Kit, application thereof and method for detecting tandem repeat gene typing

Abstract

The invention relates to the technical field of biology, and discloses a kit and application thereof and a method for detecting tandem repeat genotyping, the kit comprises a primer pair A and a primer pair B. The primer pair A comprises a primer with a nucleotide sequence as shown in SEQ IN NO: 1 and a primer with a nucleotide sequence as shown in SEQ IN NO: 2; and the primer pair B comprises a primer with a nucleotide sequence as shown in SEQ IN NO: 3 and a primer with a nucleotide sequence as shown in SEQ IN NO: 4. The kit provided by the invention can simultaneously realize typing determination of two variable number tandem repeat polymorphisms, only one PCR amplification is needed in the detection process, and meanwhile, the adopted primers do not need fluorescent modification and are low in price, so that the detection cost can be greatly reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a kit and an application thereof, and a method for detecting tandem repeat sequence genotyping. Background Art

[0002] Thymidylate synthase (TS) is the target of fluoropyrimidine drugs. The TYMS gene influences TS enzyme expression, thereby impacting drug efficacy. Therefore, identifying this genetic polymorphism is crucial for precision medicine with fluoropyrimidines. rs45445694 is located in the promoter region of the TYMS gene, immediately adjacent to the ATG start codon. A 28-bp variable number tandem repeat (VTR) is present upstream of the transcription start site in the 5'-UTR. Tandem repeat polymorphisms at this site significantly influence drug efficacy and toxicity. This sequence can bind to various transcriptional regulatory proteins, thereby stimulating and enhancing promoter activity and affecting gene expression efficiency. The VTR sequence in this region varies in number, ranging from two (2R), three (3R), or four to five times, with reports suggesting a maximum of nine repeats.

[0003] The SLC6A4 gene is a key gene associated with susceptibility to psychiatric disorders and the efficacy of antidepressant medications. The rs774676466 sequence, located in the promoter region of the SLC6A4 gene, contains a 20-24 bp homologous repeat sequence with variable repeat length, including long, extra-long, short, and very short alleles with varying expression. Repeat length polymorphisms in this gene promoter have been shown to affect the rate of serotonin uptake, and multiple studies suggest that this polymorphism may play a role in behavior and depression.

[0004] Currently, numerous technologies are used to detect human genetic polymorphisms. The most commonly used include polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), sequence-specific PCR, gene chip analysis, and gene sequencing. However, when applied to variable number repeat polymorphisms (VTRs), these technologies suffer from low resolution, cumbersome operation, long detection cycles, and high costs due to the molecular characteristics of VTRs, including dynamic changes in repeat number, high GC content, and complex sequence composition. For example, PCR-RFLP suffers from low resolution, unable to accurately distinguish differences within 50 bp, and is susceptible to poor amplification efficiency due to the influence of high GC content. Second-generation sequencing (NGS) is limited in read length and cannot accurately locate and identify VTR variants, resulting in low sensitivity. CN119776518A provides a tandem repeat-related gene mutation detection system and a method for non-disease diagnosis purposes. However, this method relies on single-molecule real-time sequencing of third-generation sequencing to detect tandem repeats. This method requires only 2 μg of DNA, is cumbersome to operate, and has a long detection cycle.

[0005] Therefore, there is an urgent need to develop a simple, high-resolution method for detecting tandem repeat genotyping. Summary of the Invention

[0006] The purpose of the present invention is to overcome the defects of cumbersome operation and low resolution in the method for detecting tandem repeat sequence genotyping.

[0007] In order to achieve the above object, the first aspect of the present invention provides a kit, which includes a primer pair A and a primer pair B: Primer pair A: comprising a primer having a nucleotide sequence as shown in SEQ IN NO: 1 and a primer having a nucleotide sequence as shown in SEQ IN NO: 2; Primer pair B: includes a primer having a nucleotide sequence as shown in SEQ IN NO: 3 and a primer having a nucleotide sequence as shown in SEQ IN NO: 4.

