Promoter P1 for ackermania mucophila exogenous gene expression, recombinant vector, recombinant bacteria and application thereof

By screening the high-expression promoter P1 and using double-crossover recombination technology, the Lux CDABE luminescence system was integrated into the genome of Akkermansia muciniphila, and the recombinant strain Akkermansia muciniphila SDLYAKK8-Lux was constructed, which solved the genetic manipulation difficulties and stable expression problems of exogenous genes in this strain and realized the application of in vivo imaging technology.

CN120683114AActive Publication Date: 2025-09-23LINYI UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511189676.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-25
Publication Date
2025-09-23
Estimated Expiration
2045-08-25

AI Technical Summary

Technical Problem

Genetic manipulation of Akkermansia muciniphila is difficult, and exogenous genes are difficult to express stably, resulting in the inability of existing technologies to achieve real-time monitoring and research of its colonization in the body.

Method used

The high-expression promoter P1 was screened, and the Lux CDABE luminescence system was integrated into the genome of Akkermansia muciniphila through double-crossover recombination technology to construct the recombinant strain Akkermansia muciniphila SDLYAKK8-Lux, realizing stable expression of exogenous genes and in vivo imaging.

Benefits of technology

Non-invasive, continuous visual monitoring of Akkermansia muciniphila was achieved, solving the problem of stable expression of exogenous genes in this strain and supporting the visualization of the real-time colonization process in living animals.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683114A_ABST
    Figure CN120683114A_ABST
Patent Text Reader

Abstract

The invention discloses a promoter P1 for ackermania mucophila exogenous gene expression, a recombinant vector, a recombinant bacterium and application of the promoter P1 and the recombinant bacterium. Belongs to the technical field of gene engineering. According to the application, the strong promoter capable of being used for the expression of the ackermania mucophila exogenous gene is screened for the first time, and the strong promoter has super-strong expression quantity. According to the invention, a recombinant plasmid capable of inserting a Lux CDABE report system into Ackerman muciniphila is constructed at the same time, a method for recombining the Lux CDABE report system into an Ackerman muciniphila genome by using a double exchange mode is established on the basis, and a luminous Akkermansia muciniphila SDLYAKK8-Lux strain is successfully constructed, so that the luminous Akkermansia muciniphila SDLYAKK8-Lux strain can be used for preparing the recombinant plasmid for the Ackerman muciniphila, and the luminous Akkermansia muciniphila SDLYAKK8-Lux strain can be used for preparing the Akkerman muciniphila SDLYAKK8-Lux strain. Research finds that the luminous intensity of the strain is strongly related to the number of the strains, and the blank that no living body fluorescence imaging construction method for the AKK bacteria exists is filled up.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and more particularly to a promoter P1 for expressing exogenous genes of Akkermansia muciniphila, a recombinant vector, a recombinant bacterium thereof and applications thereof. Background Art

[0002] Akkermansia muciniphila (AKK) is a Gram-negative anaerobic bacterium native to the human intestine. It uses mucin as its sole source of carbon, nitrogen, and energy. It hydrolyzes mucin to release free sulfate, which is then fermented to produce acetic and propionic acids. AKK is a ubiquitous colonizer of the human intestine, comprising approximately 0.5% to 5% of the human microbiome. Research has shown that AKK has significant potential in improving metabolic diseases (such as obesity and diabetes), limiting inflammation, combating aging, and assisting in cancer immunotherapy. It has been hailed as a promising candidate for second-generation probiotics.

[0003] Currently, most detections of Akkermansia muciniphila colonization in vivo are performed using high-throughput sequencing methods, such as mouse feces or intestinal contents collected after dissection. This method has a serious lag and cannot reflect the actual replication and colonization of AKK bacteria in the body in real time.

