therebetween.

[0090] The regulatory sequence in this application is used to adjust the annealing temperature and binding specificity of the binding sequence; the binding sequence is used to recognize and anneal to the target gene sequence; and the exogenous sequence is introduced into the upstream or downstream connected gene fragment for identification purposes. When the 3' end of the amplified product requires nicking, the exogenous sequence is derived from the downstream connected gene fragment; when the 5' end of the amplified product requires nicking, the exogenous sequence is derived from the upstream connected gene fragment.

[0091] In the present application, if the number of bases z in the exogenous sequence is less than n or m, Taq polymerase or a similar enzyme needs to be used for finishing treatment before the subsequent use of T4 ligase.

[0092] The amplification primer pairs described in this application also need to meet the basic principles of primer design, including but not limited to: the G+C base content should be 40%-60% to avoid the appearance of secondary structures within the primers; the bases at the 3' end of the primers, especially the last base and the second to last base at the end, should be strictly paired, etc.

[0093] In some embodiments of the present application, the sgRNA includes a promoter sequence, an amplification product sequence, and a sequence that binds to a reverse primer. The present application does not specifically limit the promoter sequence, as long as it can achieve the purpose of the invention of the present application. For example, a T7 promoter sequence can be used. The present application uses sgRNA to guide the recognition site, which can reduce the number of enzymes used and reduce costs.

[0094] In some embodiments of the present application, the promoter sequence is shown as SEQ ID NO.9 (TTAATACGACTCACTATAGG), and the sequence that binds to the reverse primer is shown as SEQ ID NO.10 (GTTTTAGAGCTAGAAA TAGCA).

[0095] In some embodiments of the present application, the sequence of the amplified product is a sequence of 20 bases from the first base of the NGG sequence (the first NGG sequence starting from the 3' end) to the 5' end (when the 3' end of the amplified product needs to be nicked) in the amplified product; or, the reverse complementary sequence of a sequence of 20 bases from the last base of the CCN sequence (the first CCN sequence starting from the 5' end) to the 3' end (when the 5' end of the amplified product needs to be nicked) in the amplified product.

[0096] When designing the sgRNA primers for this application, a 20bp sequence at the 3' end of the amplified product containing CCN (when the 5' end of the amplified product needs to be nicked) or at the 5' end containing NGG (when the 3' end of the amplified product needs to be nicked) can be selected for forward primer design. The primer structure includes the T7 promoter (20bp), the amplified product sequence (20bp), and the sequence that actually binds to the reverse primer (21bp). For example, the sgRNA primer structure is as follows: 5'...TTAATACGACTCACTATAGG(N) 20 GTTTTAGAGCTAGAAATAGCA…3';

[0097] Among them, (N) 20Refers to the 20 bp sequence from the 3' end of the amplified product containing CCN (when the 5' end of the amplified product needs to be nicked) or the 5' end containing NGG (when the 3' end of the amplified product needs to be nicked); (N) 20 The previous sequence is the T7 promoter sequence; (N) 20 The subsequent sequence binds to the reverse primer, which corresponds to the sequence encoding the spCas9 scaffold.

[0098] In some embodiments of the present application, the Cas9 mutant protein comprises D10A and / or H840A. The D10A or H840A described in the present application is used in conjunction with sgRNA to nick the amplified product to obtain a nicked product with a single-stranded cantilever of 20-30 bases at the end, making the recognition between DNA chains more efficient and accurate. Compared with conventional restriction endonucleases, D10A and H840A are cheaper and do not have restrictions on sites such as methylation modification. Both D10A and H840A described in the present application can be purchased through commercial channels, for example, from Guangdong Huankai Microbiology Technology Co., Ltd.

[0099] In some embodiments of the present application, the mixing is to mix all the cleavage products in an equal molar ratio. For example, when two target genes, gene A (upstream connection gene) and gene B (downstream connection gene), are connected, the cleavage products of gene A and gene B are mixed at a molar ratio of 1:1; when three target genes, gene A' (upstream connection gene), gene B' (middle connection gene), and gene C' (downstream connection gene), are connected in sequence, the cleavage products of gene A', gene B', and gene C' are mixed at a molar ratio of 1:1:1.

[0100] In some embodiments of the present application, the cloning method applicable to long and ultra-long DNA fragments further includes the steps of: constructing a recombinant plasmid using the ligation product and a vector, and then transfecting it into competent cells for expanded culture.

