Primer pair for detecting resistance of colletotrichum gloeosporioides to QoIs bactericide as well as application and visualization method of primer pair

Abstract

The invention discloses a primer pair for detecting resistance of colletotrichum gloeosporioides to a QoIs (Quality of Experience) bactericide as well as application and a visualization method of the primer pair. The primer pair comprises a forward primer F: GGGCAAATGTCATATGAGC of which the nucleotide sequence is shown as SEQ ID NO. 1 in a sequence table, and a reverse primer R: GTTGGTATTACTCACCTGTTAG of which the nucleotide sequence is shown as SEQ ID NO. 2 in the sequence table. According to the visualization method for detecting the QoIs resistance of the colletotrichum gloeosporioides, provided by the invention, a major breakthrough is realized in detection efficiency. According to the detection method, the field sample can be detected within 3 hours, and the detection time is greatly shortened. Meanwhile, the magnetic bead visualization technology is combined, dependence on complex equipment such as a gel electrophoresis apparatus and a gel imager is avoided, operation can be achieved only through a PCR instrument, and the steps are simple and easy to operate. The convenience is especially suitable for basic plant protection stations, the detection threshold is greatly reduced, basic workers can rapidly master and carry out detection work, and development of field drug-resistant strain real-time monitoring work is powerfully promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of methoxyacrylate (QoIs) fungicide resistance, and in particular to a primer pair for detecting the resistance of Colletotrichum oleraceus to QoIs fungicides, and an application and visualization method thereof. Background Art

[0002] Caused by fruit-bearing anthracnose fungi ( Colletotrichum fructicola ) seriously restricts the improvement of peach quality and poses a major threat to the development of the peach industry. At the same time, the pathogen can also infect a variety of economic crops such as pear trees and tea trees, causing widespread damage. Although methoxyacrylate fungicides (QoIs) commonly used in chemical control can effectively control peach anthracnose, their single site of action and long-term use can cause pathogen resistance. The main reason is cytb The gene undergoes G143A or F129L mutations, with G143A being the main mutation site in drug-resistant strains. The emergence of drug-resistant strains further exacerbates the difficulty of prevention and control. Accurate detection of drug-resistant strains of fruit anthracnose in the field is the key to achieving precise pesticide application for peach anthracnose and ensuring the healthy development of the peach industry. Currently, conventional detection methods focus on measuring the inhibitory rate of different concentrations of pesticides on the mycelial growth of pathogens. 50 This method, however, has significant drawbacks. It requires culturing the pathogen on a drug-containing culture medium and determining growth inhibition through microscopic observation or manual measurement. The entire process takes 3-7 days. It is not only cumbersome and time-consuming, but also requires stringent laboratory cleanliness. Furthermore, the results are easily affected by subjective factors, making it difficult to meet the urgent demand for rapid and efficient testing in modern agricultural production. The emerging loop-mediated isothermal amplification (LAMP) technique, while not requiring a PCR instrument or gel electrophoresis, allows for visualization of results via the color change of the SYBR Green I dye. However, in practice, it is highly susceptible to aerosol contamination, frequently leading to false-positive results and significantly compromising the reliability of test results. Detection techniques based on allele-specific PCR (AS-PCR) offer both sensitivity and reliability. However, conventional gel electrophoresis is typically required after PCR amplification, which is not only time-consuming and labor-intensive but also requires skilled technicians and equipment such as gel electrophoresis instruments and gel imagers. Therefore, a simple, equipment-free, and visual detection method is needed. Summary of the Invention The main purpose of this invention is to provide a primer pair, application, and visualization method for detecting QoI-resistance in Colletotrichum oleraceus, with high sensitivity and reliability. This method can determine the presence of an amplification product based on the presence of a precipitate in the solution, without the need for gel electrophoresis, and thus determine whether the sample strain has developed resistance to QoI-type fungicides.

[0003] To achieve the above objectives, the present invention proposes a primer pair for detecting the resistance of fruit anthracnose to QoIs fungicide, wherein the primer pair includes a forward primer F: GGGCAAATGTCATTATGAGC, whose nucleotide sequence is shown in SEQ ID NO.1 in the sequence listing, and a reverse primer R: GTTGGTATTACTCACTCGTTAG, whose nucleotide sequence is shown in SEQ ID NO.2 in the sequence listing.

[0004] The present invention also provides a visualization method for detecting the QoIs resistance of fruit anthracnose fungi. During the detection process, the primer pair as described above is used in combination with magnetic beads and flocculation technology to visualize the results.

