Drug resistance gene detection composition based on RAA-TtrAgo detection method, kit, detection method and application

Abstract

The invention provides a drug resistance gene detection composition based on an RAA-TtrAgo detection method, a kit, a detection method and application, and belongs to the technical field of gene detection. According to the invention, a recombinase-mediated isothermal nucleic acid amplification technology and a TtrAgo enzyme technology are combined, a high-sensitivity and high-accuracy RAA-TtrAgo-based drug-resistant gene detection method is developed, the detection sensitivity of the method reaches the level of 10 copies / mu L, target nucleic acid with extremely low concentration can be detected, and the method is suitable for clinical application. The fluorescence detection of the aadA gene (HEX fluorescence) and the qacA gene (FAM fluorescence) can be carried out under an ultraviolet lamp, the dependence on professional equipment is avoided, the detection efficiency is improved, the rapid detection (completed within 60 minutes) is realized, the detection result is visual and readable, the method conforms to the development trend of rapid and on-site detection, the method is suitable for a detection system with limited resources, and the innovation and development of a nucleic acid detection technology are promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a drug-resistant gene detection composition, a kit, a detection method and an application based on the RAA-TtrAgo detection method. Background Art

[0002] Antibiotic resistance genes (ARGs) are the genetic basis for bacterial resistance to antibiotics, allowing bacteria to tolerate the effects of antibiotics and rendering antibiotic treatment ineffective. The World Health Organization (WHO) has labeled bacterial antibiotic resistance a major global public health crisis. In 2024, the WHO updated its list of antibiotic resistance genes that pose the greatest threat to human health, highlighting the urgency and severity of the antibiotic resistance problem.

[0003] Antibiotic resistance has become a major global public health challenge. It not only undermines the effectiveness of existing antibiotics but also leads to a large number of unnecessary deaths. Antibiotic resistance causes approximately 700,000 deaths annually. According to the World Health Organization, if this trend is not effectively curbed, this number is expected to rise to 10 million by 2050. This means that within the next few decades, antibiotic resistance may become one of the leading causes of death worldwide, potentially even exceeding cancer in terms of death toll.

[0004] Due to the overuse of antibiotics, large amounts of antibiotics remaining in the environment continuously screen microorganisms, leading to the excretion of large numbers of drug-resistant bacteria carrying ARGs into the water or soil microenvironment through livestock or human feces, posing a potential threat to public health. Current technologies for detecting drug-resistant genes include antibiotic susceptibility testing, dilution methods, disc diffusion methods, PCR, and metagenomic sequencing. However, these methods have limitations, are time-consuming, complex, and require specialized equipment and operators.

[0005] Argonaute (Ago) proteins are a family of highly conserved proteins found widely in bacteria, archaea, and eukaryotes. They use single-stranded "guide RNA" or "guide DNA" to find target RNA or DNA with complementary sequences. Argonaute was first described in a study of a mutant of Arabidopsis thaliana and was named Argonaute because of its resemblance to a squid. Depending on their origin, Argonaute proteins can be divided into eukaryotic Argonaute (eAgo) and prokaryotic Argonaute (pAgo). TtrAgo (Thermococcus thioreducens Argonaute) is a prokaryotic Argonaute protein isolated from a sulfur-loving archaeon. It functions as a programmable DNA endonuclease by utilizing a short 5'-phosphorylated or 5'-hydroxylated single-stranded DNA guide and exhibits high efficiency and accuracy at an optimal temperature of 75°C to 95°C. In addition, TtrAgo exhibits stepwise cleavage activity similar to PfAgo (Pyrococcus furiosus Argonaute) and double-stranded DNA cleavage activity similar to MjAgo (Methanocaldococcusjannaschii Argonaute). In 2022, researchers applied TtrAgo to detect hepatitis B virus DNA; in 2023, other researchers introduced TtrAgo (also known as TtdAgo) into the industrial ethanol-producing bacterium Zymomonas mobilis to evaluate its in vivo effects. Research reports indicate that TtrAgo has the potential to become a new tool for gene editing and nucleic acid detection technologies.