[0101] In some embodiments of the present application, the cloning method for long and ultra-long DNA fragments comprises the steps of:

[0102] S1: Gene A (upstream linker gene) is amplified using the first amplification primer pair. The 3' end of the obtained amplification product is introduced with a partial sequence of gene B, and the amplification product A + The number of bases from the first base of the first NGG sequence (PAM) starting from the 3' end to the 3' end is 20-30; wherein the N is selected from any one of A, T, C and G;

[0103] S2: Use sgRNA2 to guide Cas9 mutant protein to amplify product A +Nicking is performed to obtain a nicking product A with a single-stranded cantilever of 20-30 bases at the end - ; Cutting method such as Figure 1 ( represents the PAM sequence, i.e., NGG);

[0104] S3: Repeat the above steps S1 and S2 to obtain the cut product B - ; Specifically include:

[0105] The second amplification primer pair is used to amplify gene B (downstream connection gene), and the 5' end of the obtained amplification product is introduced with a partial sequence of gene A, and the amplification product B + The number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end is 20-30;

[0106] sgRNA1 is used to guide Cas9 mutant protein to amplify product B + Nicking is performed to obtain a nicking product B with a single-stranded cantilever of 20-30 bases at the end - ;

[0107] S4: Cut product A - and cutting product B - Mix them in equal molar ratios and ligate them using T4 ligase to obtain a ligation product;

[0108] S5: Use the ligation product and vector to construct a recombinant plasmid, which is then transfected into competent cells for expansion culture;

[0109] The number of bases of gene A and gene B is greater than 100. The bases from the nth to the n-3th from the 3' end of gene A are NGG; the bases from the m-3th to the mth from the 5' end of gene B are CCN, and n+m=20-30;

[0110] The first amplification primer pair includes an upstream primer F1 and a downstream primer R1, wherein the downstream primer R1 includes an exogenous sequence, a binding sequence, and a regulatory sequence; the number of bases of the binding sequence is x1, 3≤x1≤27; the number of bases of the regulatory sequence is y1, 15≤x1+y1≤27; the number of bases of the exogenous sequence is z1, 20≤x1+z1≤30, z1≥n;

[0111] The second amplification primer pair includes an upstream primer F2 and a downstream primer R2, wherein the upstream primer F2 includes an exogenous sequence, a binding sequence, and a regulatory sequence; the number of bases of the binding sequence is x2, 3≤x2≤27; the number of bases of the regulatory sequence is y2, 15≤x2+y2≤27; the number of bases of the exogenous sequence is z2, 20≤x2+z2≤30, z2≥m;

[0112] The primer structure of sgRNA2 is as follows: 5'…TTAATACGACTCACTATAGG(N1) 20 GTTTTAGAGCTAGAAATAGCA…3', where (N1) 20 Amplification product A + A sequence of 20 bases from the first base of the NGG sequence (the first NGG sequence starting from the 3' end) to the 5' end;

[0113] The primer structure of sgRNA1 is as follows: 5'…TTAATACGACTCACTATAGG(N2) 20 GTTTTAGAGCTAGAAATAGCA…3', where (N2) 20 Amplification product B + The reverse complementary sequence of a sequence of 20 bases from the last base of the CCN sequence (the first CCN sequence starting from the 5' end) to the 3' end (when the 5' end of the amplified product needs to be nicked).

[0114] In some embodiments of the present application, the cloning method for long and ultra-long DNA fragments comprises the steps of:

[0115] S1: Amplify gene A' (upstream linker gene) using the first amplification primer pair, and obtain the amplified product A' + The 3' end of the gene is introduced with a partial sequence of gene B', and the amplified product A' + The number of bases from the first base of the first NGG sequence (PAM) starting from the 3' end to the 3' end is 20-30; wherein the N is selected from any one of A, T, C and G;

[0116] S2: sgRNA0 is used to guide the Cas9 mutant protein to amplify the product A' + Nicking is performed to obtain a nicking product A' with a single-stranded cantilever of 20-30 bases at the end - ;

[0117] S3: Repeat the above steps S1 and S2 to obtain the cleaved product B' - and C' - ; Specifically include:

[0118] The second amplification primer pair is used to amplify gene B' (middle connecting gene), and the amplified product B' is obtained. + The 5' end of the amplified product has a partial sequence of gene A' introduced, the 3' end of the amplified product has a partial sequence of gene C' introduced; and the amplified product B' +The number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end is 20-30, and the amplified product B' + The number of bases from the first base of the first NGG sequence (PAM) starting at the 3' end to the 3' end is 20-30;

