Preparation method of AAV gene therapy system with high SIRT6 expression and application of AAV gene therapy system in corneal endothelium decompensation therapy
By constructing an AAV gene therapy system with high expression of SIRT6, the treatment problem of corneal endothelial decompensation has been solved, and the efficient delivery and expression of SIRT6 protein in corneal endothelial cells has been achieved, reducing oxidative damage, delaying corneal edema, and providing a new treatment method for corneal endothelial decompensation.
Patent Information
- Application Number
- CN202510572393.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-06
- Publication Date
- 2025-09-23
AI Technical Summary
The existing technology lacks effective treatments to treat corneal endothelial decompensation, especially the loss of corneal endothelial cells due to oxidative stress, which leads to decreased vision and eye discomfort. In addition, corneal transplantation is subject to a shortage of donor tissue and risks.
Develop an AAV gene therapy system that highly expresses SIRT6. By constructing a vector plasmid, packaging the virus, and efficiently expressing SIRT6 protein in corneal endothelial cells, the SIRT6 gene is delivered using adeno-associated virus to reduce oxidative stress damage.
Effectively deliver and express SIRT6 protein, reduce oxidative damage to corneal endothelial cells, inhibit corneal edema, delay and treat corneal endothelial decompensation, and have low toxicity and immunogenicity.
Smart Images

Figure CN120683180A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of ophthalmic biomedicine, and in particular relates to a method for preparing an AAV gene therapy system that highly expresses SIRT6 and its application in the treatment of corneal endothelial decompensation. Background Art
[0002] The human corneal endothelium is composed of a single layer of uniform hexagonal cells. Corneal endothelial cells (CEC) have two main functions: barrier function and sodium-potassium pump function, which helps maintain corneal thickness and transparency. However, human corneal endothelial cells cannot spontaneously divide and regenerate under physiological conditions in vivo. When acquired or genetic factors cause excessive loss of CEC cells, the CEC density drops to 500 cells / mm 2 When the corneal endothelial cells are damaged by cataract, corneal edema and vision loss can occur, leading to eye discomfort, pain, and even blindness. Vision loss caused by corneal endothelial decompensation affects millions of people worldwide, resulting in a significant socioeconomic burden. Currently, there are limited clinical treatments for corneal endothelial decompensation, with corneal transplantation being the only proven effective treatment. However, due to the extreme shortage of corneal donor tissue and the risk of transplant failure, new approaches to treat corneal endothelial decompensation are necessary. Oxidative stress plays a crucial role in the development and progression of corneal endothelial decompensation. Oxidative stress is the primary cause of corneal endothelial damage during phacoemulsification, and oxidative stress-induced corneal endothelial cell apoptosis is also a key component of the pathogenesis of Fuchs' corneal endothelial dystrophy (FECD). Silent information regulator 6 (SIRT6) is a deacetylated protein, and recent studies have shown that SIRT6 is a promising therapeutic target for oxidative stress.
[0003] Adeno-associated virus (AAV) has become one of the most actively studied gene therapy vectors due to its tissue tropism, transduction specificity, lack of host genome integration, and sustained gene expression. Recent studies have shown that the cornea is also an ideal target for AAV-mediated gene therapy, potentially offering hope for the treatment of corneal endothelial decompensation. Summary of the Invention
[0004] One object of the present invention is to overcome the deficiencies of the above-mentioned background technology and provide a method for preparing an AAV therapeutic system that highly expresses the SIRT6 gene. The developed AAV can deliver the SIRT6 gene in vivo and in vitro and efficiently express the SIRT6 protein.
[0005] The second object of the present invention is to use the AAV therapeutic system with high SIRT6 expression to treat corneal endothelial decompensation.