[0008] A second aspect of the present invention provides a method for detecting short tandem repeat genotyping, the method comprising: (1) performing specific PCR amplification on a nucleic acid sample of a sample to be identified using a kit to obtain an amplified product; the kit is the kit described in the first aspect; (2) The amplified product and the standard are subjected to capillary electrophoresis, and the number of repetitions of the core repeat unit of the tandem repeat sequence is determined based on the electrophoresis patterns of the standard and the amplified product.

[0009] The third aspect of the present invention provides use of the kit described in the first aspect in detecting the genotype of a polymorphic site of a thymidylate synthase gene.

[0010] The fourth aspect of the present invention provides use of the kit described in the first aspect in detecting the genotype of a polymorphic site of a serotonin transporter gene.

[0011] Through the above technical solution, the present invention has at least the following advantages: (1) The kit provided by the present invention can simultaneously determine the typing of two variable number tandem repeat polymorphisms. The detection process only requires one PCR amplification. At the same time, the primers used do not require fluorescent modification and are low in price, which can greatly reduce the detection cost.

[0012] (2) The present invention can achieve high specificity, high efficiency and rapid amplification of complex regions with high GC content by optimizing primer sequences, polymerases and enhancers, and the kit of the present invention is compatible with all gene amplification instruments on the market.

[0013] (3) The present invention adopts a capillary electrophoresis fragment analysis detection system, which can directly and clearly detect the size of the amplified product band and easily determine the typing of variable number tandem repeat polymorphisms by comparing the amplified product with the standard.

[0014] (4) The present invention only requires 10 ng of DNA sample to complete the detection, which has a low demand for DNA and can meet the DNA extraction needs of various tissue or body fluid samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the capillary electrophoresis result of the standard product in Example 2; Figure 2 is the result of capillary electrophoresis of sample 1 in Example 2; Figure 3 is the capillary electrophoresis result of sample 2 in Example 3; Figure 4 is the capillary electrophoresis result of sample 3 in Example 4; Figure 5 is the capillary electrophoresis pattern of NA12878 DNA in Example 5; Figure 6 is the result of capillary electrophoresis of Promega DNA in Example 6; Figure 7 This is the result of the capillary electrophoresis of Promega DNA in Comparative Example 1. DETAILED DESCRIPTION

[0016] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0017] As mentioned above, the first aspect of the present invention provides a kit comprising a primer pair A and a primer pair B: Primer pair A: comprising a primer having a nucleotide sequence as shown in SEQ IN NO: 1 and a primer having a nucleotide sequence as shown in SEQ IN NO: 2; Primer pair B: includes a primer having a nucleotide sequence as shown in SEQ IN NO: 3 and a primer having a nucleotide sequence as shown in SEQ IN NO: 4.

[0018] The nucleotide sequences shown in SEQ IN NO: 1 to SEQ IN NO: 4 are as follows: SEQ IN NO: 1: GGCGTTGCCGCTCTGAATGC.

[0019] SEQ IN NO: 2: GAGGGACTGAGCTGGACAACC.

[0020] SEQ IN NO: 3: GTGGCTCCTGCGTTTCCCCC.

[0021] SEQ IN NO: 4: GCTCCGAGCCGGCCACAGGCATG.

[0022] Preferably, the molar concentration ratio of primer pair A to primer pair B is 0.8-1.2:1.

[0023] The "molar concentration ratio of primer pair A to primer pair B" refers to the ratio of the sum of the molar concentrations of the two primers in primer pair A to the sum of the molar concentrations of the two primers in primer pair B, assuming that the molar concentrations of the two primers in primer pair A and the molar concentrations of the two primers in primer pair B are the same in the amplification system.

[0024] For example, the working concentration range of the primer with the nucleotide sequence shown in SEQ IN NO: 1 and the primer with the nucleotide sequence shown in SEQ IN NO: 2 in primer pair A is 0.2 μM-0.3 μM.