[0119] sgRNA1 and sgRNA2 were used to guide the Cas9 mutant protein to amplify product B' + The nicking is performed to obtain a nicking product B' with single-stranded overhangs of 20-30 bases at the 5' and 3' ends respectively. - ; The schematic diagram of the cutting of the intermediate connecting gene is as follows Figure 2 (( Represents the PAM sequence, i.e., NGG));

[0120] The third amplification primer pair is used to amplify gene C' (downstream connection gene), and the 5' end of the obtained amplification product is introduced with a partial sequence of gene B', and the amplification product C' + The number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end is 20-30;

[0121] sgRNA1 was used to guide the Cas9 mutant protein to amplify the product C' + The nicking product C' is obtained with a single-stranded cantilever of 20-30 bases at the end. - ;

[0122] S4: Cut the product A' - , cutting product B' - and the cleavage product C' - Mix them in equal molar ratios and ligate them using T4 ligase to obtain a ligation product;

[0123] S5: Use the ligation product and vector to construct a recombinant plasmid, which is then transfected into competent cells for expansion culture;

[0124] Among them, the number of bases of gene A' and gene C' are both greater than 100, the number of bases of gene B is greater than 200, the bases from the n1th to the n1-3th base starting from the 3' end of gene A' are NGG; the bases from the m1-3th to the m1th base starting from the 5' end of gene B' are NGG, and n1+m1=20-30; the bases from the n2th to the n2-3th base starting from the 3' end of gene B' are NGG; the bases from the m2-3th to the m2th base starting from the 5' end of gene C' are NGG, and n2+m2=20-30;

[0125] The first amplification primer pair includes an upstream primer F1 and a downstream primer R1, wherein the downstream primer R1 includes an exogenous sequence, a binding sequence, and a regulatory sequence; the number of bases of the binding sequence is x1, 3≤x1≤27; the number of bases of the regulatory sequence is y1, 15≤x1+y1≤27; the number of bases of the exogenous sequence is z1, 20≤x1+z1≤30, and z1≥n1;

[0126] The second amplification primer pair includes an upstream primer F2 and a downstream primer R2, wherein the upstream primer F2 includes an exogenous sequence, a binding sequence, and a regulatory sequence; the number of bases of the binding sequence is x2, 3≤x2≤27; the number of bases of the regulatory sequence is y2, 15≤x2+y2≤27; the number of bases of the exogenous sequence is z2, 20≤x2+z2≤30, and z2≥m1; the downstream primer R2 includes an exogenous sequence, a binding sequence, and a regulatory sequence; the number of bases of the binding sequence is x3, 3≤x3≤27; the number of bases of the regulatory sequence is y3, 15≤x3+y3≤27; the number of bases of the exogenous sequence is z3, 20≤x3+z3≤30, and z3≥n2;

[0127] The third amplification primer pair includes an upstream primer F3 and a downstream primer R3, wherein the upstream primer F3 includes an exogenous sequence, a binding sequence, and a regulatory sequence; the number of bases of the binding sequence is x4, 3≤x4≤27; the number of bases of the regulatory sequence is y4, 15≤x4+y4≤27; the number of bases of the exogenous sequence is z4, 20≤x4+z4≤30, and z4≥m2;

[0128] The primer structure of sgRNA0 is as follows: 5'…TTAATACGACTCACTATAGG(N1) 20 GTTTTAGAGCTAGAAATAGCA…3', where (N0) 20 Amplification product A' + A sequence of 20 bases from the first base of the NGG sequence (the first NGG sequence starting from the 3' end) to the 5' end;

[0129] The primer structure of sgRNA1 is as follows: 5'…TTAATACGACTCACTATAGG(N2) 20 GTTTTAGAGCTAGAAATAGCA…3', where (N1) 20 Amplification product B' + The reverse complementary sequence of the sequence consisting of 20 bases from the last base of the CCN sequence (the first CCN sequence starting from the 5' end) to the 3' end (when the 5' end of the amplified product needs to be nicked);

[0130] The primer structure of sgRNA2 is as follows: 5'…TTAATACGACTCACTATAGG(N3) 20 GTTTTAGAGCTAGAAATAGCA…3', where (N3) 20 Amplification product B' + A sequence of 20 bases from the first base of the NGG sequence (the first NGG sequence starting from the 3' end) to the 5' end;

[0131] The primer structure of sgRNA3 is as follows: 5'…TTAATACGACTCACTATAGG(N4) 20 GTTTTAGAGCTAGAAATAGCA…3', where (N4) 20 Amplification product C' + The reverse complementary sequence of a sequence of 20 bases from the last base of the CCN sequence (the first CCN sequence starting from the 5' end) to the 3' end (when the 5' end of the amplified product needs to be nicked).