[0004] The Lux CDABE system is a bacterial bioluminescence reporter system. Different from the luciferase bioluminescence reporter system and the fluorescence reporter system, the Lux CDABE reporter system has the advantages of not requiring the addition of substrate, strong luminescence signal, and high signal-to-noise ratio. It can reflect the bacterial growth level in real time and is currently widely used in many bacterial live imaging applications.

[0005] Akkermansia muciniphila's slow growth rate, difficulty in genetic manipulation, and difficulty in stably expressing exogenous genes in vivo have hindered the development of genetic research in AKK bacteria. Consequently, there is currently no research on exogenous gene expression in AKK bacteria. There are also few reports on the construction of exogenous gene promoters and in vivo fluorescence imaging methods for AKK bacteria, as well as related research.

[0006] Therefore, how to develop corresponding promoters and exogenous gene editing systems for Akkermansia muciniphila and develop corresponding in vivo imaging technologies is a technical problem that needs to be urgently solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention provides a promoter P1 for the expression of exogenous genes in Akkermansia muciniphila, a recombinant vector, a recombinant bacterium and its application. In view of the problems of difficult genetic manipulation of AKK bacteria and difficult stable expression of exogenous genes, the present invention successfully screened out the high-expression promoter P1, and innovatively designed the pCONJ4s-Lux recombinant plasmid. The luminescence system was precisely integrated into the genome through double-exchange recombination technology, overcoming the problem of stable expression of exogenous genes in the bacteria. The AKK luminescent strain Akkermansia muciniphila SDLYAKK8-Lux was successfully constructed, realizing the first non-invasive and continuous visual monitoring of the AKK bacteria colonization process in living animals.

[0008] The first object of the present application is to provide: a promoter P1 for expressing an exogenous gene of Akkermansia muciniphila, wherein the nucleotide sequence of the promoter P1 is shown in SEQ ID NO.2;

[0009] Or it can be represented by a nucleotide sequence that still maintains promoter activity after one or more bases are replaced, deleted and / or added to the sequence shown in SEQ ID NO. 2.

[0010] Another object of the present application is to provide: a recombinant vector, which includes the promoter P1 sequence; and also includes upstream and downstream homology arm sequences homologous to the recipient bacteria or recipient cells, a Lux CDABE expression cassette sequence, and a resistance screening sequence.

[0011] In one embodiment, the recombinant vector is pCONJ4s-Lux, and its nucleotide sequence is shown in SEQ ID NO.13.

[0012] Another object of the present application is to provide: a recombinant bacterium, wherein the recombinant bacterium comprises the promoter or the recombinant vector.

[0013] In one embodiment, the recombinant bacterium is Akkermansia muciniphila SDLYAKK8-Lux, which is deposited in China Center for Type Culture Collection with a deposit date of 2025.07.02 and a deposit number of CCTCC NO: M 20251508.

[0014] Another object of the present application is to provide a method for constructing the recombinant bacteria, comprising the following steps:

[0015] (1) Screening a strong promoter of Akkermansia muciniphila, the sequence of which is shown in SEQ ID NO. 2;

[0016] (2) Design primers for upstream and downstream homology arms, P1 promoter, Lux CDABE expression cassette, and resistance screening expression cassette, and amplify the corresponding fragments for future use;

[0017] (3) Using pCONJ4s as the backbone plasmid, single enzyme digestion was performed with the amplified fragment in step (2) to perform homologous recombination to obtain a homologous recombination vector;

[0018] (4) Use the double exchange method to obtain recombinant bacteria.

[0019] Another object of the present application is to provide: a living imaging system, comprising the recombinant bacteria.

[0020] Another object of the present application is to provide: an application of the promoter P1, wherein the application is in any of the following directions:

[0021] (1) Application in genetic engineering of Akkermansia muciniphila;

[0022] (2) Application in constructing a recombinant plasmid for introducing the Lux CDABEDE bacterial bioluminescent reporter system into Akkermansia muciniphila;

[0023] (3) Application in the construction of recombinant bacteria containing the Lux CDABEDE bacterial bioluminescence reporter system;

[0024] (4) Application in constructing an in vivo imaging system containing the Lux CDABEDE bacterial bioluminescence reporter system;

[0025] (5) Application of in vivo imaging technology to reflect the proliferation and colonization of Akkermansia muciniphila in real time.