[0006] Currently, nuclease-based gene editing and nucleic acid detection technologies include CRISPR / Cas and pAgo enzyme technology. CRISPR / Cas technology has been developed as a highly sensitive diagnostic tool for in vitro nucleic acid detection and is currently a popular detection technology. However, CRISPR / Cas technology still has certain limitations. First, it requires the presence of a PAM sequence at the target site to be detected; otherwise, the Cas effector protein cannot attach and cleave the target DNA fragment. Second, the Cas effector protein requires an RNA guide to perform its cleavage function. Guide RNA is typically obtained by in vitro transcription or chemical synthesis, which is costly and unstable and easily degrades. In contrast, pAgo enzyme technology can use a short single-stranded DNA (ssDNA) as a guide strand (gDNA) to target and cleave DNA, with greater precision and stability. Among them, TtrAgo can accurately recognize and cleave complementary DNA or RNA targets without requiring a specific PAM sequence. This allows it to target more genomic regions and is not restricted by PAM sequences. Moreover, TtrAgo uses a more stable DNA guide rather than RNA. This guide DNA (gDNA) is complementary to the target DNA sequence, guiding TtrAgo to precisely locate a specific nucleic acid sequence. After recognizing the target DNA, TtrAgo cleaves it between nucleotides 10 and 11 at the corresponding position in the guide DNA. This cleavage mechanism is similar to that of other Argonaute proteins, but TtrAgo's cleavage efficiency and specificity are particularly pronounced at high temperatures (75°C to 95°C), making its detection more stable and efficient in high-temperature environments. Therefore, it has potential applications in nucleic acid detection and gene editing.

[0007] In order to control the spread of antibiotic resistance, there is an urgent need to establish a method that can quickly and accurately detect resistance genes in the environment. Summary of the Invention

[0008] The purpose of the present invention is to provide a drug-resistant gene detection composition, kit, detection method and application based on the RAA-TtrAgo detection method, which has the characteristics of high sensitivity and rapid detection, provides new ideas for drug-resistant gene detection in the environment, and is of great significance to protecting public health.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a drug-resistant gene detection composition based on the RAA-TtrAgo detection method, wherein the drug-resistant gene detection composition includes a composition for detecting the aadA gene, a composition for detecting the qacA gene, or a composition for detecting both the aadA gene and the qacA gene;

[0011] The composition for detecting the aadA gene includes the following sequence:

[0012] RAA upstream primer-SEQ ID NO.3:

[0013] CTAAATGAAAACCTTAACGCTATGGAACTCGC;

[0014] RAA downstream primer-SEQ ID NO.4:

[0015] GTGATCTCGCCTTTCACGTAGTGGACAAAT

[0016] gDNA2-1-SEQ ID NO.11:

[0017] GGACAAATTCTTCCAA;

[0018] gDNA2-2-SEQ ID NO.12:

[0019] TCGCCTTTCACGTAGT;

[0020] Probe - SEQ ID NO. 17:

[0021] HEX-TTTCACGTAGTGGACAAATTCTTCCAACTGAT-BHQ1;

[0022] The composition for detecting the qacA gene includes the following sequence:

[0023] RAA upstream primer-SEQ ID NO.5:

[0024] TACAGGTTGTGGAAGAACTTTCTCCTTTTA;

[0025] RAA downstream primer-SEQ ID NO.6:

[0026] GACCAAAGAAATACATAATAAACATGCCAAT;

[0027] gDNA2-1-SEQ ID NO.15:

[0028] AATAGGAGATATGGTG;

[0029] gDNA2-2-SEQ ID NO.16:

[0030] TTTGCACCAATTGCAC;

[0031] Probe - SEQ ID NO. 18:

[0032] FAM-TATGGCAATAGGAGATATGGTGTTTGCACCAAT-BHQ1.

[0033] The composition for detecting aadA gene and qacA gene comprises:

[0034] The above-mentioned composition for detecting aadA gene and the composition for detecting qacA gene.

[0035] The present invention also provides an application of the drug-resistant gene detection composition based on the RAA-TtrAgo detection method in drug-resistant gene detection.

[0036] The present invention also provides a drug-resistant gene detection kit based on the RAA-TtrAgo detection method, wherein the drug-resistant gene detection kit based on the RAA-TtrAgo detection method comprises the above-mentioned drug-resistant gene detection composition based on the RAA-TtrAgo detection method, and the drug-resistant gene detection kit is an aadA gene detection kit, a qacA gene detection kit, or an aadA gene and qacA gene detection kit.