[0025] For example, the working concentration range of the primer with the nucleotide sequence shown in SEQ IN NO: 3 and the primer with the nucleotide sequence shown in SEQ IN NO: 4 in primer pair B is 0.2 μM-0.3 μM.

[0026] Preferably, the kit further comprises an enhancer.

[0027] Preferably, the enhancer comprises 5%-8% dimethyl sulfoxide (DMSO), 0.05%-0.1% Tween 20, and 1M-1.5M betaine.

[0028] In the present invention, the enhancer is an additive that significantly improves PCR amplification efficiency and PCR amplification specificity; based on the total volume of the PCR amplification system, the content of dimethyl sulfoxide is 5 volume %-8 volume %; the content of Tween-20 is 0.05 volume %-0.1 volume %; and the content of betaine is 1M-1.5M.

[0029] Preferably, the kit further comprises a PCR detection working solution.

[0030] Preferably, the PCR detection working solution contains at least one of tris(hydroxymethylaminomethane) hydrochloride buffer, DNA polymerase, and deoxynucleotide triphosphate.

[0031] According to a preferred embodiment of the present invention, the PCR detection working solution is a 2×PCR reaction solution.

[0032] In the present invention, the kit also includes a standard, which includes a DNA fragment I with a nucleotide sequence as shown in SEQ IN NO: 5 and a DNA fragment II with a nucleotide sequence as shown in SEQ IN NO: 6; the DNA fragment I is a TYMS gene sequence containing a promoter region, wherein the promoter region contains 3 variable number tandem repeat sequences, wherein the variable number tandem repeat sequence has a fragment length of 28 bp; the DNA fragment II is a SLC6A4 gene sequence containing a promoter region, wherein the promoter region contains 16 variable number tandem repeat sequences, wherein the variable number tandem repeat sequences are repeat sequences with extremely high base sequence similarity, and the fragment length is 20-24 bp. The nucleotide sequences shown in SEQ IN NO: 5 to SEQ IN NO: 6 are as follows: SEQ IN NO: 5: GTGGCTCCTGCGTTTCCCCCTGGCGCACGCTCTCTAGAGCGGGGGCCGCCGCGACCCCGCCGAGCAGGAAGAGGCGGAGCGCGGGACGGCCGCGGGAAAAGGCGCGCGGAAGGGGTCCTGCCACCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCCGCCCGCCGCGCCATGCCTGTGGCCGGCTCGGAGC.

[0033] SEQ IN NO: 6: .

[0034] Preferably, the GC content of the two primers in the primer pair A is 61.9%-65%; the GC content of the two primers in the primer pair B is 70%-73.5%.

[0035] In the present invention, GC content refers to the ratio of cytosine (C) to guanine (G) among the four bases in a DNA sequence.

[0036] For example, the annealing temperatures of the primer with the nucleotide sequence shown in SEQ IN NO: 1 and the primer with the nucleotide sequence shown in SEQ IN NO: 2 in primer pair A are 60° C.-65° C. and 60° C.-65° C., respectively.

[0037] Illustratively, the annealing temperatures of the primer with the nucleotide sequence shown in SEQ IN NO: 3 and the primer with the nucleotide sequence shown in SEQ IN NO: 4 in primer pair B are 60°C-65°C and 60°C-65°C, respectively.

[0038] The present invention specifically designs primer sequences that can amplify regions with high GC content. At the same time, non-specific binding will not occur between primers, and dimers will not be formed during use. Therefore, primer pair A and primer pair B can be mixed and used together, thereby enabling the use of PCR amplification technology to quickly and conveniently identify the typing of the above-mentioned variable number tandem repeat polymorphism.

[0039] The primer pair A and the primer pair B provided by the present invention can be packaged separately or mixed. Since non-specific binding does not occur between the primers in the kit provided by the present invention, preferably, in order to save packaging materials and reduce production and use costs, the primer pair A and the primer pair B can be packaged in a mixed form.