[0026] Another object of the present application is to provide: an application of the recombinant vector or the recombinant bacteria, wherein the application is in any of the following directions:

[0027] (1) Application in constructing an in vivo imaging system containing the Lux CDABEDE bacterial bioluminescence reporter system;

[0028] (2) Application of in vivo imaging technology to reflect the proliferation and colonization of Akkermansia muciniphila in real time.

[0029] Another object of the present application is to provide: an application of the in vivo imaging system in real-time reflection of the proliferation and colonization of Akkermansia muciniphila in vivo based on in vivo imaging technology.

[0030] It can be seen from the above technical solutions that compared with the prior art, the present invention has the following beneficial effects:

[0031] 1) The present invention provides a promoter P1, a recombinant vector, and its recombinant bacteria and applications for expressing exogenous genes in Akkermansia muciniphila. To address the difficulties in genetic manipulation of Akkermansia and the difficulty in stably expressing exogenous genes, the present invention successfully screened for the first time a high-expression promoter P1. This promoter has exceptional expression, is only 238 bp in length, yet achieves ultra-high activity. It is easier to use in genetic engineering vector construction than traditional long promoters (>500 bp), and is both efficient and convenient.

[0032] 2) In addition, this application innovatively designed the pCONJ4s-Lux recombinant plasmid, and accurately integrated the luminescence system into the AKK bacteria genome through double-crossover recombination technology, overcoming the difficulty of stable expression of exogenous genes in this bacterium. The AKK luminescent strain Akkermansia muciniphila SDLYAKK8-Lux was successfully constructed, realizing the first non-invasive, continuous visual monitoring of the AKK bacteria colonization process in living animals.

[0033] 3) In the process of constructing the recombinant luminescent strain, this application selected an AKK β-lactamase gene as the insertion site. The destruction of this gene does not affect the growth of AKK bacteria. In addition, this application adopts a scarless insertion method, and only the promoter + Lux will be preserved in the end, and no other genes will remain. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0035] Figure 1 For: Akkermansia muciniphila recombinant plasmid pCONJ4s-Lux.

[0036] Figure 2 Figure 1: Competent cells of the donor bacterium SM10λpir containing the recombinant plasmid pCONJ4s-Lux observed by a living imaging device.

[0037] Figure 3 It is the aerobic conjugation process between donor bacteria and recipient bacteria.

[0038] Figure 4 For: Akkermansia muciniphila SDLYAKK8-Lux strain observed by live imaging.

[0039] Figure 5Figure 2: In vitro growth curves of Akkermansia muciniphila SDLYAKK8-Lux strain and wild-type strain SDLYAKK8.

[0040] Figure 6 Figure 2: Relationship between the luminescence brightness of Akkermansia muciniphila SDLYAKK8-Lux strain and the number of strains.

[0041] Figure 7 Figure 2: Colonization of Akkermansia muciniphila SDLYAKK8-Lux strain in mice at different times.

[0042] Figure 8 The Akkermansia muciniphila SDLYAKK8-Lux strain mainly colonizes the mouse colon. DETAILED DESCRIPTION

[0043] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0044] The materials used in the examples of this application are as follows:

[0045] Plasmid pBBR1MCS4-LuxCDABE containing the Lux CDABE luminescent expression cassette was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0046] Backbone plasmid pCONJ4s: This plasmid is maintained in our laboratory and its construction method is disclosed in Liu G, Beaton SE, Grieve AG, EvansR, Rogers M, Strisovsky K, Armstrong FA, Freeman M, Exley RM, Tang CM. Bacterial rhomboid proteases mediate quality control of orphan membrane proteins. EMBO J. 2020 May 18;39(10):e102922. doi: 10.15252 / embj.2019102922. Epub 2020 Apr 27. PMID: 32337752; PMCID: PMC7232013.