[0037] The present invention also provides an application of the above-mentioned drug-resistant gene detection kit in drug-resistant gene detection.

[0038] The present invention also provides a method for detecting drug-resistant genes based on RAA-TtrAgo, comprising the following steps:

[0039] (1) RAA reaction:

[0040] Prepare the RAA reaction system and react the reaction system at 35-40°C for 10-20 minutes;

[0041] (2) TtrAgo reaction:

[0042] Prepare the TtrAgo reaction system, place the reaction system in a real-time PCR detector, and cycle 99 times at 93°C and once at 37°C.

[0043] Preferably, in step (1), the RAA reaction system comprises:

[0044] 20-30 μL buffer, 1-3 μL forward primer F, 1-3 μL reverse primer R, 2-3 μL magnesium acetate, 1-3 μL DNA template.

[0045] Preferably, in step (2), when the gene to be detected is the aadA gene, the TtrAgo reaction system comprises:

[0046] 2-4 μL buffer, 0.5-2 μL Mn2+ , 1~2μL gDNA2-1, 1~2μL gDNA2-2, 2~4μL probe, 5~8μL TtrAgo, 4~5.5μL DNA, 0~9.5μL H2O.

[0047] Preferably, in step (2), when the gene to be detected is the qacA gene, the TtrAgo reaction system comprises:

[0048] 2-4 μL buffer, 0.5-1 μL Mn 2+ , 1~2μL gDNA2-1, 1~2μL gDNA2-2, 2~4μL probe, 4~8.5μL TtrAgo, 3~4μL DNA, 0~11.5μL H2O.

[0049] The present invention also provides an application of the above-mentioned RAA-TtrAgo-based drug-resistant gene detection method in drug-resistant gene detection.

[0050] The beneficial effects of the present invention compared with the prior art are:

[0051] (1) The present invention combines recombinase-mediated isothermal nucleic acid amplification technology (RAA) with TtrAgo enzyme technology to develop a highly sensitive and accurate RAA-TtrAgo-based drug-resistant gene detection method. Among them, TtrAgo uses more stable DNA as a guide instead of RNA. This guide DNA (gDNA) is complementary to the target DNA sequence, thereby guiding TtrAgo to accurately locate a specific nucleic acid sequence. After recognizing the target DNA, TtrAgo will cut the target DNA between the 10th and 11th nucleotides at the corresponding position of the guide DNA. Its cutting efficiency and specificity are particularly outstanding at high temperatures (75°C to 95°C). This feature makes its detection in a high temperature environment more stable and efficient, and the detection sensitivity reaches the level of 10 copies / μL, which can detect extremely low concentrations of target nucleic acids. The optimal reaction conditions are also determined to ensure the stability and reliability of the detection system. Moreover, the present invention can perform fluorescence detection of the aadA gene (HEX fluorescence) and the qacA gene (FAM fluorescence) under a readily available ultraviolet lamp, and the results can be directly observed with the naked eye, eliminating dependence on professional equipment, improving detection efficiency, and achieving rapid detection (completed within 60 minutes), making the test results intuitive and easy to read. This conforms to the development trend of rapid, on-site detection, is suitable for detection systems with limited resources, and promotes the innovation and development of nucleic acid detection technology.

[0052] (2) The present invention develops a detection method for environmental samples that can quickly detect drug-resistant genes. The method is easy to operate and does not require complex equipment and professionals. It is suitable for rapid detection in on-site environments with limited resources and has the potential to be used in environmental testing. It can provide society with cleaner and safer environmental resources, enhance public health and safety protection capabilities, effectively prevent the outbreak of infectious diseases, and reduce social panic and economic losses. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0054] Figure 1 This is an operational flow chart of the RAA-TtrAgo-based drug-resistant gene detection method in Example 1 of the present invention;

[0055] Figure 2 Figure 1 is a diagram of wastewater DNA collection and extraction in Example 1 of the present invention, wherein A is a wastewater extraction kit; BD are diagrams of the wastewater collection process;

[0056] Figure 3 This is the pET-28a(+) plasmid map in Example 1 of the present invention;

[0057] Figure 4 This is an SDS-PAGE image of TtrAgo in Example 1 of the present invention;