[0040] As mentioned above, the second aspect of the present invention provides a method for detecting tandem repeat sequence genotyping, the method comprising: (1) performing specific PCR amplification on a nucleic acid sample of a sample to be identified using a kit to obtain an amplified product; the kit is the kit described in the first aspect; (2) The amplified product and the standard are subjected to capillary electrophoresis, and the number of repetitions of the core repeat unit of the tandem repeat sequence is determined based on the electrophoresis patterns of the standard and the amplified product.

[0041] The present invention has no particular limitation on the method for extracting the nucleic acid sample of the sample to be identified, and the method can be selected according to conventional methods in the art.

[0042] Preferably, the reaction procedure of the specific PCR amplification includes: 94°C, 2 min, 28×[94°C, 15 s, 63°C, 15 s, 68°C, 15 s], 68°C, 1 min, and storage at 4°C.

[0043] As mentioned above, the third aspect of the present invention provides the use of the kit described in the first aspect in detecting the genotype of the polymorphic site of the thymidylate synthase gene.

[0044] Preferably, the thymidylate synthase gene polymorphism site is rs45445694.

[0045] As mentioned above, the fourth aspect of the present invention provides the use of the kit described in the first aspect in detecting the genotype of the polymorphic site of the serotonin transporter gene.

[0046] Preferably, the serotonin transporter gene polymorphism site is rs774676466.

[0047] The present invention only needs to perform PCR amplification and capillary electrophoresis to simultaneously detect the typing of the variable number tandem repeat polymorphisms of the rs45445694 site of the thymidylate synthase gene and the rs45445694 site of the serotonin transporter gene.

[0048] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention.

[0049] In the following examples, unless otherwise specified, all raw materials used are commercially available products; room temperature refers to 25±2°C.

[0050] The Qsep100 fully automatic nucleic acid and protein analysis system was purchased from Guangding Biotechnology Co., Ltd. in Taiwan, China.

[0051] The PCR amplification instrument was purchased from Hangzhou Biori Technology Co., Ltd., model TC-96 / G / H / (b)C.

[0052] Example 1 This example is used to illustrate the preparation of the kit provided by the present invention.

[0053] 1. Prepare primers and reference materials.

[0054] Shanghai Jierui Bioengineering Co., Ltd. synthesized primers and standards according to the nucleotide sequences in Table 1. The original concentrations of primers SLC6A4_F, SLC6A4_R, TYMS_F, and TYMS_R synthesized by Shanghai Jierui Bioengineering Co., Ltd. were all 10 μM.

[0055] Table 1:

[0056] 2. Prepare the unit reaction reagent kit for PCR reaction Prepare the corresponding reagents according to the required amounts of the unit reaction reagent kit (ie, the reagent kit used to detect one sample in one PCR reaction) in Table 2.

[0057] Table 2:

[0058] Note: In Table 2, 2× PCR reaction solution was purchased from Thermo Fisher Scientific (China) Co., Ltd. with the catalog number 14000012; DMSO was purchased from Sangon Biotech (Shanghai) Co., Ltd. with the catalog number A100231-0250; betaine was purchased from Sangon Biotech (Shanghai) Co., Ltd. with the catalog number A600185-0100; 10 mol / L betaine was prepared by dissolving 1.17 g betaine in 1 mL of nuclease-free water; Tween-20 was purchased from Sangon Biotech (Shanghai) Co., Ltd. with the catalog number A600560-0500; 1% Tween-20 was prepared by adding 20 μL of Tween-20 to 1980 μL of nuclease-free water.

[0059] 3. Prepare the kit Combine and package the reagents prepared in steps 1-2 according to the required volumes for a 48-unit reaction kit (i.e., a kit for testing 48 samples in 48 PCR reactions). The volumes of the individual reagents in the kit are shown in Table 3.

[0060] Table 3:

[0061] Example 2 This example is used to illustrate that the kit provided by the present invention determines the typing of the variable number tandem repeat polymorphism at the rs45445694 site of the thymidylate synthase gene and the rs45445694 site of the serotonin transporter gene in the genomic DNA of sample 1.