[0006] The purpose of the present invention is achieved through the following technical solutions:
[0007] A method for preparing a high-expression SITR6 AAV gene therapy system is carried out according to the following steps:
[0008] 1. Construction of vector plasmid
[0009] 1. The vector plasmid comprises:
[0010] AAV ITR sequences:
[0011] Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaga
[0012] gggagtggccaactccatcactaggggttcct
[0013] CMV promoter sequence:
[0014] gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaat
[0015] caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct
[0016] P2A sequence: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggcca
[0017] WPRE sequence:
[0018] aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttccc
[0019] gtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaac
[0020] ccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgct
[0021] ggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggac
[0022] gtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtc
[0023] ggatctccctttgggccgcctccccgc
[0024] hGH polyA:
[0025] gggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgact
[0026] aggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctg
[0027] gagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccagg
[0028] ctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctggga
[0029] ttacaggcgtgaaccactgctcccttccctgtcctt
[0030] 2. Obtain the ORF fragment of the target gene, that is, obtain the following open reading frame sequence fragment of the human SIRT6 gene:
[0031] Cccgccagccccaagcgggagcggcccaccagccctgccccccacagaccccccaaaagggtgaaggccaaggcggtccccagctg
[0032] aatgtcggtgaattacgcggcggggctgtcgccgtacgcggacaagggcaagtgcggcctcccggagatcttcgacccccggaggagctgg
[0033] agcggaaggtgtgggaactggcgaggctggtctggcagtcttccagtgtggtgttccacacgggtgccggcatcagcactgcctctggcatcc
[0034] ccgacttcaggggtccccacggagtctggaccatggaggagcgaggtctggcccccaagttcgacaccacctttgagagcgcgcggcccac
[0035] gcagacccacatggcgctggtgcagctggagcgcgtgggcctcctccgcttcctggtcagccagaacgtggacgggctccatgtgcgctcag
[0036] gcttccccagggacaaactggcagagctccacgggaacatgtttgtggaagaatgtgccaagtgtaagacgcagtacgtccgagacacagtc
[0037] gtgggcaccatgggcctgaaggccacgggccggctctgcaccgtggctaaggcaagggggctgcgagcctgcaggggagagctgaggga
[0038] caccatcctagactgggaggactccctgcccgaccgggacctggcactcgccgatgaggccagcaggaacgccgacctgtccatcacgctg
[0039] ggtacatcgctgcagatccggcccagcgggaacctgccgctggctaccaagcgccggggaggccgcctggtcatcgtcaacctgcagccca
[0040] ccaagcacgaccgccatgctgacctccgcatccatggctacgttgacgaggtcatgacccggctcatgaagcacctggggctggagatcccc
[0041] gcctgggacggcccccgtgtgctggagagggcgctgcccacccctgccccgcccgcccacccccaagctggagcccaaggaggaatctcc
[0042] cacccggatcaacggctctatccccgccggccccaagcaggagccctgcgcccagcacaacggctcagag
[0043] The obtaining steps are as follows:
[0044] 1) Extract the total RNA of human corneal endothelial cell line and reverse transcribe to synthesize cDNA:
[0045] (1) Discard the culture medium of cultured human corneal endothelial cells (6-well plate or culture flask) and gently rinse twice with pre-chilled PBS. Add 1 mL of TRIzol reagent (for a single well of a 6-well plate) and lyse at room temperature for 5 minutes to ensure complete cell lysis; add 200 μL of chloroform, vortex vigorously for 15 seconds, and let stand at room temperature for 3 minutes; centrifuge at 4°C, 12,000 × g, for 15 minutes; separate into three layers after centrifugation, and transfer the upper colorless aqueous phase to a new centrifuge tube; add an equal volume of isopropanol (about 500 μL), gently invert to mix, and let stand at room temperature for 10 minutes; centrifuge at 4°C, 12,000 × g, for 10 minutes, and discard the supernatant. A white RNA precipitate should be visible at the bottom of the tube; add 1 mL of 75% ethanol (prepared with DEPC water) and vortex to wash the precipitate; centrifuge at 7,500 × g for 5 minutes at 4°C, discard the supernatant, and dry at room temperature for 5 minutes (avoid over-drying); add 20 μL of DEPC water to dissolve the RNA; determine the RNA concentration (NanoDrop: A260 / A280 should be 1.8-2.0) and store in aliquots at -80°C.
[0046] (2) Reverse transcription reaction
[0047] (2.1) Configure the reverse transcription reaction system:
[0048] RNA template: 1 μg total RNA
[0049] 5×RT Master Mix: 4 μL
[0050] Add DEPC water to 20 μL system
[0051] (2.2) Incubate at 37°C for 15 minutes (reverse transcription reaction); heat at 85°C for 5 minutes to inactivate the reverse transcriptase; immediately place on ice and briefly centrifuge to collect droplets for subsequent PCR.
[0052] 2) PCR amplification of cDNA
[0053] (1) PCR amplification primers:
[0054] 12795-SalI-F sequence: TTGCCTTTCTCTCCACAGtctagagtcgacgccaccatgtcggtgaattatgcagcagggttg
[0055] 12795-NheI-R:gctgaagttagtagctccgcttccGCTAGCgctgggggcagcctcg
[0056] (2) Configure the PCR reaction system:
[0057] cDNA: 1-5ul
[0058] 12795-SalI-F: 2 μL
[0059] 12795-NheI-R: 2 μL
[0060] Add DEPC water to 50 μL system;
[0061] (3) PCR amplification:
[0062] 95°C for 3 min before cycling;
[0063] 40 cycles of amplification at 95°C for 10 s, 58°C for 5 s, and 72°C for 10 s were performed in a PCR instrument;
[0064] After the cycle, 72°C for 5 min;
[0065] The PCR products were run on gel, and the target band was returned to the gel for plasmid construction.