[0005] The present invention also provides a method for detecting the resistance of Colletotrichum oleraceus to QoIs fungicides using the primer pair described above, comprising the following steps: (1) Extract DNA from the strain to be tested; (2) Allele-specific PCR amplification was performed using the primer pair, and the amplified sequence in the resistant strain was shown as SEQ ID NO. 3; (3) Mix the amplified product with magnetic microbeads and incubate them to allow the DNA to bind to the magnetic beads; (4) After magnetic separation and washing, a flocculation solution is added; (5) Observe the formation of precipitation. If precipitation occurs, it is determined to be a QoIs-resistant strain.

[0006] Preferably, the rapid DNA extraction reagent for the strain to be tested is 10×TE buffer, which comprises: 100 mM Tris-HCl, 10 mM EDTA, pH=8.0.

[0007] Preferably, the AS-PCR reaction system is: 25 µL of 2×PCR Master Mix, 2 µL of 10 µM forward primer F, 2 µL of 10 µM reverse primer R, 2 µL of 100 ug / mL DNA template, and dd H2O to 50 µL.

[0008] Preferably, the AS-PCR reaction procedure is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 60 s, 35 cycles; final extension at 72°C for 10 min.

[0009] The present invention also provides a product for detecting the QoIs resistance of Colletotrichum oleraceus, comprising the primer pair described above.

[0010] Preferably, the product includes a kit and reagents.

[0011] Preferably, the kit further comprises PCR reaction system reagents.

[0012] The present invention also provides a use of the primer pair or the product described above in detecting the QoIs resistance of fruit anthracnose fungi.

[0013] Compared with the prior art, the present invention has the following beneficial effects: (1) The visualization method for detecting QoIs resistance of fruit anthracnose provided by the present invention has achieved a major breakthrough in detection efficiency. Compared with the traditional growth rate determination method, which requires a long detection cycle of 3 to 7 days, this method can complete the detection of field samples within 3 hours, greatly shortening the detection time. At the same time, it combines magnetic bead visualization technology, gets rid of the dependence on complex equipment such as gel electrophoresis instruments and gel imagers, and only requires a PCR instrument for operation, with simple and easy steps. This convenience is particularly suitable for grassroots plant protection stations, greatly reducing the detection threshold, enabling grassroots staff to quickly master and carry out detection work, and effectively promoting the development of real-time monitoring of drug-resistant strains in the field. (2) The specific primer pairs designed based on the molecular mechanism of QoI resistance provided by the present invention, combined with allele-specific PCR amplification reaction and magnetic bead detection, significantly improve the accuracy and sensitivity of detection. Compared with traditional PCR and LAMP methods that are prone to false positive results, this method can accurately determine whether the sample strain has developed resistance to QoIs fungicides, avoiding misjudgment. In addition, this method also has the advantage of high throughput and can detect multiple strains at the same time, effectively meeting the needs of modern agricultural production for rapid and efficient resistance detection, providing reliable technical support for the scientific use of QoI fungicides, helping to rationally plan drug use, reduce drug costs, and improve the economic benefits of the peach industry and related agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0015] Figure 1 The figure shows the gel electrophoresis pattern of AS-PCR amplification of DNA of 9 fruit anthracnose fungi using the specific primers F / R of the present invention, where M is a DNA electrophoresis molecular weight standard, Nos. 1-4 are QoIs-resistant strains, Nos. 5-9 are QoIs-sensitive strains, and No. 10 is a control using ddH2O as a template.

[0016] Figure 2 This is a validation of the specificity of the AS-PCR reaction for QoIs-resistant and sensitive strains of Colletotrichum oleraceus. The reaction results are based on the changes in precipitation after the addition of magnetic microbeads. Figures 1-4 are the results for QoIs-resistant strains, 5-9 are the results for QoIs-sensitive strains, and 10 is a control using ddH2O as a template.

[0017] Figure 3 The sensitivity test diagram of the AS-PCR and visualization method of the present invention is shown in FIG. The initial DNA concentration is 303 ng / µL, and the DNA sample is serially diluted (10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 W is a control in which ddH2O is used as a template.

[0018] Figure 4 This is a simulated field detection diagram of the AS-PCR and visualization method of the present invention. W is a control for ddH2O as a template.

[0019] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. If specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. If the reagents or instruments used are not specified by the manufacturer, they are all conventional products that can be purchased commercially. In addition, the technical solutions between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in this field to achieve. When the combination of technical solutions is mutually contradictory or cannot be achieved, it should be considered that the combination of such technical solutions does not exist and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0021] The technical solutions of the present invention are further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0022] Example 1 Synthesis and specificity identification of primers 1. Experimental Materials PDA medium: 200 g / L potato, 20 g / L glucose, 12 g / L agar, and the balance water.