[0058] Figure 5 Figure 1 is a primer screening result diagram in Example 1 of the present invention, wherein A is a 1.5% agarose gel electrophoresis diagram of aadA gene primers; B is a 1.5% agarose gel electrophoresis diagram of qacA gene primers; M is a DNA molecular weight standard;

[0059] Figure 6-1 : The gDNA screening result diagram in Example 1 of the present invention, wherein A is a fluorescence curve result diagram of the aadA gene screening optimal gDNA; B is a fluorescence curve result diagram of the qacA gene screening optimal gDNA; C is a fluorescence tube diagram of the optimal aadA gene gDNA screening under ultraviolet light detection; D is a fluorescence tube diagram of the optimal qacA gene gDNA screening under ultraviolet light detection; E is a fluorescence curve result diagram of the aadA gene thinning gDNA; F is a fluorescence curve result diagram of the qacA gene thinning gDNA; G is a fluorescence tube diagram of the thinning aadA gene gDNA under ultraviolet light detection; H is a fluorescence tube diagram of the thinning qacA gene gDNA under ultraviolet light detection;

[0060] Figure 6-2 Graphs showing the gDNA screening results in Example 1 of the present invention, wherein I is a 20% TBE-PAGE result graph of the aadA gene; J is a 20% TBE-PAGE result graph of the qacA gene;

[0061] Figure 7-1 Graph showing the optimization results of the RAA-TtrAgo detection system in Example 1 of the present invention, wherein A represents the results of different amounts of DNA in the aadA gene system; B represents the results of different amounts of TtrAgo in the aadA gene system; and C represents the results of different amounts of gDNA in the aadA gene system.

[0062] Figure 7-2 The optimization results of the RAA-TtrAgo detection system in Example 1 of the present invention are shown in FIG, wherein D is the result of different amounts of probes in the aadA gene system; E is the result of different amounts of Mn in the aadA gene system. 2+ F is the result of different amounts of DNA in the qacA gene system; G is the result of different amounts of TtrAgo in the qacA gene system; H is the result of different amounts of gDNA in the qacA gene system; I is the result of different amounts of probe in the qacA gene system; J is the result of different amounts of Mn in the qacA gene system 2+ the result;

[0063] Figure 8 Figure 1 is a sensitivity result diagram of RAA-TtrAgo in Example 1 of the present invention, wherein A is a diagram showing the RAA-TtrAgo reaction results of aadA plasmids at different concentrations; B is a diagram showing the RAA-TtrAgo reaction results of qacA plasmids at different concentrations; C is a fluorescence tube diagram of the aadA gene under ultraviolet light detection; D is a fluorescence tube diagram of the qacA gene under ultraviolet light detection;

[0064] Figure 9 These are the detection results of the aadA gene and qacA gene in Example 2 of the present invention, where A is a 1.5% agarose gel electrophoresis result of the aadA gene; B is a 1.5% agarose gel electrophoresis result of the qacA gene; C is a fluorescence intensity result of the environment A sample, M is a DNA molecular weight standard; and P is a positive sample. DETAILED DESCRIPTION

[0065] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0066] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0067] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0068] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0069] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0070] Example 1

[0071] Example 1 of the present invention provides a method for detecting drug-resistant genes based on RAA-TtrAgo ( Figure 1 ) The specific steps are as follows:

[0072] (1) Sample collection

[0073] A total of 30 environmental samples were collected in 2024, including 15 sewage samples collected from Chaozhou disease surveillance sentinel hospitals and 15 manually collected samples of lake water, river water, rainwater, and other domestic sewage. After identifying the detailed information of each sample, DNA was extracted from these 30 samples using a water sample DNA extraction kit and then stored in a -80°C ultra-low temperature freezer in the laboratory.

[0074] (2) Reagents and instruments

[0075] Water sample DNA extraction kit (Guangzhou Jiebei Biotechnology Co., Ltd.), His-tagged protein purification kit (denaturation-resistant formulation) (Shanghai Biyuntian Biotechnology Co., Ltd.), RAA nucleic acid amplification kit (electrophoresis method) (Jiangsu Qitian Gene Biotechnology Co., Ltd.), 1.5m centrifuge tubes and 0.2mL PCR thin-walled tubes (Shanghai Baisai Biotechnology Co., Ltd.), primers, gDNA and molecular beacons (Suzhou Jinweizhi Biotechnology Co., Ltd.), EP01-normal agarose gel 6× RNA / DNA loading buffer, EP03-50× TAE Buffer, EP06-GoldenView nucleic acid dye (Beijing Aidelai Biotechnology Co., Ltd.); LD DS2000 DNA Marker (Guangzhou Dongsheng Biotechnology Co., Ltd.).