[0066] 3) Obtain the ORF fragment of the target gene (i.e., linearized expression vector):
[0067] (1) Configure the enzyme digestion system:
[0068] 2 μl of SalI restriction enzyme
[0069] 2ul of NheI restriction enzyme
[0070] pAAV-CMV-Luciferase-P2A-EGFP-WPRE plasmid 4ug
[0071] Add dd water to 20ul system;
[0072] Incubate at 37°C for 2 h, run the gel, cut the target band (approximately 6000 bp position), and re-gel;
[0073] (2) Using the Gibson assembly method, configure the following system:
[0074] PCR product: [PCR product length × 0.04] ng
[0075] Enzyme digestion product: [enzyme digestion product length × 0.02] ng
[0076] 2×Gibson assembly enzyme: 10ul
[0077] Add dd water to 20ul system
[0078] Incubate at 50°C for 45 minutes.
[0079] (3) Cultivate the ORF fragment of the target gene
[0080] The cultivation steps are:
[0081] (3.1) Thaw competent cells Dh5α on ice in advance. Take 10 μl of the liquid from the previous step and add 100 μl DH5α. Place on ice for 30 min, heat shock at 42°C for 1 min, and then keep on ice for 5 min.
[0082] (3.2) Spread all of the above liquid onto solid LB medium containing amp and incubate at 37°C overnight;
[0083] (3.3) The next day, the bacteria were picked and cultured in liquid LB medium. The bacterial culture was sent for testing. After sequencing, the plasmid was extracted. The linearized expression vector containing the ORF fragment of the target gene was obtained and used as a transfer plasmid for subsequent virus packaging.
[0084] 2. rAAV packaging
[0085] 1. Prepare plasmid:
[0086] The above transfer plasmid, pHelper plasmid (carrying adenovirus-derived genes) and pAnc80L65 (carrying AAV replication and capsid genes) plasmid were extracted in large quantities; pHelper plasmid and pAnc80L65 plasmid were purchased.
[0087] 2. The HEK-293 cell transfection steps are:
[0088] 1) Seed HEK-293 cells in a 10 cm dish and use for transfection 48 hours later, when the confluence reaches 70-80%;
[0089] 2) 1 hour before transfection, remove the cell culture plate, remove the original cell culture medium, and add 10 ml of Opti-MEM medium;
[0090] 3) Prepare the complex of transfection reagent and plasmid
[0091] i. Dissolve 32 μg of each of the three plasmids to be transfected (pHelper plasmid: pAnc80L65 plasmid: transfer plasmid = 1:1:1) in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 minutes to obtain a plasmid dilution;
[0092] ii. Dissolve the purchased transfection reagent in Opti-MEM medium to a total volume of 500 μl, mix gently, and let it stand for 5 minutes;
[0093] iii. Add the transfection reagent dilution dropwise to the plasmid dilution, gently mix while adding, and let it stand at room temperature for 20 minutes to allow the DNA and transfection reagent to fully combine to form a stable DNA transfection complex;
[0094] 4) Remove the cell dish and add the prepared DNA-transfection reagent complex to the cell culture plate; after 6 hours, aspirate the culture medium, wash once with PBS, and add 10 ml of fresh complete culture medium for incubation.
[0095] 3. Virus harvest and purification
[0096] 1) 60 hours after transfection, scrape the cells with a cell scraper and collect them into a centrifuge tube;
[0097] 2) Centrifuge at 1500 rpm and 4°C for 5 min; resuspend the cell pellet in 9 ml of lysis buffer and collect the culture medium in a 500 ml bottle;
[0098] 3) Take the cell lysate and freeze it in liquid nitrogen for 3 minutes, then freeze and thaw it 3-4 times in a 37°C water bath.
[0099] 4) Add 250 U of benzonase, mix well, and incubate at 37°C for 1 hour;
[0100] 5) Add NaCl to a final concentration of 150 mM, mix well, and incubate at 37°C for 30 min;
[0101] 6) Centrifuge at 2500 rpm at room temperature for 10 min, remove the supernatant and discard the precipitate;
[0102] 7) Pour the supernatant from step 2) into the supernatant collected in step 6), add PEG8000 and NaCl to final concentrations of 8% and 0.5 M, respectively, and incubate at 4°C overnight;
[0103] 8) Centrifuge at 12000 rpm at 4°C for 1.5 h, discard the supernatant, and resuspend the pellet in 10 ml of PBS;
[0104] 9) The resuspended virus stock solution was added to four ultracentrifuge tubes containing iodixanol (the concentrations of iodixanol in the four ultracentrifuge tubes were 15%, 25%, 40%, and 60%, respectively) and centrifuged at 63,000 rpm and 18°C for 2 h.