[0023] 2. DNA Extraction (1) Nine known fruit anthracnose strains were inoculated onto PDA medium and cultured in a 26°C incubator. After 4 days, the strains were removed from the incubator and the mycelium was collected.

[0024] (2) Take a 1.5 mL centrifuge tube and add 500 µL of DNA extraction buffer (1 M KCl, 100 mM Tris-HCl, 10 mM EDTA).

[0025] (3) Pick soybean-sized hyphae and place them in a 1.5 mL centrifuge tube filled with DNA extraction buffer. Add a small steel ball and place the tube in a cell disruptor for disruption. After disruption, place the tube in a centrifuge at 12,000 rpm for 10 minutes.

[0026] (4) After centrifugation, 300 μL of the supernatant was transferred to a new 1.5 mL centrifuge tube. 300 μL of isopropanol was added and the tube was shaken until white flocs appeared. The tube was then centrifuged at 12,000 rpm for 10 min.

[0027] (5) Discard the supernatant, add 800 μL of 70% ethanol, shake to mix, and centrifuge at 12,000 rpm for 10 minutes.

[0028] (6) After centrifugation, discard the supernatant and place the 1.5 mL centrifuge tube open at room temperature. After the residual ethanol has evaporated, add 35 µL of sterile water to dissolve the DNA. After measuring the DNA concentration, store in a -20°C refrigerator until ready for use.

[0029] (7) The extracted DNA can be directly used for allele-specific PCR (AS-PCR) amplification.

[0030] 3. Primer Synthesis The identified anthracnose-resistant and anthracnose-sensitive peach materials were sequenced, and the G143A mutation site was analyzed by sequence comparison. A pair of specific primers was designed to ensure that the first base at the 3' end of the forward primer completely matched the mutation site. This primer pair can accurately amplify the G143A point mutation gene fragment related to QoIs resistance in anthracnose fungi.

[0031] The primer sequences are as follows: Forward primer F (SEQ ID NO. 1): GGGCA AATGTCATTATGAGC; Reverse primer R (SEQ ID NO. 2): GTTGGTATTACTCACTCGTTAG; The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd. according to the above sequences.

[0032] 4. PCR Reaction PCR reaction system 50 µL: 2× PCR Master Mix 25 µL, 10 µM forward primer F 2 µL, 10 µM reverse primer R 2 µL, 100 ug / mL DNA template 2 µL, and dd H2O to 50 µL.

[0033] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 60 s; and post-extension at 72°C for 10 min.

[0034] The PCR products were electrophoresed in a 1.5% agarose gel (containing 0.05% GoldenView nucleic acid dye, Adelaide Biotechnology) (120 V, 20 min), and the electrophoresis results were observed using a gel imaging system. Figure 1 As shown in the figure, the four QoIs-resistant strains showed the target band at 1000 bp after AS-PCR amplification with specific primers F / R, while the five QoIs-sensitive strains and the control with ddH2O as the template did not show the band.

[0035] Example 2 Establishment of visualization method The DNA of the resistant and sensitive strains obtained in Example 1 was amplified by AS-PCR using the primers and method of Example 1 (the amplified sequence in the resistant strain is shown in SEQ ID NO. 3). After amplification, magnetic microbeads and a flocculation solution were added to the amplified product. The specific steps of the visualization method for detecting the amplified product include: (1) Add 1.5-1.8 times the volume of magnetic microbeads (Hieff NGS DNA SelectionBeads, YEASEN) to the PCR product and mix thoroughly. Incubate at room temperature for 10 min to allow the DNA to bind to the magnetic beads. (2) Place the sample on a magnetic rack and carefully remove the supernatant after the solution has clarified. (3) Keep the sample on the magnetic stand, add 200 μl of 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, carefully remove the supernatant, and repeat this step twice; (4) Add 30 µl of flocculation solution (100 mM sodium acetate, pH 4.4, 1% v / v Tween 20) to the magnetic microbeads and flick the beads to mix.

[0036] SEQ ID NO. 3: The results are as follows Figure 2 As shown, PCR amplification products using four QoI-resistant strains as templates showed precipitation after the bridge flocculation test, confirming the generation of amplified fragments. However, precipitation did not occur with the five QoI-sensitive strains and the ddHO control, indicating the absence of amplified fragments. This result is consistent with the electrophoresis gel results, validating the accuracy of the present method for detecting amplified products.