[0132] Example

[0133] The following examples and comparative examples are provided to more specifically illustrate the embodiments of the present invention. Various tests and evaluations were performed according to the following methods. In addition, unless otherwise specified, "parts" and "%" are based on mass.

[0134] Example 1

[0135] The nucleotide sequence of Gene A is shown in SEQ ID NO.1: 5’-ATGCAGGACGAGGAGAGATACATG ACCCTGAACGTGCAGAGCAAGAAGAGGAGCAGCGCCCAGACCAGCCAGCTGACCTTCAAGGACTACAGCGTGACCCTGCACTGGTACAAGCTGAGGCACAGGAGGCAGGGCAAGCACTGGACCAGCACCCAGAGAAAGGCTGACTTCCAGCACGATGCCCAGGAGGAAAACCTGTATGCTGCCGTGAAGCACACACAGCCTGAGGATGGCGTGGAGATGGACACAAGGAGCCCTCACGACGAGGACCCTCAGGCTGTGACCTATGCCGAGGTGAAGCACAGCAGACCCAGGAGAGAGATGGCCTCTCCTCCTAGCCCTCTGTCTGGCGAGTTCCTGGACACCAAGGACAGACAGGCCGAGGAGGACAGGCAGATGGACACAGAGGCTGCTGCTTCTGAAGCCCCTCAGGACGTGACCTACGCCCAGCTGCACAGCTTGACACTGAGAAGGGAGGCTACAGAGCCTCCTCCTAGCCAGGAAGGCCCCTCTCCTGCTGTTCCCTCTATCTACGCCACACTGGCCATCCAC-3’, with a length of 552bp.

[0136] The nucleotide sequence of gene B is shown in SEQ ID NO. 2: 5'-TGGTTCCTGCCGAGAGAGAGACA -3', with a length of 648 bp.

[0137] The gene A contains a TGG sequence at 11 bp near the 3' end (n=11), and the gene B contains a CCG sequence at 12 bp near the 3' end (m=12).

[0138] 1. Primer design

[0139] The amplification primer pair for gene A includes an upstream primer F1 and a downstream primer R1, wherein the nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO.3: 5'-CGGCAGGAACCA-GTGGATGGCCAGTGTGGCG-3'; wherein the sequence before "-" is an exogenous sequence, and the sequence after "-" is a regulatory sequence and a binding sequence.

[0140] The nucleotide sequence of the upstream primer F1 is shown in SEQ ID NO. 5: 5'-ATGCAGGACGAGGAGAGATACATGAC-3'.

[0141] The amplification primer pair for gene B includes an upstream primer F2 and a downstream primer R2, wherein the nucleotide sequence of the upstream primer F2 is shown in SEQ ID NO.4: 5'-CACTGGCCATCCAC-TGGTTCCTGCCGAGAGAG-3'; wherein the sequence before "-" is the exogenous sequence, and the sequence after "-" is the regulatory sequence and the binding sequence.

[0142] The nucleotide sequence of the downstream primer R2 is shown in SEQ ID NO. 6: 5'-TCTAGGAGGCAGGGCCTGCATG-3'.

[0143] The nucleotide sequence of sgRNA1 is shown in SEQ ID NO.7: 5'-TTAATACGACTCACTATAGG TCCCTCTAT CTACGCCACAC GTTTTAGAGCTAGAAATAGCA-3'; the underlined part is the amplified product fragment.

[0144] The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.8: 5'-TTAATACGACTCACTATAGG TACTCCTCC TGTCTCTCTCT GTTTTAGAGCTAGAAATAGCA-3'; the underlined part is the amplified product fragment.

[0145] 2. Experimental methods

[0146] 1) Prepare reaction system A on ice: 20 μL of Prime STAR Max Premix (2×), 1 μL of gene A (1 ng / μL) as shown in SEQ ID NO.1, 1 μL each of downstream primer R1 (100 μM) as shown in SEQ ID NO.3 and upstream primer F1 (100 μM) as shown in SEQ ID NO.5, and 17 μL of enzyme-free water. Immediately place the prepared reaction system A in a PCR instrument and perform the following reaction program: 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 10 seconds for 30 cycles to obtain amplified product A. + .