[0062] 1. Extraction of genomic DNA from sample 1 Sample 1 is human whole blood, obtained from Hunan Shengweier Medical Laboratory Co., Ltd. Informed consent was obtained from the relevant personnel for this study. Genomic DNA was extracted from 300 μL of whole blood using a nucleic acid extraction or purification kit (Cat. No. S10015) from Shengxiang Biotechnology Co., Ltd. The following are the detailed extraction steps: Preparation: According to the label instructions of "S10015-Washing Solution 2", add 50 mL of anhydrous ethanol to S10015-Washing Solution 2 before use; according to the number of samples, mix Proteinase K (20 μL / person) and S10015-Magnetic Bead Solution (30 μL / person) in the proportion to form a Proteinase K-Magnetic Bead mixture, shake to mix, and centrifuge at low speed.

[0063] Operation process: (1) Take a 1.5 mL centrifuge tube, add 300 μL of sample 1, 500 μL of S10015-extraction solution 1 and 50 μL of proteinase K-magnetic bead mixture; cover the tube, shake and mix for 30 seconds, and heat at 60℃ for 10 minutes.

[0064] (2) Let it stand at room temperature for 1 minute, centrifuge it at low speed, place the centrifuge tube on a magnetic separator, and slowly aspirate and discard the waste liquid after 5 minutes.

[0065] (3) Add 750 μL of S10015-wash solution 1, shake and mix for 30 seconds, centrifuge at low speed, and place the centrifuge tube back into the magnetic separator. Magnetic suction for 3 minutes, completely aspirate and discard the liquid.

[0066] (4) Add 750 μL of S10015-wash solution 2, shake and mix for 30 seconds, centrifuge at low speed, and place the centrifuge tube back in the magnetic separator. Magnetic suction for 3 minutes, completely aspirate and discard the liquid, and continue to stand on the magnetic separator for 2 minutes to completely aspirate the liquid.

[0067] (5) Open the lid and let it stand at room temperature for 5 minutes.

[0068] (6) Add 100 μL of S10015-elution buffer S, shake and mix for 30 seconds to elute the magnetic beads on the wall of the centrifuge tube to the bottom of the tube, and let it stand at room temperature for 5 minutes; centrifuge at a low speed, place the centrifuge tube on the magnetic separator again and magnetically absorb for 3 minutes, and then transfer the eluted nucleic acid to a clean 1.5 mL centrifuge tube.

[0069] 2. First round of multiplex PCR amplification The PCR reaction was performed according to the reaction conditions in Table 4.

[0070] Table 4:

[0071] 3. Fully automatic capillary electrophoresis (1) Dilution of amplified product: Take 5 μL of amplified product and add it to a new 1.5 mL centrifuge tube. Add 50 μL of deionized water to the centrifuge tube, vortex for 20 seconds, and centrifuge briefly.

[0072] (2) The capillary electrophoresis of the standard product was performed using the Qsep100 fully automatic nucleic acid and protein analysis system. The capillary electrophoresis pattern of the standard product is as follows: Figure 1 As shown. Figure 1 As can be seen from the results, two clear peaks of 246 bp and 553 bp were generated. The fragment sizes in the standard are shown in Table 5.