[0105] 10) Draw out the 40% layer of sample using a 10 ml syringe and place it into a dialysis bag. Dialyze at 4°C, changing the dialysate every 12-16 hours, using 2 L of buffer each time.
[0106] 11) Collect the dialyzed samples, concentrate them using ultrafiltration tubes, and store them at -80°C;
[0107] Packaging is complete.
[0108] 3. Titer determination
[0109] The titer of AAV is determined by measuring the number of AAV viral particles by detecting the genomic copy number of the AAV vector in the genome through quantitative PCR;
[0110] 1. Prepare the standard: Use the plasmid standard, calculate the concentration of the standard, dilute to 1E+8 cells / ul, and dilute in a gradient to 1E+3 cells / ul, for a total of 6 gradients;
[0111] 2. Prepare the sample: Alkaline lysis - Take 5ul of concentrated virus sample, add NaOH to a final concentration of 1M, bathe in a 55℃ water bath for 30min, then add HCl to neutralize, and dilute 10-fold with pure water or 1XPBS;
[0112] 3. Add 18 μl of reaction solution to each reaction well, followed by 2 μl of template;
[0113] 4. Set the annealing temperature to 60°C on the instrument and obtain the Ct value according to standard procedures to calculate the copy number in the AAV sample.
[0114] 5. The synthesized rAAV was stored at -80°C for long-term storage.
[0115] The SIRT6 AAV gene therapy system can reduce oxidative damage to corneal endothelial cells induced by oxidative stress, alleviate morphological and functional damage to corneal endothelial cells, inhibit corneal edema, and can be used as a drug for delaying and treating corneal endothelial decompensation.
[0116] The beneficial effects of the present invention are: the provided gene therapy system can promote the delivery and expression of the SIRT6 gene in corneal endothelial cells, and has extremely low toxicity and immunogenicity, thereby being effectively used in the treatment of corneal endothelial decompensation. BRIEF DESCRIPTION OF THE DRAWINGS
[0117] Figure 1 Images of changes in mouse corneal endothelial transduction capacity after UVA-induced intracameral injection of rAAV (Anc80L65).
[0118] Figure 2 Images show the delivery and expression effects of rAAV-SIRT6 after UVA-induced intracameral injection.
[0119] Figure 3 Images of changes in corneal edema in the mouse cornea after UVA-induced intracameral injection of rAAV-SIRT6.
[0120] Figure 4 Images of changes in the degree of oxidative stress in the mouse corneal endothelium after UVA-induced intracameral injection of rAAV-SIRT6.
[0121] Figure 5Images of changes in the morphology and functional damage of mouse corneal endothelial cells after UVA-induced intracameral injection of rAAV-SIRT6S.
[0122] Figure 6 Images of systemic and ocular safety testing in mice following UVA-induced intracameral injection of rAAV-SIRT6. DETAILED DESCRIPTION
[0123] The following is further described with reference to the embodiments shown in the accompanying drawings.
[0124] First, the present invention tested the transduction efficacy, expression efficacy, and related therapeutic efficacy of the AAV gene therapy system containing SIRT6. Specifically, during the preparation process, the mouse SIRT6 gene open reading frame was used to replace the human SIRT6 gene open reading frame for related efficacy testing, and the EGFP gene (enhanced green fluorescent protein) open reading frame was used to enhance the visual effect.
[0125] in:
[0126] The open reading frame of the mouse SIRT6 gene is:
[0127] Atgtcggtgaattatgcagcagggttgtcgccttacgcggataagggcaagtgcgggctgcccgagatcttcgacccaccagaggagctggaacgcaaggtgt
[0128] gggagctggcccggctaatgtggcagtcctccagcgtggttttccacacgggcgccggcatcagcaccgcctctggcatccccgacttcagaggcccccatggcgt
[0129] gtggaccatggaggaacgcggcctggcccccaagtttgacaccaccttcgagaatgctcggccctcgaagacccacatggccctggttcagctagaacgcatggg
[0130] cttcctcagcttcctggtcagccagaacgtagacgggctgcacgtgcgctcgggcttccccagggacaagctggcagagctgcacggaaacatgtttgtagaggaat
[0131] gtcccaagtgtaagacgcagtacgtcagagacacggttgtgggcaccatgggcctcaaggccacaggccggctctgcaccgtggccaagaccaggggacttcgg
[0132] gcctgtagaggggagctgagagacaccattctggactgggaggactcgttgcctgaccgggacctgatgctcgctgatgaggccagcaggaccgcagacctgtct
[0133] gtcaccctgggtacctcgctgcagatccgccccagtgggaacctgccccttgccactaagcgccgaggaggccgtctggtcattgtcaacctgcaacccacaaaac
[0134] atgaccgccaggctgacctgcgcatccacggctacgtggatgaggtgatgtgcagactcatgaagcatctggggctggagattccagcctgggatggaccctgcgt
[0135] gctagacaaagccctgccacctctgcctcgcccagtagcactcaaggctgagccccccgtgcatctcaatggtgcagtgcatgtttcgtataagtccaagcccaacag
[0136] ccctatactccacaggccccccaaaagagtgaagaccgaggctgcccccagc
[0137] The open reading frame of the EGFP gene is:
[0138] Atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgaggg
[0139] cgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgt
[0140] gcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgac
[0141] ggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctgg
[0142] ggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgagg
[0143] acggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctg
[0144] agcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa
[0145] 2. Test Instructions (Details) Color Representation
[0146] See also Figure 1 ; The present invention tested the endothelial transduction ability after intracameral injection of rAAV (Anc80L65); Figure 1 Figure A shows the rAAV injection scheme: 1 ul (titer of 5E+12 vg / ml or above) rAAV-SIRT6 was injected into the anterior chamber of the right eye of the mouse. Four weeks later, the right eye was treated with UVA light, and the images of UVA-induced corneal endothelial damage after rAAV-SIRT6 injection were detected on the 1st, 4th and 7th days after UVA treatment. Figure 1 Panel B shows EGFP immunofluorescence staining of frozen sections of mouse eyeballs four weeks after intracameral injection of EGFP-rAAV (Anc80L65). The three images show DAPI nuclear staining, EGFP protein staining, and the overlap of nuclear and EGFP protein staining, respectively. This row of images demonstrates EGFP staining of the cornea: the green arrow indicates the location of the corneal endothelium, which exhibits strong green fluorescence. These results demonstrate that this delivery method demonstrates reliable endothelial transduction four weeks after intracameral injection.
[0147] See also Figure 2 The present invention tested the delivery and expression of rAAV-SIRT6 after intracameral injection; Figure 2 Panel A shows the results of SIRT6 immunofluorescence staining of frozen sections of mouse eyeballs taken 4 weeks after intracameral injection of rAAV-SIRT6. The three rows of images show SIRT6 immunofluorescence staining in the UVA-only treatment group (long-wave ultraviolet treatment group), the empty AAV + UVA treatment group, and the rAAV-SIRT6 + UVA treatment group. By comparison, the rAAV-SIRT6 + UVA treatment group had higher SIRT6 protein expression, indicating that the intracameral injection of rAAV-SIRT6 upregulated SIRT6 protein expression in the corneal endothelium, thereby inhibiting the downregulation of SIRT6 in the mouse corneal endothelium in the UVA-induced corneal endothelial decompensation model.
[0148] Figure 2 Figure B shows the results of western blot (WB) detection of proteins extracted from the corneas of three groups of mice: the UVA-only treatment group, the empty AAV+UVA injection treatment group, and the rAAV-SIRT6+UVA injection treatment group. The upper image shows the bands of SIRT6, HO-1, and Actin proteins, and the lower image shows the quantitative results of the grayscale analysis of SIRT6 and HO-1 (antioxidant defense pathway protein) protein bands; the results show that compared with the UVA group and the UVA+Empty AAV group, the SIRT6 and HO-1 proteins in the corneal tissue of the UVA+AAV-SIRT6 group were upregulated; this indicates that intracameral injection of rAAV-SIRT6 can inhibit UVA-induced SIRT6 downregulation and upregulate the antioxidant defense pathway.
[0149] See also Figure 3 The present invention observed the degree of corneal edema after intracameral injection of rAAV-SIRT6 in a UVA-induced mouse corneal endothelial decompensation model.
[0150] Figure 3Panel A shows images of the UVA group, the UVA+AAV empty group (i.e., UVA+EmptyAAV), and the UVA+AAV-SIRT6 group (in each group, the left image is a slit lamp image of the mouse cornea, and the right image is an OCT image). The three rows of images represent the observation results on days 1, 4, and 7 after UVA irradiation, respectively. The results showed that compared with the UVA group and the UVA+Empty AAV group, the corneal edema of the mice in the UVA+AAV-SIRT6 group was significantly improved on days 4 and 7 after UVA irradiation, and OCT results showed that the corneal thickness returned to normal.
[0151] Figure 3 Panel B shows HE staining of corneal tissue obtained 7 days after UVA irradiation. The results show that compared with the UVA and UVA+Empty AAV groups, the UVA+AAV-SIRT6 group showed reduced corneal edema and thickness.
[0152] Figure 3 Figure C shows the corneal thickness results of mice measured after OCT photography in the Control group, UVA group, UVA+AAV empty group, and UVA+AAV-SIRT6 group; the horizontal axis represents the corneal thickness test results on the 1st, 4th, and 7th days, indicating that SIRT6 overexpression can alleviate UVA-induced corneal edema in mice.