[0147] Prepare reaction system B on ice: Prime STAR Max Premix (2×) 20 μL, gene B (1 ng / μL) 1 μL, upstream primer F2 (100 μM) and downstream primer R2 (100 μM) 1 μL each of SEQ ID NO. 4 and SEQ ID NO. 6, and enzyme-free water 17 μL. Immediately place the prepared reaction system B in a PCR instrument and perform the following reaction program: 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 10 seconds for 30 cycles to obtain amplified product B. + .

[0148] 2) The amplified products A and B were analyzed by 1.2% (w / v) agarose gel electrophoresis. + and amplification product B + For detection, the electrophoresis condition was 110V for 40min.

[0149] 3) Using the Tiangen Agarose Gel DNA Recovery Kit, the DNA fragments of the corresponding size bands were purified and recovered according to the instructions. After amplification of gene A shown in SEQ ID NO.1, a 500-600 bp band was recovered; after amplification of gene B shown in SEQ ID NO.2, a 600-700 bp band was recovered.

[0150] 4) Prepare the reaction system on ice: 10 μL of 2× sgRNA Reaction Buffer, 2 μL of sgRNA1 (10 μM) (SEQ ID NO. 7), 2 μL of Enzyme Mix, and 6 μL of RNase-free water. Immediately place the reaction system in a PCR instrument and incubate at 37°C for 1 hour and 70°C for 10 minutes to obtain the first transcript.

[0151] Prepare the following reaction mixture on ice: 10 μL of 2× sgRNA Reaction Buffer, 2 μL of sgRNA2 (10 μM) as described in SEQ ID NO. 8, 2 μL of Enzyme Mix, and 6 μL of RNase-free water. Immediately transfer the reaction mixture to a PCR instrument and incubate at 37°C for 1 hour and 70°C for 10 minutes to obtain the secondary transcript.

[0152] 5) Add 1 μL of DNase I to each of the first and second transcripts obtained in 4), react at 37°C for 10 min to remove the DNA template, and then react the reaction products at 75°C for 10 min to obtain sgRNA1 and sgRNA2 products, respectively, and store at -20°C.

[0153] 6) Prepare the reaction system on ice: 3.5 μL of the gel-cleaved product of gene A (56.6 ng / μL) as shown in SEQ ID NO. 1, 9.8 μL of the sgRNA1 product (20.5 ng / μL) as shown in SEQ ID NO. 7, 0.7 μL of Cas9 D10A Nickase (0.1 μg / μL), 2 μL of 10× Reaction Buffer, and 4 μL of RNase-free water. Immediately place the prepared reaction system in a PCR instrument and follow the following procedure: incubate at 37°C for 1 hour, 70°C for 10 minutes, 94°C for 3 minutes, and hold at 4°C to obtain the nicked product A. - .

[0154] Prepare the reaction system on ice: 3.5 μL of the gel-cleaved product (56.6 ng / μL) of gene B shown in SEQ ID NO. 2, 9.8 μL of the sgRNA1 product (20.5 ng / μL) shown in SEQ ID NO. 8, 0.7 μL of Cas9 D10A Nickase (0.1 μg / μL), 2 μL of 10× Reaction Buffer, and 4 μL of RNase-free water. Immediately place the prepared reaction system in a PCR instrument. The reaction program is as follows: incubate at 37°C for 1 hour, incubate at 70°C for 10 minutes, then at 94°C for 3 minutes, and then hold at 4°C to obtain the nicked product B. - .

[0155] 7) Prepare the reaction on ice: - , cutting product B - Add 2.5 μL of each, 2 μL of T4 ligase reaction buffer (10×), 0.5 μL of T4 ligase (2000 U / μL), and 12.5 μL of enzyme-free water. Immediately place the prepared reaction system in a PCR instrument and perform 50 cycles of incubation at 37°C for 1 minute, then at 16°C for 1 minute, followed by incubation at 37°C for 5 minutes and at 60°C for 5 minutes to obtain the ligation product.

[0156] 8) Prepare the reaction system on ice: 20 μL of PrimeSTAR Max Premix (2×), 1 μL each of upstream primer F1 (100 μM) of SEQ ID NO. 5 and downstream primer R2 (100 μM) of SEQ ID NO. 6, 2 μL of the ligation product from 7), and 16 μL of enzyme-free water. Immediately place the reaction system in a PCR instrument and run the following cycle: 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 10 seconds, for 25 cycles.

[0157] 9) The amplified ligation products were detected by 1.2% (w / v) agarose gel electrophoresis at 110 V for 40 min.