[0047] Akkermansia muciniphila SDLYAKK8 strain: This strain has been disclosed in the paper "Complete Genome and Biological Characterization of Akkermansia muciniphila Isolates." GenbanK accession number: CP115935. It is currently held by the applicant and may be made available to the public for the purpose of satisfying patent disclosure requirements.

[0048] In addition, the starting strain used in the present application can be any other Akkermansia muciniphila strain other than the Akkermansia muciniphila SDLYAKK8 strain, as long as the genome sequence of the selected strain contains the sequence shown in SEQ ID NO.1.

[0049] Ttattcttttccggcggcaggtctccactccatgcacagccagcgggccatggaggcaatcacccggtcacaagcggattcagaatcctttgaatccctgataaacacggaaaccgccattttccggccgttgggaagaacaatgatgccgacgtcattgcgggcggtaacgccaccccccggcagcgtgaatccggatcccgtcttatgcgccaccacgtaatcccgcggcagctgccctttcaaacgttcagggcctgtagagcaccccgccatgataccccaaagaaaattctgtgtaccccttgccagaattttaccttcgtcaaacgcccggagcagggagttcatggccgacggacggcttgagttgacatattgcaaatcatgattccggtgtatttcttcttccgtaaaacggacattaatgccgtcaattccccattccttcaaatccttctgcacggcctgcggccctccaataaggccaaacaggagggaggtcgcaggtgttgttgtcgctttcctggacagtcactctcagcagttccttcagagagaaatcgccgccttgcgggaaacgctcccggagggggctccaggtatctttcaccagttgttccggacgtatgcggatgatctgttccagattcatggcgccctggtccacccgcttcaagacagacaaggccagcacgaatttgacgacgctctgcatgggataggccgcctcatcccccaccatgacggtttcccccgtatccagcatttccgcagccatgcccacacgggccttcagggaatgggccagttcgcgtacggcggaggaatccgctgcggaaacggctggcggagaagacgtggccccctgagaaaaaacgcaaaagaacat, SEQ ID NO.1.

[0050] Plasmid PBAD33: Purchased from Shanghai Zeye Biotechnology Co., Ltd.

[0051] SM10λpir competent cells were purchased from Shanghai Yaji Biotechnology Co., Ltd.

[0052] Example 1

[0053] Screening of strong promoters for the expression of exogenous genes in Akkermansia muciniphila

[0054] After Akkermansia muciniphila SDLYAKK8 was cultured in liquid culture medium to the logarithmic phase, the supernatant was discarded after centrifugation at 12,000 rpm for 10 minutes at 4°C. The precipitate was quickly frozen in liquid nitrogen and sent to Shanghai Paisonno Biotechnology Co., Ltd. for transcriptome analysis. The promoter of the gene with the highest mRNA expression level was selected as the target promoter. The nucleotide sequence of the P1 promoter was determined as follows:

[0055] P1 promoter nucleotide sequence:

[0056] GTTCCCTACCGTGCCTCAAGAAGGCGCCCCATGCAAGCCGGCGCTCCGTACGTGCCCCCGGACTGTCAAACTTACCCCGGAGGCCAAAAGCGCGTCCTCATCAAAAAAACCGCCCTAAAAAGAATCCTCTCCGCGTATTTTTTTGAACAAAAATCACTCCCTGCCGCTCTATCTGTCGTAGAACGGCAGCTCTTCTGCCGCTGCATTACCAACACCACACAACCTCACATATCATTAT, SEQ ID NO. 2.