[0076] ZQLY-180ES Oscillating Incubator (Shanghai Zhichu Instrument Co., Ltd.), KP-XW80 Vortex Mixer (Hybribio Biotechnology Co., Ltd.), LS-HD Series High-Pressure Steam Sterilizer (Guangzhou Yuete Scientific Instrument Co., Ltd.), LC-CJ-1FD Clean Bench (Shanghai Lichen Bangxi Instrument Technology Co., Ltd.), ETC 811 Gene Amplifier (Dongsheng Innovation Biotechnology Co., Ltd.), H1850R Desktop Refrigerated Centrifuge (Hunan Xiangyi Laboratory Instrument Development Co., Ltd.), Min1524 Desktop High-Speed ​​Centrifuge (Zhuhai Dark Horse Medical Instrument Co., Ltd.), Thermo Scientific TM Digital metal bath (Thermo Fisher Scientific), Tanon 2500 series fully automatic digital gel image analysis system (Shanghai Tianneng Technology Co., Ltd.), EPS-600 digital display constant voltage and constant current electrophoresis instrument, HE-220 high-throughput horizontal electrophoresis tank (Shanghai Tianneng Technology Co., Ltd.), TS-300T decolorization shaker (Hangzhou Miou Instrument Co., Ltd.), -80℃ ultra-low temperature refrigerator and biological safety cabinet (Qingdao Haier Biomedical Co., Ltd.).

[0077] (3) Oligonucleotide primers, gDNA and probe design

[0078] Since the aadA gene (GenBank: QID24729.1) and the qacA gene (ARO: 3003046) belong to two different resistance gene families: aminoglycoside resistance and disinfectant resistance, respectively, sequences of these two genes were downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov) and the Comprehensive Antibiotic Resistance Database (https: / / card.mcmaster.ca). Two sets of upstream and downstream primers, two pairs of gDNA, and HEX (hexachloro-6-methylfluorescein) / FAM (5 / 6-carboxyfluorescein)-labeled probes were designed for each gene. Primer, gDNA, and probe sequences were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The sequences are shown in Tables 1–3.

[0079] Table 1 PCR amplification primer sequences of aadA gene and qacA gene

[0080]

[0081] Table 2 aadA gene and qacA gene gDNA sequences

[0082]

[0083] Table 3 aadA gene and qacA gene fluorescent probe sequences

[0084]

[0085]

[0086] (4) DNA extraction

[0087] The DNA extraction kit of Guangzhou Jiebaisi Biotechnology Co., Ltd. was used to extract DNA from environmental samples (such as Figure 2). First, filter the water sample with a filter membrane to enrich the biological components. Next, add 0.4g glass beads, 1.2mL Buffer C1, and 50μL Buffer C2, and vortex for 3 minutes. Then add 250μL Buffer C3, vortex for 1 minute, and treat in a 70℃ water bath for 10 minutes. After shaking several times, centrifuge at 12000rpm for 1 minute. Take 1mL of the supernatant and transfer it to a 1.5mL centrifuge tube. Add 200μL Buffer C4 and mix well. Place on ice for 5 minutes, centrifuge again at 12000rpm for 1 minute, and transfer the supernatant to a 2.0mL centrifuge tube. Then add an equal volume of Buffer C5 and mix well. Take 750μL of the mixture and add it to the GBC adsorption column. Centrifuge at 12000rpm for 30 seconds, discard the filtrate, and repeat this step to treat the remaining mixture. Next, add 500μL of Buffer WB and 600μL of DNA Wash Buffer (anhydrous ethanol must be added before use), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid. Finally, centrifuge at 12,000 rpm for 2 minutes. Transfer the adsorption column to a clean centrifuge tube, add 75μL of sterile deionized water dropwise, and centrifuge at room temperature for 1 minute to elute the DNA. Collect the flow-through, which is the target DNA, and store it in a freezer at -80°C.