[0158] Test results such as Figure 3 As shown, Scheme 1 represents the amplified connection product of Example 1 of the present application, Scheme 2 is the connection product obtained by using Golden Gate cloning technology, Gene 1 represents Gene A used in Example 1 of the present application, and Gene 2 represents Gene B used in Example 1 of the present application. Figure 3 It can be seen that the cloning method for long and ultra-long DNA fragments described in this application can successfully connect gene A and gene B to form a long DNA fragment; while the Golden Gate cloning technology cannot connect gene A and gene B.

[0159] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application shall be included in the scope of protection of the present application.

Claims

1. A cloning method for long and ultra-long DNA fragments, wherein: Including steps: Amplifying the target gene using an amplification primer pair, wherein the 3' end of the obtained amplification product has a partial sequence of the downstream connected gene introduced and / or the 5' end has a partial sequence of the upstream connected gene introduced; The amplified product is nicked using a Cas9 mutant protein guided by sgRNA to obtain a nicked product with a single-stranded overhang of 20-30 bases at the end; Repeat the above steps to obtain another target gene nicking product connected to the target gene; All the nicking products are mixed and ligated using a ligase to obtain a ligation product.

2. The method according to claim 1, wherein The number of bases from the first base of the first NGG sequence starting from the 3' end to the 3' end of the amplified product is 20-30 and / or the number of bases from the last base of the first CCN sequence starting from the 5' end to the 5' end of the amplified product is 20-30; wherein, the N is selected from any one base of A, T, C and G.

3. The method according to claim 1, wherein The number of bases of all target genes is greater than 100; preferably, when both the 5' end and the 3' end of the target gene need to be connected to other genes, the number of bases of the target gene is greater than 200.

4. The method according to claim 1, wherein any of the following conditions is met: (1) The nth to n-3th bases from the 3' end of the target gene are NGG, the m-3th to mth bases from the 5' end of another target gene connected to the target gene are CCN, and n+m=20-30; (2) If the condition of (1) is not met, any codon encoding tryptophan or arginine within the nth base starting from the 3' end of the target gene is replaced with NGG; and / or Replace any codon encoding proline within the mth base starting from the 5' end of another target gene connected to the target gene with CCN; (3) If the conditions of (1) and (2) are not met, constructing a spacer sequence of at least 20 bases at the 3' end of the target gene by exogenous introduction without changing the function of the recombinant protein; and / or Under the premise of not changing the function of the recombinant protein, a spacer sequence containing at least 20 bases is constructed at the 5' end of another target gene connected to the target gene by exogenous introduction, so that the modified target gene and the other target gene connected to the target gene meet the conditions of (1) or (2).

5. The method according to claim 1, wherein When the 3' end of the amplified product needs to be nicked, the downstream primer in the amplification primer pair includes an exogenous sequence, a binding sequence, and a regulatory sequence; wherein the number of bases of the binding sequence is x, 3≤x≤27; the number of bases of the regulatory sequence is y, 15≤x+y≤27; the number of bases of the exogenous sequence is z, 20≤x+z≤30, z≥n; and / or When the 5' end of the amplified product needs to be nicked, the upstream primer in the amplification primer pair includes an exogenous sequence, a binding sequence and a regulatory sequence; wherein the number of bases of the binding sequence is x, 3≤x≤27; the number of bases of the regulatory sequence is y, 15≤x+y≤27; and the number of bases of the exogenous sequence is z, 20≤x+z≤30, z≥m.

6. The method according to claim 1, wherein The sgRNA includes a promoter sequence, an amplification product sequence, and a sequence that binds to a reverse primer.

7. The method according to claim 6, wherein: The promoter sequence is shown in SEQ ID NO.9, and the sequence that binds to the reverse primer is shown in SEQ ID NO.

10.

8. The method according to claim 6, wherein: The amplification product sequence is a sequence of 20 bases from the first base of the NGG sequence to the 5' end of the amplification product; or, The complementary sequence of the amplified product comprises 20 bases from the last base of the GGN sequence to the 5' end.

9. The method according to claim 1, wherein: The Cas9 mutant protein comprises D10A and / or H840A.

10. The method according to claim 1, wherein The mixing is to mix all the cutting products in an equal molar ratio.

11. The method according to claim 1, wherein The method further comprises the steps of: using the connection product and a vector to construct a recombinant plasmid, and then transfecting the recombinant plasmid into competent cells for expanded culture.

Images