[0057] Table 1 Strong promoters of Akkermansia muciniphila

[0058]

[0059] Example 2

[0060] Construction of a recombinant plasmid expressing the luminescent system Lux CDABE protein in Akkermansia muciniphila

[0061] (1) Single enzyme digestion of backbone plasmid

[0062] Streak competent S17-1λpir cells containing the pCONJ4s plasmid, stored at -80°C, onto LB nutrient agar plates containing AMP-resistant strains. Incubate overnight. Once a single colony has grown, pick it and transfer it to LB liquid medium containing AMP-resistant strains. After overnight incubation, extract 5 mL of the culture medium according to the instructions for the Norvegance Plasmid Extraction Kit. After measuring the concentration, digest the plasmid using the NEB PmeI Express Enzyme instructions. After gel electrophoresis, recover the digested product using the Norvegance Gel Extraction Kit. After measuring the concentration, store at -20°C until further use.

[0063] (2) Amplification and recovery of homology arms, resistance expression cassettes, and luminescence expression cassettes

[0064] Upstream homology arm Up-arm primer, P1 promoter primer, Lux CDABE expression cassette primer, downstream homology arm primer Down-arm, chloramphenicol expression cassette primer were designed. The specific primer sequences are shown in Table 2.

[0065] Table 2 Primer sequences used to construct recombinant plasmids

[0066] The templates used for the upstream homology arm, promoter, and downstream homology arm were the genomic DNA of the strain SDLYAKK8, the template used for the chloramphenicol expression cassette was the plasmid pBAD33 (purchased from Shanghai Zeye Biotechnology Co., Ltd.), and the template used for the Lux CDABE expression cassette was the plasmid pBBR1MCS4-LuxCDABE (purchased from Wuhan Miaoling Biotechnology Co., Ltd.).

[0067] The corresponding products were amplified using Norvegren high-fidelity enzymes. The corresponding amplification system is shown in Table 3. PCR reactions were performed under the following conditions: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 58°C for 30 s; extension at 72°C for 2 min; and 30 cycles of extension at 72°C for 7 min and 4°C for 10 min.

[0068] Table 3 PCR amplification reaction system

[0069]

[0070] The PCR product was then subjected to agarose gel electrophoresis, and the fragment was purified using a gel recovery kit and the concentration was measured. The purified pCONJ4s single enzyme digestion product, upstream homology arm, promoter, Lux CDABE expression cassette primer, downstream homology arm, and chloramphenicol expression cassette product were homologously recombined according to the instructions of the Novozyme multi-fragment homologous recombination kit to obtain the Akkermansia muciniphila recombinant plasmid pCONJ4s-Lux ( Figure 1

[0071] Example 3

[0072] Obtaining the Akkermansia muciniphila SDLYAKK8-Lux Luminescent Strain by Double Crossover

[0073] (1) Preparation of donor bacteria:

[0074] The recombinant plasmid pCONJ4s-Lux of Example 2 was transformed into the competent cells of the donor bacteria SM10λpir and stored at -80°C for future use. The fluorescent bacteria were observed by the in vivo imaging system ( Figure 2 ).

[0075] (2) Cultivation of recipient bacteria:

[0076] Akkermansia muciniphila SDLYAKK8 strain was used as the recipient bacteria, which was revived from a -80°C freezer, cultured to the logarithmic phase, and set aside.

[0077] (3) Donor bacteria and recipient bacteria culture conjugation

[0078] Take 2 mL of donor bacteria and 1 mL of recipient bacteria, centrifuge the donor bacteria at 3000 rpm for 3 minutes, resuspend in PBS and repeat centrifugation twice, discard the supernatant for later use; centrifuge the recipient bacteria at 5000 rpm at 4°C for 5 minutes, resuspend in PBS and repeat centrifugation once, add 200uL PBS to resuspend, mix with the donor bacteria, and place on the recipient bacteria solid plate, place in a 37°C constant temperature incubator for aerobic conjugation for 8-12 hours ( Figure 3 ).