[0073] (3) Typing determination rules: Through capillary electrophoresis, obtain the fragment size of the amplified product of the sample to be tested and the standard, and perform typing by comparing the difference in fragment size between the two. The details are as follows: DNA fragment I in the standard is the TYMS gene (rs45445694) containing three tandem repeat sequences. The fragment length of DNA fragment I is <450bp and has a single peak. DNA fragment II in the standard is the SLC6A4 gene (rs774676466) containing 16 variable number tandem repeat sequences. The fragment length of DNA fragment II is >450bp and has a single peak. For the fragment amplified from the TYMS gene (rs45445694) in the sample to be tested, this fragment is <450bp, and the homozygote has a single peak, while the heterozygote has a bimodal pattern. For the fragment amplified from the SLC6A4 gene (rs774676466) in the sample to be tested, this fragment is >450bp, and the homozygote has a single peak, while the heterozygote has a bimodal pattern. TYMS (rs45445694) coefficient of variation = (sample band - standard band) / 28, the result is rounded SLC6A4 (rs774676466) variance coefficient = (sample band - standard band) / 20, the result is rounded Number of replicates = standard (number of replicates) + coefficient of variation (3) Automatic capillary electrophoresis of amplified products: 5 μL of diluted amplified products were loaded on the Qsep100 automatic nucleic acid protein analysis system and capillary electrophoresis was performed. The capillary electrophoresis pattern was as follows: Figure 2 shown. Figure 2 Two clear peaks, 249 bp and 518 bp, were generated. The fragment sizes of the amplified products are shown in Table 5. According to the typing rules and Table 5, sample 1 showed a homozygous genotype of 3R / 3R for TYMS (rs45445694). Sample 1 also showed a homozygous genotype of 14 / 14 for SLC6A4 (rs774676466).

[0074] Example 3 The present embodiment is used to illustrate that the test kit provided by the present invention determines the typing of the variable number tandem repeat polymorphism of the rs45445694 site of the thymidylate synthase gene and the rs45445694 site of the serotonin transporter gene in the genomic DNA of sample 2. According to the same method as Example 2, the difference is that sample 1 is replaced by sample 2, and the sample 2 is human whole blood, derived from Hunan Shengweier Medical Laboratory Co., Ltd., and the research of this embodiment has been passed through the informed consent of relevant personnel. The capillary electrophoresis pattern of the amplified product is as follows Figure 3 As shown. Figure 3Two clear peaks, 248 bp and 516 bp, were generated. The fragment sizes of the amplified products are shown in Table 5. According to the typing rules and Table 5, sample 2 showed a homozygous genotype of 3R / 3R for TYMS (rs45445694). Sample 2 also showed a homozygous genotype of 14 / 14 for SLC6A4 (rs774676466).

[0075] Example 4 The present embodiment is used to illustrate that the test kit provided by the present invention determines the typing of the variable number tandem repeat polymorphism of the rs45445694 site of the thymidylate synthase gene and the rs45445694 site of the serotonin transporter gene in the genomic DNA of sample 3. According to the same method as in Example 2, the difference is that sample 1 is replaced by sample 3, and the sample 3 is human whole blood, derived from Hunan Shengweier Medical Laboratory Co., Ltd., and the research of this embodiment has been passed through the informed consent of relevant personnel. The capillary electrophoresis pattern of the amplified product is as follows Figure 4 As shown. Figure 4 Four distinct peaks were generated, at 217 bp, 241 bp, 513 bp, and 550 bp. The fragment sizes of the amplified products are shown in Table 5. According to the typing rules and Table 5, in sample 3, TYMS (rs45445694) was heterozygous for 2 / 3 repeats, with a genotype of 2R / 3R; and SLC6A4 (rs774676466) was heterozygous for 14 / 16 repeats, with a genotype of 14 / 16.

[0076] Example 5 This example is used to illustrate the use of the kit provided by the present invention to determine the typing of the variable number tandem repeat polymorphism at the rs45445694 site of the thymidylate synthase gene and the rs45445694 site of the serotonin transporter gene in NA12878 DNA. The same method as in Example 2 was used, except that Sample 1 was replaced with NA12878 DNA purchased from Yu Jingliang Technology (Shenzhen) Co., Ltd. under the product number GW-SHF001. The capillary electrophoresis pattern of the amplified product is shown in FIG. Figure 5 As shown. Figure 5 Two clear peaks, 246 bp and 514 bp, were generated. The fragment sizes of the amplified products are shown in Table 5. According to the typing rules and Table 5, NA12878 showed a homozygous genotype of 3R / 3R for TYMS (rs45445694). In NA12878, the homozygous genotype of 14 repeats for SLC6A4 (rs774676466) was 14 repeats, with a genotype of 14 / 14.