[0088] (5) Expression and purification of TtrAgo protein

[0089] The coding gene of TtrAgo was obtained by gene synthesis and then cloned into the pET-28a(+) plasmid ( Figure 3 ) to construct a recombinant plasmid. The recombinant plasmid was then transformed into Escherichia coli BL21(DE3) strain, and expression of the His-tag fusion protein was induced using 1 mM IPTG at 37°C. Following expression, the target protein was purified by Ni affinity chromatography on an AKTA Prime Plus system (GE Healthcare Life Sciences, Boston, MA). Finally, the purified protein was stored in storage buffer (20 mM Tris-HCl, pH 8.0, 300 mM NaCl, 0.5 mM MnCl, 15% (v / v) glycerol) and aliquoted and stored in a -80°C freezer until ready for use.

[0090] According to the steps of the His tag protein purification kit instructions, the supernatant of uninduced, induced, cleaved, washing solution, flow-through, elution 1 and elution 2 were taken for SDS-PAGE electrophoresis (see Figure 4 ). Figure 4 It can be seen that the obtained TtrAgo is in line with expectations, with a size of 87 KDa.

[0091] (6) Establishment of RAA amplification system

[0092] The total RAA reaction volume was 50 μL, consisting of 25 μL of buffer V, 2 μL of forward primer F, 2 μL of reverse primer R, 2.5 μL of magnesium acetate, 2 μL of DNA template, and 16.5 μL of nuclease-free water. ddH2O was used as a negative control. The reaction mixture was placed in a water bath at 39°C for 15 min. After the reaction, the results were analyzed by 1.5% agarose gel electrophoresis, visualized on a gel imaging system, and photographed for preservation.

[0093] (7) Construction of TtrAgo reaction system

[0094] The trAgo cleavage reaction system, totaling 25 μL, consisted of 2 μL 2× buffer, 1 μL MnCl₂ (40 μM), 2 μL gDNA2-1 (20 μM), 2 μL gDNA2-2 (20 μM), 1.3 μL probe (10 μM), 5 μL TtrAgo (10 μM), 4.5 μL DNA, and 7.2 μL nuclease-free water. The reaction was performed in a SLAN-96S real-time PCR detection system with 99 cycles at 93°C and one cycle at 37°C for a total of 25 minutes. Fluorescence signals were recorded every 30 seconds.

[0095] (8) Primer screening

[0096] Using the primers shown in Table 1, the RAA amplification system of step (6) was used to carry out the reaction respectively, and the best primers for aadA gene and qacA gene were screened by 1.5% agarose gel electrophoresis. The results are shown in FIG. Figure 5 shown.

[0097] Figure 5 The results showed that both primer pairs of aadA gene had product bands ( Figure 5 The F2R2 lane was brighter and about 278 bp in size. The amplified fragment was consistent with the theoretical length and no nonspecific amplification was found. The best primer for the qacA gene was F1R1 ( Figure 5 The optimal RAA primer combination for the aadA gene was determined to be F2R2, and the optimal RAA primer combination for the qacA gene was determined to be F1R1.

[0098] (9) Optimal gDNA screening

[0099] Using the gDNA shown in Table 2, the TtrAgo reaction system of step (7) was used to screen the best gDNA for the aadA gene and the qacA gene. The results are as follows: Figure 6-1 、 Figure 6-2 shown.

[0100] Figure 6-1The results showed that the best gDNA for aadA gene was gDNA2( Figure 6-1 A), the best gDNA for qacA gene is gDNA2( Figure 6-1 After the best gDNA was screened, the gDNA was further subdivided and the fluorescence intensity of gDNA2-1 (aadA gene), gDNA2-2 (aadA gene), gDNA2-1 (qacA gene) and gDNA2-2 (qacA gene) were compared simultaneously ( Figure 6-1 Zhong E and Figure 6-1 F), it was found that the fluorescence intensity was optimal when gDNA2-1 and gDNA2-2 were added at the same time. This finding was also detected by ultraviolet light ( Figure 6-1 C, D and Figure 6-1 G, H) and 20% TBE-PAGE ( Figure 6-2 I and J in Figure 6 were verified.