[0037] Example 3 Visualization method sensitivity detection To evaluate the sensitivity of the AS-PCR detection method and visualization method, the initial concentration of genomic DNA of the resistant strain was 303 ng / µL, and the DNA samples were serially diluted (10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 ), was used as a template for AS-PCR and detected by gel electrophoresis and visualization. The electrophoresis results showed that ( Figure 3 A), the AS-PCR system established in this study can amplify at least 10 -4 Gradient (30.3 pg / µL) pathogen DNA sample. Moreover, the visualization method results are consistent with the electrophoresis results ( Figure 3 B).

[0038] The above results show that the detection system established by the present invention has good sensitivity, fully meets the needs of production practice, and can theoretically effectively detect low-abundance resistant strains in the early infection stage.

[0039] Example 4 Visualization Method Simulating Field Detection In order to simulate the field detection, the resistant strain (R) and the sensitive strain (S) were inoculated on the surface of peach fruit by simulating the field disease conditions indoors and cultured under suitable temperature conditions for 5 days ( Figure 4 A). After lesions form, mycelial tissue at the lesion junction is scraped and placed in a centrifuge tube containing 50 µL of 10× TE buffer (100 mM Tris-HCl, 10 mM EDTA, pH 8.0). The sample is placed in a boiling water bath for 2 minutes and then cooled naturally to room temperature. The resulting supernatant is the crude DNA extract. 2 µL of the crude DNA extract is used as a template for AS-PCR amplification. Electrophoresis analysis shows that the resistant strain samples all amplify a specific band of approximately 1000 bp, while the sensitive strain does not amplify the product ( Figure 4 B). Visualization was also used to detect that the resistant strain sample showed obvious precipitation, while the sensitive strain sample did not. The visualization results were consistent with the gel electrophoresis results ( Figure 4 C).

[0040] The above results prove that this method is applicable to the detection of diseased peaches in the field. The primers in Example 1 of the present invention can effectively distinguish whether the fruit anthracnose fungus on peach fruits is resistant to the QoIs fungicide. The visualization method does not require a gel electrophoresis instrument and gel imaging equipment and is more convenient. It has the characteristics of reliability, sensitivity and convenience.

[0041] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of the present invention.

Claims

1. A primer pair for detecting the resistance of Colletotrichum fuscae to a QoIs fungicide, characterized in that: The primer pair includes a forward primer F: GGGCAAATGTCATTATGAGC, whose nucleotide sequence is shown in SEQ ID NO. 1 in the sequence table, and a reverse primer R: GTTGGTATTACTCACTCGTTAG, whose nucleotide sequence is shown in SEQ ID NO. 2 in the sequence table.

2. A visualization method for detecting QoIs resistance of fruit anthracnose fungi, characterized in that: The detection process uses the primer pair as described in claim 1, combined with magnetic beads and flocculation technology, and the results are visualized.

3. A method for detecting the resistance of Colletotrichum fuscae to QoIs fungicides using the primer pair according to claim 1, characterized in that: The following steps are involved: (1) Extract DNA from the strain to be tested; (2) performing allele-specific PCR amplification using the primer pair, and the amplified sequence in the resistant strain is shown in SEQ ID NO. 3; (3) Mix the amplified product with magnetic microbeads and incubate them to allow the DNA to bind to the magnetic beads; (4) After magnetic separation and washing, a flocculation solution is added; (5) Observe the formation of precipitation. If precipitation occurs, it is determined to be a QoIs-resistant strain.

4. The method according to claim 3, characterized in that The rapid DNA extraction reagent for the strain to be tested is 10×TE buffer, which includes: 100 mM Tris-HCl, 10 mM EDTA, pH=8.

0.

5. The method according to claim 3, characterized in that The AS-PCR reaction system was as follows: 25 µL of 2×PCR MasterMix, 2 µL of 10 µM forward primer F, 2 µL of 10 µM reverse primer R, 2 µL of 100 ug / mL DNA template, and ddH2O added to 50 µL.

6. The method according to claim 3, characterized in that The AS-PCR reaction procedure was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 60 s, for 35 cycles; and final extension at 72°C for 10 min.

7. A product for detecting the QoIs resistance of fruit anthracnose fungi, characterized in that: Comprising the primer pair as claimed in claim 1.

8. The product according to claim 7, characterized in that The products include test kits and reagents.

9. The product according to claim 8, characterized in that The kit also includes PCR reaction system reagents.

10. Use of the primer pair according to claim 1 or the product according to any one of claims 7 to 9 in detecting QoIs resistance of Colletotrichum fuscae.

Images