[0077] Example 6 This example is used to illustrate the use of the kit provided by the present invention to determine the typing of the variable number tandem repeat polymorphism at the rs45445694 site of the thymidylate synthase gene and the rs45445694 site of the serotonin transporter gene in Promega DNA. The same method as in Example 2 was used, except that Sample 1 was replaced with the Promega DNA purchased from Promega Corporation with the product number G3041. The capillary electrophoresis pattern of the amplified product is shown in FIG. Figure 6 As shown. Figure 6 Four clear peaks were generated, at 218 bp, 242 bp, 517 bp, and 554 bp. The fragment sizes of the amplified products are shown in Table 5. According to the typing rules and Table 5, the TYMS (rs45445694) gene in the Promega DNA was heterozygous for 2 / 3 repeats, with a 2R / 3R genotype; the SLC6A4 (rs774676466) gene in the Promega DNA was heterozygous for 14 / 16 repeats, with a 14 / 16 genotype.

[0078] Table 5:

[0079] Comparative Example 1 The same method as in Example 2 was used, except that the nucleotide sequences of the primers were replaced with the nucleotide sequences shown in Table 6, and the test sample was Promega DNA. The capillary electrophoresis pattern of the amplified product was as shown in FIG. Figure 7 As shown. Figure 7 It shows that there are weak peaks at 219 bp and 253 bp, and the other peaks are basically invisible; it is impossible to determine the two repeat units.

[0080] Table 6:

[0081] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.

Claims

1. A kit, characterized in that: The kit includes primer pair A and primer pair B: Primer pair A: comprising a primer having a nucleotide sequence as shown in SEQ IN NO: 1 and a primer having a nucleotide sequence as shown in SEQ IN NO: 2; Primer pair B: includes a primer having a nucleotide sequence as shown in SEQ IN NO: 3 and a primer having a nucleotide sequence as shown in SEQ IN NO:

4.

2. The kit according to claim 1, wherein The molar concentration of primer pair A and primer pair B is 0.8-1.2:1; And / or, the kit further comprises an enhancer.

3. The kit according to claim 2, wherein The enhancer includes 5%-8% dimethyl sulfoxide, 0.05%-0.1% Tween-20 and 1M-1.5M betaine; And / or, the kit further comprises a PCR detection working solution; the PCR detection working solution contains at least one of tris(hydroxymethylaminomethane) hydrochloride buffer, DNA polymerase, and deoxynucleotide triphosphate.

4. The kit according to any one of claims 1 to 3, characterized in that The GC content of the two primers in the primer pair A is 61.9%-65%; the GC content of the two primers in the primer pair B is 70%-73.9%.

5. A method for detecting tandem repeat sequence genotyping, characterized in that: The method includes: (1) performing specific PCR amplification on a nucleic acid sample of a sample to be identified using a kit to obtain an amplified product; the kit is the kit according to any one of claims 1 to 4; (2) The amplified product and the standard are subjected to capillary electrophoresis, and the number of repetitions of the core repeat unit of the tandem repeat sequence is determined based on the electrophoresis patterns of the standard and the amplified product.

6. The method according to claim 5, characterized in that The reaction procedure of the specific PCR amplification includes: 94°C, 2 min, 28×[94°C, 15 s, 63°C, 15 s, 68°C, 15 s], 68°C, 1 min, and storage at 4°C.

7. Use of the kit according to any one of claims 1 to 4 in detecting the genotype of a polymorphic site of a thymidylate synthase gene.

8. The use according to claim 7, characterized in that The thymidylate synthase gene polymorphism site is rs45445694.

9. Use of the kit according to any one of claims 1 to 4 in detecting the genotype of a polymorphic site of a serotonin transporter gene.

10. The use according to claim 9, characterized in that The serotonin transporter gene polymorphism site is rs774676466.

Images