[0101] (10) Optimization of RAA-TtrAgo detection system

[0102] Refer to step (7) to control the single variable method and detect the DNA, TtrAgo, gDNA, probe and Mn in the TtrAgo enzyme digestion system respectively. 2+ The dosage was determined and the optimal dosage was determined. The results are shown in Figure 7.

[0103] Screening of the optimal detection system for aadA gene:

[0104] Different concentrations of DNA (0, 4, 5.5, 7 and 8.5 μL) were tested, and the highest enzyme digestion efficiency was obtained with 5.5 μL DNA ( Figure 7-1 Middle A).

[0105] Different concentrations of TtrAgo (0, 4, 5.5, 7, and 8.5 μL) were tested, and the results showed that 8.5 μL of TtrAgo produced the most effective results ( Figure 7-1 Middle B), considering economic benefits and reaction efficiency, the final choice was to add 7 μL of TtrAgo.

[0106] Different concentrations of gDNA (0, 1, 2, 3, 4, 8 μL) were tested, and it was found that the gDNA digestion efficiency was the best at 2 μL ( Figure 7-1 Middle C).

[0107] Different concentrations of probe (0, 1, 2, 3, and 4 μL) were tested, and it was found that the enzyme cleavage efficiency of 4 μL of probe was the highest (Figure 7-2D). Considering the economic benefits and reaction efficiency, the addition of 2 μL of probe was finally chosen.

[0108] Different concentrations of Mn were detected2+ (0, 0.5, 1, 2, 4 μL), the results showed that 0.5 μL of Mn 2+ Produced the most effective results ( Figure 7-2 In E), considering the reaction efficiency and consistency with the qacA gene reaction system, we finally chose to add 1 μL of Mn 2+ .

[0109] The optimal system for detecting aadA gene is: 2 μL buffer, 1 μL Mn 2+ , 1μL gDNA2-1, 1μLgDNA2-2, 2μLprobe, 7μL TtrAgo, 5.5μL DNA, 5.5μLH2O

[0110] The optimal detection system for the qacA gene was screened by referring to the optimal detection system screening steps for the aadA gene. The results are shown in FIG7F to J.

[0111] Figure 7-2 Figures F, G, H, I, and J show that the optimal detection system for the qacA gene includes: 3 μL DNA, 5.5 μL TtrAgo, 3 μL gDNA (gDNA2-1 + gDNA2-2 mixed in a 1:1 volume ratio), 4 μL probe, and 1 μL Mn. 2+ .

[0112] The optimal system for detecting the qacA gene is: 2 μL buffer, 1 μL Mn 2+ , 1.5μL gDNA2-1, 1.5μL gDNA2-2, 2μL probe, 5.5μL TtrAgo, 3μL DNA, 6.5μL H2O. (11)

[0114] The present invention constructs a standard plasmid containing a drug-resistant gene sequence for sensitivity testing of the RAA-TtrAgo detection system. Among them, aadA (792bp) was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and cloned into the pUC57 vector with ampicillin resistance of 2710bp to generate a recombinant plasmid (aadA); qacA (560bp) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and cloned into the pUC-GW-Kan vector with kanamycin resistance of 2626bp to generate a recombinant plasmid (qacA). The recombinant plasmid was subjected to a 10% initial concentration of 10 7 Then, according to the optimal reaction system and reaction conditions of step (10), a sensitivity experiment was performed ( Figure 8When the plasmid was diluted to a limit of 10 copies / μL, the fluorescence intensity value was still visible, indicating that the minimum detection limit of RAA-TtrAgo established in this study was 10 copies / μL, with high detection sensitivity.

[0115] Example 2

[0116] In Example 2 of the present invention, based on the optimal reaction system and reaction conditions of step (10) in Example 1, 30 environmental samples from hospital sewage and domestic sewage such as lake water, river water, and rainwater were tested. The results are as follows:

[0117] After identifying the detailed information of each sample, DNA was extracted from the above 30 samples using a water sample DNA extraction kit, and the aadA gene and qacA gene were detected ( Figure 9 C), and the plasmid was used as a positive standard, and the results were compared and verified with 1.5% agarose gel electrophoresis ( Figure 9 China A and Figure 9 The results showed that the qacA gene in environmental samples was unclear or absent on both 1.5% agarose gel electrophoresis and the RAA-TtrAgo detection system, likely due to the low qacA gene content in this batch of samples, which fell below the detection limit. The aadA gene was detected in 30 positive samples on 1.5% agarose gel electrophoresis, while the RAA-TtrAgo detection system detected 27 positive samples and 3 negative samples. The results of the RAA-TtrAgo detection system and 1.5% agarose gel electrophoresis were basically consistent, with a detection rate of 90% (27 / 30).