[0079] (4) Obtaining AKK luminescent strain by double exchange of recombinant plasmids

[0080] After scraping the conjugates, resuspend them in 2 mL of PBS and evenly spread them onto a recipient agar plate containing chloramphenicol resistance (6 ng / uL) and incubate anaerobically for 96 hours. Once a single colony grows, place it on a live imaging device for observation. If a fluorescent strain grows, pick a single colony, expand it, and evenly spread it onto a recipient agar plate containing 8% sucrose. Anaerobic incubation is continued. Once a single colony grows, place it on a live imaging device for observation. The luminescent strain observed is the recombinant strain Akkermansia muciniphila SDLYAKK8-Lux (containing the Lux CDABE luminescence system and has completed the double exchange). Figure 4 ), the applicant deposited the strain with the China Center for Type Culture Collection, the deposit date is 2025.07.02, the deposit number is CCTCC NO: M20251508, and the deposit address is Wuhan University, Wuhan, China.

[0081] Example 4

[0082] Growth characteristics and luminescence brightness of Akkermansia muciniphila SDLYAKK8-Lux and its relationship with strain concentration

[0083] (1) Comparison of growth ability between Akkermansia muciniphila SDLYAKK8-Lux strain and wild-type strain SDLYAKK8

[0084] First, we determined whether there was a difference in growth ability between the Akkermansia muciniphila SDLYAKK8-Lux strain and the wild-type strain SDLYAKK8. We took the activated Akkermansia muciniphila SDLYAKK8-Lux strain and the wild-type strain SDLYAKK8 and inoculated them into liquid culture medium at a ratio of 1:30, with three replicates for each strain. Every 4 hours, we sterilely took the bacterial solution and measured its OD value. 600 , a total of 36 h was measured, and then the growth curve of the strain in liquid culture medium was drawn. The experimental results are shown in Figure 5 shown.

[0085] Result analysis: The results showed that there was no difference in in vitro growth ability between the constructed Akkermansia muciniphila SDLYAKK8-Lux strain and the wild-type strain SDLYAKK8.

[0086] (2) Relationship between the luminescence brightness of Akkermansia muciniphila SDLYAKK8-Lux strain and the number of strains

[0087] The Akkermansia muciniphila SDLYAKK8-Lux strain cultured to the logarithmic phase was diluted in multiples and then photographed using a small animal in vivo imaging system (IVIS Lumina Series III). The luminescence intensity at 2-, 4-, 8-, 16-, and 32-fold dilutions was measured. The bacterial solution at each dilution was then titrated and counted. Finally, the relationship between the number of bacteria and the luminescence intensity was calculated and a correlation analysis was performed. The experimental results are shown in Figure 2. Figure 6 shown.

[0088] Result analysis: The results show that the formula of bacterial number and luminescence intensity is:

[0089] Bacterial CFU = 145845 × ROI + 9 × 10 8 , correlation coefficient R 2 =0.9711, the two are strongly correlated.

[0090] Example 5

[0091] Study on the colonization status and colonization sites of Akkermansia muciniphila SDLYAKK8-Lux strain in mice

[0092] The ability of Akkermansia muciniphila to customize in mice was determined by gavage with Akkermansia muciniphila SDLYAKK8-Lux strain. 8-week-old SPF BALB / c mice were taken and adapted to feeding for 1 week. They were then gavaged with a quadruple antibiotic (vancomycin + metronidazole + neomycin sulfate + ampicillin) for 1 week. The drinking water was then given a quadruple antibiotic for 3 days. The water was replaced with clean water 2 days before gavage. The mice were fasted for 4 hours before gavage. Then, 200uL of Akkermansia muciniphila SDLYAKK8-Lux cultured to the logarithmic phase was gavaged (concentration of 10 9 CFU / mL) were gavaged and then photographed using a small animal in vivo imaging system (IVIS Lumina Series III). The mice were then kept normally and photographed every 24 hours to observe the colonization of Akkermansia muciniphila SDLYAKK8-Lux in the body. The observation was continued for 11 days. The experimental results are as follows Figure 7 and Figure 8 shown.