[0153] See also Figure 4 ; The present invention observed the degree of oxidative stress in the mouse endothelium after intracameral injection of rAAV-SIRT6 in the UVA-induced mouse corneal endothelial decompensation model. The figure shows the results of DHE staining of frozen sections of the eyeballs in the UVA group, UVA+AAV empty group and UVA+AAV-SIRT6 group on the 7th day. DHE is an indicator of the degree of oxidative stress. The results showed that compared with the UVA group and UVA+AAV empty group, the UVA+AAV-SIRT6 group had lower DHE staining, suggesting that overexpression of SIRT6 has the effect of inhibiting oxidative stress in corneal endothelial cells.
[0154] See also Figure 5 ; The present invention observed that intracameral injection of rAAV-SIRT6S could reduce the degree of corneal endothelial cell morphology and functional damage in the UVA-induced mouse endothelial decompensation model.
[0155] Figure 5Panel A shows ZO-1 immunofluorescence staining of corneal endothelial flat mounts from the UVA, UVA+AAV empty, and UVA+AAV-SIRT6 groups on day 7. ZO-1 is a structural protein in the corneal endothelium, indicating changes in corneal endothelial morphology. The results showed that compared with the UVA and UVA+AAV empty groups, the UVA+AAV-SIRT6 group had a higher density of corneal endothelial cells and a more uniform morphology, suggesting that SIRT6 overexpression can alleviate UVA-induced damage to corneal endothelial cell morphology in mice.
[0156] Figure 5 Figure B shows ATP1A1 immunofluorescence staining of frozen sections of eyeballs in each group on the 7th day. ATP1A1 is a protein that indicates the function of corneal endothelial cells. The immunofluorescence staining results showed that compared with the UVA group and the UVA+AAV empty group, the UVA+AAV-SIRT6 group had higher ATP1A1 protein expression, indicating that SIRT6 overexpression can alleviate UVA-induced corneal endothelial dysfunction in mice.
[0157] See also Figure 6 ; The systemic and ocular safety of intracameral injection of rAAV-SIRT6 of the present invention was tested. Figure 6 Figure 3: HE staining results of heart, liver, spleen, lung, kidney, and retina of mice in the UVA, UVA+AAV empty, and UVA+AAV-SIRT6 groups on the 7th day, indicating that intracameral injection of rAAV did not cause significant damage to important organs and retinal cells.
[0158] The above test results indicate:
[0159] The cornea is also an ideal target for AAV-mediated gene therapy. Anc80L65 is an AAV subtype designed and synthesized based on ancestral sequence reconstruction. Studies have found that it can effectively transduce corneal endothelial cells 28 days after a single injection into the anterior chamber of the mouse eye; it has been demonstrated that AAV-mediated SIRT6 overexpression can improve corneal transparency, corneal thickness, corneal endothelial oxidative stress levels, and corneal endothelial cell morphology and density in the UVA-induced corneal endothelial decompensation model in vivo, and can be used as a gene therapy targeting corneal endothelial cells, which shows the great potential of AAV-mediated gene therapy in delaying the process of corneal endothelial decompensation.
[0160]
[0161]
[0162]
[0163]
Claims
1. A method for preparing an AAV gene therapy system that highly expresses SITR6, comprising the following steps: 1) Construction of vector plasmid (1) The vector plasmid comprises: AAV ITR sequences: Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagaggggagtggccaactccatcactaggggttcct CMV promoter sequence: gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaat caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct P2A sequence: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggcca WPRE sequence: aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctatgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgc hGH polyA: gggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtc cttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatctt ggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagaga cggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtcctt (2) Obtain the ORF fragment of the target gene, that is, obtain the following open reading frame sequence fragment of the human SIRT6 gene: Cccgccagccccaagcgggagcggcccaccagccctgccccccacagaccccccaaaagggtgaaggccaaggcggtccccagctgaatgtcggtgaattacgcggcggggctgtcgccgtacgcggacaagggcaagtgcggcctcccggagatcttcgacccccggaggagctggagcggaaggtgtgggaactggcgaggctggtctggcagtcttccagtgtggtgttccacacgggtgccggcatcagcactgcctctggcatccccgacttcaggggtccccacggagtctggaccatggaggagcgaggtctggcccccaagttcgacaccacctttgagagcgcgcggcccacgcagacccacatggcgctggtgcagctggagcgcgtgggcctcctccgcttcctggtcagccagaacgtggacgggctccatgtgcgctcaggcttccccagggacaaactggcagagctccacgggaacatgtttgtggaagaatgtgccaagtgtaagacgcagtacgtccgagacacagtcgtgggcaccatgggcctgaaggccacgggccggctctgcaccgtggctaaggcaagggggctgcgagcctgcaggggagagctgagggacaccatcctagactgggaggactccctgcccgaccgggacctggcactcgccgatgaggccagcaggaacgccgacctgtccatcacgctgggtacatcgctgcagatccggcccagcgggaacctgccgctggctaccaagcgccggggaggccgcctggtcatcgtcaacctgcagcccaccaagcacgaccgccatgctgacctccgcatccatggctacgttgacgaggtcatgacccggctcatgaagcacctggggctggagatccccgcctgggacggcccccgtgtgctggagagggcgctgcccacccctgccccgcccgcccacccccaagctggagcccaaggaggaatctcccacccggatcaacggctctatccccgccggccccaagcaggagccctgcgcccagcacaacggctcagag The acquisition steps are: (2.1) Extraction of total RNA from human corneal endothelial cells and reverse transcription to synthesize cDNA: (2.2) PCR amplification of cDNA (2.3) Cultivate the ORF fragment of the target gene: 2) rAAV packaging. The packaging steps are: (1) Preparing plasmids; (2) HEK-293 cell transfection; (3) Virus harvesting and purification.
2. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 1, characterized in that: The method for extracting total RNA from human corneal endothelial cell line and synthesizing cDNA by reverse transcription in step (2.1) is: (2.11) Remove the culture medium from cultured human corneal endothelial cells (6-well plates or culture flasks) and gently rinse twice with pre-chilled PBS. Add 1 mL of TRIzol reagent per well of the 6-well plate and lyse at room temperature for 5 minutes to ensure complete cell lysis. Add 200 μL of chloroform, vortex vigorously for 15 seconds, and let stand at room temperature for 3 minutes. Centrifuge at 12,000 × g for 15 minutes at 4°C. After centrifugation, separate the three layers and transfer the upper colorless aqueous phase to a new centrifuge tube. Add 500 μL of isopropanol, gently invert to mix, and let stand at room temperature for 10 minutes. Centrifuge at 12,000 × g for 10 minutes at 4°C and discard the supernatant. A white RNA precipitate will be visible at the bottom of the tube. Add 1 mL of 75% ethanol and vortex to wash the precipitate. Centrifuge at 7,500 × g for 5 minutes at 4°C and discard the supernatant. Dry at room temperature for 5 minutes. Add 20 μL of DEPC water to dissolve the RNA. Determine the RNA concentration and store in aliquots at -80°C. (2.12) Reverse transcription reaction (2.121) Configure the reverse transcription reaction system: RNA template: 1 μg total RNA 5×RT Master Mix: 4 μL Add DEPC water to 20 μL system (2.122) Incubate the reverse transcription reaction at 37°C for 15 minutes; inactivate the reverse transcriptase by heating at 85°C for 5 minutes; immediately place on ice and centrifuge briefly to collect the droplets for subsequent PCR.
3. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 2, characterized in that: The steps of PCR amplification of cDNA in step (2.2) are: (2.21) PCR amplification primers: 12795-SalI-F sequence: TTGCCTTTCTCTCCACAGtctagagtcgacgccaccatgtcggtgaattatgcagcagggttg 12795-NheI-R:gctgaagttagtagctccgcttccGCTAGCgctgggggcagcctcg (2.22) Configure the PCR reaction system: cDNA: 1-5ul 12795-SalI-F: 2 μL 12795-NheI-R: 2 μL Add DEPC water to 50 μL system; (2.23) PCR amplification: 95°C for 3 min before cycling; 40 cycles of amplification at 95°C for 10 s, 58°C for 5 s, and 72°C for 10 s were performed in a PCR instrument; After the cycle, 72°C for 5 min; The PCR products were run on gel, and the target band was returned to the gel for plasmid construction.
4. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 3, characterized in that: The step (2.3) of obtaining the ORF fragment of the target gene is: (2.31) Configure the enzyme digestion system: 2 μl of SalI restriction enzyme 2ul of NheI restriction enzyme pAAV-CMV-Luciferase-P2A-EGFP-WPRE plasmid 4ug Add dd water to 20ul system; Incubate at 37°C for 2 h, run the gel, cut the target band (approximately 6000 bp position), and re-gel; (2.32) Using the Gibson assembly method, configure the following system: PCR product: [PCR product length × 0.04] ng Enzyme digestion product: [enzyme digestion product length × 0.02] ng 2×Gibson assembly enzyme: 10ul Add dd water to 20ul system; Incubate at 50°C for 45 min. (2.33) Cultivate the ORF fragment of the target gene The cultivation steps are: (2.331) Thaw Dh5α on ice in advance. Take 10 μl of the liquid from step 2) and add 100 μl of Dh5α. Place on ice for 30 min, heat shock at 42°C for 1 min, and then keep on ice for 5 min. (2.332) Spread all of the above liquid onto solid LB medium containing amp and incubate at 37°C overnight; (2.333) The next day, the bacteria were selected and cultured in liquid LB medium. The bacterial solution was sent for testing. After correct sequencing, the plasmid was extracted. The ORF fragment containing the target gene was obtained and used as a transfer plasmid for subsequent virus packaging.
5. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 4, characterized in that: The steps for preparing plasmid in step 2) rAAV packaging are: The transfer plasmid, pHelpe plasmid and pAnc80L65 plasmid were subjected to large-scale extraction.
6. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 5, characterized in that: The HEK-293 cell transfection step in step 2) rAAV packaging is: 1) Seed HEK-293 cells in a 10 cm dish and use for transfection 48 hours later, when the confluence reaches 70-80%; 2) 1 hour before transfection, remove the cell culture plate, remove the original cell culture medium, and add 10 ml of Opti-MEM medium; 3) Prepare the complex of transfection reagent and plasmid The steps are: i. Dissolve 32 μg of each of the three plasmids to be transfected in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 minutes to obtain a plasmid dilution; the three plasmids are (pHelper plasmid, pAnc80L65 plasmid, and transfer plasmid; ii. Dissolve the transfection reagent in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 minutes; iii. Add the transfection reagent dilution dropwise to the plasmid dilution, gently mix while adding, and let it stand at room temperature for 20 minutes to allow the DNA and transfection reagent to fully combine to form a stable DNA transfection complex; 4) Remove the cell dish and add the prepared DNA-transfection reagent complex to the cell culture plate; after 6 hours, aspirate the culture medium, wash once with PBS, and add 10 ml of fresh complete culture medium for incubation.
7. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 6, characterized in that: The virus harvesting and purification steps in step 2) rAAV packaging are: (1) 60 h after transfection, scrape the cells with a cell scraper and collect them in a centrifuge tube; (2) Centrifuge at 1500 rpm and 4°C for 5 min; resuspend the cell pellet in 9 ml of lysis buffer and collect the culture medium into a 500 ml bottle; (3) Cell lysate was frozen in liquid nitrogen for 3 min, then placed in a 37°C water bath and repeatedly frozen and thawed 3-4 times; (4) Add 250 U of benzonase, mix well, and incubate at 37°C for 1 h; (5) Add NaCl to a final concentration of 150 mM, mix well, and incubate at 37°C for 30 min; (6) Centrifuge at 2500 rpm at room temperature for 10 min, remove the supernatant and discard the precipitate; (7) Pour the supernatant from step 2) into the supernatant collected in step 6), add PEG8000 and NaCl to final concentrations of 8% and 0.5 M, respectively, and incubate at 4°C overnight; (8) Centrifuge at 12000 rpm and 4°C for 1.5 h, discard the supernatant, and resuspend the pellet in 10 ml PBS; (9) The resuspended virus stock solution was added to four ultracentrifuge tubes containing iodixanol and centrifuged at 63,000 rpm and 18°C for 2 h; the concentrations of iodixanol in the four ultracentrifuge tubes were 15%, 25%, 40%, and 60%, respectively; (10) Draw out the 40% layer of sample using a 10 ml syringe and place it into a dialysis bag. Dialyze at 4°C and change the dialysate every 12-16 hours, using 2 L of buffer each time. (11) The dialyzed samples were collected, concentrated using ultrafiltration tubes, and stored at -80°C.
8. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 7, characterized in that: After the step 2) rAAV packaging step is completed, titer determination is required, specifically, the number of AAV virus particles is determined by detecting the genome copy number of the AAV vector in the genome through quantitative PCR.
9. The method for preparing the high-expression SITR6 AAV gene therapy system according to claim 8, characterized in that: The titer determination step is: (1) Prepare the standard: Use the plasmid standard, calculate the concentration of the standard, dilute to 1E+8 cells / ul, and then dilute in a gradient to 1E+3 cells / ul, for a total of 6 gradients; (2) Sample preparation: Alkaline lysis: Take 5 μl of concentrated virus sample, add NaOH to a final concentration of 1 M, bathe in a 55°C water bath for 30 min, then add HCl to neutralize, and dilute 10-fold with pure water or 1X PBS; (3) Add 18 μl of reaction solution to each reaction well, followed by 2 μl of template; (4) On the machine, set the annealing temperature to 60°C, obtain the Ct value according to standard procedures and calculate the copy number in the AAV sample.
10. Use of the SIRT6 AAV gene therapy system according to claim 1 as a drug for delaying and treating corneal endothelial decompensation.
Citation Information
Patent Citations
Medicament for treating atherosclerosis and application of Sirt6
CN113230393A
Compounds having SIRT6 agonistic activity and uses thereof
CN117362286A
SIRT6 activators
US20240327411A1
A viral vector comprising SIRT6 for treating a disease
WO2025032584A1