[0118] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A drug resistance gene detection composition based on the RAA-TtrAgo detection method, characterized in that: The drug-resistant gene detection composition includes a composition for detecting aadA gene, a composition for detecting qacA gene, or a composition for detecting aadA gene and qacA gene; The composition for detecting the aadA gene includes the following sequence: RAA upstream primer-SEQ ID NO.3: CTAAATGAAAACCTTAACGCTATGGAACTCGC; RAA downstream primer-SEQ ID NO.4: GTGATCTCGCCTTTCACGTAGTGGACAAAT gDNA2-1-SEQ ID NO.11: GGACAAATTCTTCCAA; gDNA2-2-SEQ ID NO.12: TCGCCTTTCACGTAGT; Probe - SEQ ID NO. 17: HEX-TTTCACGTAGTGGACAAATTCTTCCAACTGAT-BHQ1; The composition for detecting the qacA gene includes the following sequence: RAA upstream primer-SEQ ID NO.5: TACAGGTTGTGGAAGAACTTTCTCCTTTTA; RAA downstream primer-SEQ ID NO.6: GACCAAAGAAATACATAATAAACATGCCAAT; gDNA2-1-SEQ ID NO.15: AATAGGAGATATGGTG; gDNA2-2-SEQ ID NO.16: TTTGCACCAATTGCAC; Probe - SEQ ID NO. 18: FAM-TATGGCAATAGGAGATATGGTGTTTGCACCAAT-BHQ1. The composition for detecting aadA gene and qacA gene comprises: The above-mentioned composition for detecting aadA gene and the composition for detecting qacA gene.

2. Use of the drug-resistant gene detection composition based on the RAA-TtrAgo detection method as claimed in claim 1 in drug-resistant gene detection.

3. A drug resistance gene detection kit based on the RAA-TtrAgo detection method, characterized in that: The drug-resistant gene detection kit based on the RAA-TtrAgo detection method includes the drug-resistant gene detection composition based on the RAA-TtrAgo detection method according to claim 1, and the drug-resistant gene detection kit is an aadA gene detection kit, a qacA gene detection kit, or an aadA gene and qacA gene detection kit.

4. Use of the drug-resistant gene detection kit according to claim 3 in drug-resistant gene detection.

5. A method for detecting drug-resistant genes based on RAA-TtrAgo, characterized in that: The steps include: (1) RAA reaction: Prepare the RAA reaction system and react the reaction system at 35-40°C for 10-20 minutes; (2) TtrAgo reaction: Prepare the TtrAgo reaction system, place the reaction system in a real-time PCR instrument, and cycle 99 times at 93°C and once at 37°C.

6. The drug-resistant gene detection method based on RAA-TtrAgo according to claim 5, characterized in that: In step (1), the RAA reaction system comprises: 20-30 μL buffer, 1-3 μL forward primer F, 1-3 μL reverse primer R, 2-3 μL magnesium acetate, 1-3 μL DNA template.

7. The drug-resistant gene detection method based on RAA-TtrAgo according to claim 5, characterized in that: In step (2), when the gene to be detected is the aadA gene, the TtrAgo reaction system comprises: 2-4 μL buffer, 0.5-2 μL Mn 2+ , 1~2μL gDNA2-1, 1~2μL gDNA2-2, 2~4μL probe, 5~8μL TtrAgo, 4~5.5μL DNA, 0~9.5μL H2O.

8. The drug-resistant gene detection method based on RAA-TtrAgo according to claim 5, characterized in that: In step (2), when the gene to be detected is the qacA gene, the TtrAgo reaction system comprises: 2-4 μL buffer, 0.5-1 μL Mn 2+ , 1~2μL gDNA2-1, 1~2μL gDNA2-2, 2~4μL probe, 4~8.5μL TtrAgo, 3~4μL DNA, 0~11.5μL H2O.

9. Use of the RAA-TtrAgo-based drug-resistance gene detection method according to any one of claims 5 to 8 in drug-resistance gene detection.

Images