[0093] Result analysis: The results showed that the colonization of Akkermansia muciniphila in mice can be observed in real time using the in vivo imaging system ( Figure 7 ). After autopsy of mice, it was found that Akkermansia muciniphila SDLYAKK8-Lux mainly colonized the mouse colon ( Figure 8 ).

[0094] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0095] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A promoter P1 for expressing exogenous genes in Akkermansia muciniphila, characterized in that: The nucleotide sequence of the promoter P1 is shown in SEQ ID NO.2; Or it can be represented by a nucleotide sequence that still maintains promoter activity after one or more bases are replaced, deleted and / or added to the sequence shown in SEQ ID NO.

2.

2. A recombinant vector, characterized in that The recombinant vector comprises the promoter P1 sequence according to claim 1; and further comprises upstream and downstream homology arm sequences homologous to the recipient bacteria or recipient cells, a Lux CDABE expression cassette sequence, and a resistance screening sequence.

3. The recombinant vector according to claim 2, characterized in that The recombinant vector is pCONJ4s-Lux, and its nucleotide sequence is shown in SEQ ID NO.

13.

4. A recombinant bacterium, characterized in that The recombinant bacteria comprises the promoter according to claim 1 or the recombinant vector according to any one of claims 2-3.

5. The recombinant bacterium according to claim 4, characterized in that The recombinant bacterium is Akkermansiamuciniphila SDLYAKK8-Lux, which is deposited in China Center for Type Culture Collection with a deposit date of 2025.07.02 and a deposit number of CCTCC NO: M 20251508.

6. The method for constructing the recombinant bacterium according to any one of claims 4 to 5, characterized in that: The steps include: (1) Screening a strong promoter of Akkermansia muciniphila, the sequence of which is shown in SEQ ID NO. 2; (2) Design primers for upstream and downstream homology arms, P1 promoter, Lux CDABE expression cassette, and resistance screening expression cassette, and amplify the corresponding fragments for future use; (3) Using pCONJ4s as the backbone plasmid, single enzyme digestion was performed with the amplified fragment in step (2) to perform homologous recombination to obtain a homologous recombination vector; (4) Use the double exchange method to obtain recombinant bacteria.

7. A living body imaging system, characterized in that: The invention comprises the recombinant bacteria according to any one of claims 4 to 5.

8. Use of the promoter P1 according to claim 1, characterized in that: The application is any of the following: (1) Application in genetic engineering of Akkermansia muciniphila; (2) Application in constructing a recombinant plasmid for introducing the Lux CDABEDE bacterial bioluminescent reporter system into Akkermansia muciniphila; (3) Application in the construction of recombinant bacteria containing the Lux CDABEDE bacterial bioluminescent reporter system; (4) Application in constructing an in vivo imaging system containing the Lux CDABEDE bacterial bioluminescence reporter system; (5) Application of in vivo imaging technology to reflect the proliferation and colonization of Akkermansia muciniphila in real time.

9. Use of the recombinant vector according to any one of claims 2-3 or the recombinant bacteria according to any one of claims 4-5, characterized in that: The application is any of the following: (1) Application in constructing an in vivo imaging system containing the Lux CDABEDE bacterial bioluminescence reporter system; (2) Application of in vivo imaging technology to reflect the proliferation and colonization of Akkermansia muciniphila in real time.

10. Use of the in vivo imaging system according to claim 7 in real-time reflection of the proliferation and colonization of Akkermansia muciniphila in vivo based on in vivo imaging technology.

Citation Information

Patent Citations

  • Fluorescent strain E. coli C600 and construction method and application thereof

    CN110066820A

  • Construction and application of serratia marcescens with fluorescence tracing function

    CN112852700A

  • Streptococcus suis luminous bacterium based on lux report system and construction method thereof

    CN113403243A

  • Akkermansia muciniphila and application thereof to preparation of antitumor drug

    CN113862193A

  • Preparation and application of recombinant protein with effect of inhibiting human colorectal cancer cell proliferation

    CN118063568A