Use of clu gene in preparation of product for treating keloid
By promoting CLU gene overexpression or detecting CLU gene expression, and utilizing CLU gene recombinant vectors or liposome complexes, we can regulate keloid cell apoptosis and proliferation, thus solving the existing challenges in keloid treatment and achieving effective prediction and treatment results.
Patent Information
- Application Number
- CN202510867953.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-26
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2045-06-26
AI Technical Summary
Existing treatments for keloids are insufficient to completely eradicate the underlying cause, leading to high susceptibility to infection and recurrence, and a lack of effective diagnostic and therapeutic targets.
By promoting CLU gene overexpression or detecting CLU gene expression, and utilizing CLU gene recombinant vectors or liposome complexes, products for treating keloids can be prepared to regulate cell apoptosis and proliferation and inhibit scar tissue activity.
It provides new targets for predicting keloid risk, diagnosis, and treatment, significantly inhibiting scar tissue cell activity and apoptosis, and improving treatment efficacy.
Smart Images

Figure CN120695159B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of a CLU gene in preparation of a product for treating keloids. BACKGROUND
[0002] Keloid is a common skin disease characterized by the formation of pathological scars after skin injury healing. The etiology of keloid involves abnormal cell proliferation in scar tissue, significant hyperplasia of connective tissue, and subsequent collagen denaturation. Keloids usually exhibit an expanding growth pattern, extending beyond the original wound site, and showing resistance to natural regression. Clinically, keloids appear as raised red or purple scars, hard in texture, irregular in shape, and often accompanied by itching or other discomforts. The clinical management of keloids usually involves a comprehensive strategy combining various modalities, such as local steroid injection, laser treatment for collagen degradation, and cryotherapy to induce necrosis of keloid tissue. Despite various methods for treating keloids, the elusive etiology of keloids hinders complete eradication of the lesions, thereby increasing susceptibility to infection and recurrence.
[0003] A highly conserved glycoprotein known as clusterin (CLU) has multiple isoform-specific functions and exists in various species. CLU is involved in cancer progression by regulating key physiological processes, including apoptosis, metastasis, invasion, proliferation, and cell growth. However, whether CLU can serve as a target for keloid diagnosis or treatment has not been reported. SUMMARY
[0004] In view of this, the purpose of the present application is to provide application of a CLU gene in preparation of a product for treating keloids.
[0005] To achieve the above-mentioned purpose of the application, the present application provides the following technical solutions.
[0006] The present application provides application of a CLU gene in preparation of a product for treating keloids.
[0007] The present application provides application of a reagent for promoting overexpression of a CLU gene in preparation of a product for treating keloids.
[0008] Preferably, the reagent for promoting overexpression of a CLU gene comprises a recombinant vector for overexpressing a CLU gene or a liposome complex for overexpressing a CLU.
[0009] Preferably, the liposome complex for overexpressing a CLU is obtained by mixing a recombinant vector for overexpressing a CLU gene with a lipofectamine 3000 reagent.
[0010] The application provides application of a reagent for detecting expression of a CLU gene in preparation of a product for predicting a risk of suffering from keloid.
[0011] The application provides application of the reagent for detecting expression of the CLU gene in screening of a drug for treating keloid.
[0012] The application provides application of the reagent for detecting expression of the CLU gene in preparation of a product for evaluating a therapeutic effect of a drug on keloid.
[0013] Preferably, the reagent for detecting expression of the CLU gene comprises a CLU primer pair or a CLU antibody.
[0014] Preferably, sequences of the CLU primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4.
[0015] The application provides a drug for treating keloid, which comprises the reagent for promoting overexpression of the CLU gene and a pharmaceutically acceptable excipient.
[0016] Compared with the prior art, the application has the following beneficial effects:
[0017] The application provides application of a CLU gene in preparation of a product for treating keloid. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 Comparison results of expression of CLU, a pro-apoptotic gene BAX and an anti-apoptotic gene BCL2 in keloid tissues and healthy skin tissues;
[0019] Figure 2 Comparison results of expression of CLU, a pro-apoptotic gene BAX and an anti-apoptotic gene BCL2 in each primary fibroblast in a keloid group and a normal group;
[0020] Figure 3 Detection of expression of CLU in keloid tissues and healthy skin tissues by immunohistochemical technology;
[0021] Figure 4 Cell activity detection results of primary fibroblasts derived from keloid and overexpressing CLU by MTT technology;
[0022] Figure 5 The apoptosis detection result of the primary fibroblasts from the keloid after the overexpression of CLU detected by the TUNEL technology;
[0023] Figure 6 The cell activity detection result of the primary fibroblasts from the keloid after the knockdown of CLU detected by the MTT technology;
[0024] Figure 7 The apoptosis detection result of the primary fibroblasts from the keloid after the knockdown of CLU detected by the TUNEL technology. DETAILED DESCRIPTION
[0025] The application provides application of a CLU gene in preparation of a product for treating keloids.
[0026] The application provides application of a reagent for promoting overexpression of a CLU gene in preparation of a product for treating keloids.
[0027] In the application, the sequence of the CLU gene has a registration number of NM_001831.4 in the NCBI database. The product comprises a reagent or a drug. The reagent for promoting overexpression of the CLU gene comprises an overexpression CLU gene recombinant vector or an overexpression CLU liposome complex. The backbone vector of the overexpression CLU gene recombinant vector is preferably pcDNA3.1+. The preparation method of the overexpression CLU gene recombinant vector comprises connecting a CLU gene with a nucleotide sequence as shown in SEQ ID NO. 9 to pcDNA3.1+. The overexpression CLU liposome complex is obtained by mixing the overexpression CLU gene recombinant vector with lipofectamine 3000 reagent, the overexpression CLU gene recombinant vector is a recombinant vector diluted with Opti-MEM medium, the mass / volume ratio of the overexpression CLU gene recombinant vector to the Opti-MEM medium is 1 μg: 500 μL; the lipofectamine 3000 reagent is a lipofectamine 3000 solution diluted with Opti-MEM medium, the volume ratio of the lipofectamine 3000 reagent to the Opti-MEM medium is 1 μL: 500 μL; and the mass / volume ratio of the diluted recombinant vector to the diluted lipofectamine 3000 solution is 1 μg: (0.5-2) μL, more preferably 1 μg: 1 μL.
[0028] In the application, by promoting overexpression of the CLU gene, the activity and apoptosis of primary fibroblasts in scar tissue can be significantly inhibited, so that the scar tissue can be effectively treated.
[0029] The application provides application of a reagent for detecting expression of a CLU gene in preparation of a product for predicting a risk of suffering from keloids.
[0030] The application provides application of a reagent for detecting expression of a CLU gene in screening of a drug for treating keloids.
[0031] The application provides application of a reagent for detecting expression of a CLU gene in preparation of a product for evaluating a therapeutic effect of a drug on keloids.
[0032] In the application, the reagent for detecting expression of the CLU gene comprises a CLU primer pair or a CLU antibody. The sequence of the CLU primer pair is shown in SEQ ID NO. 3-4. The CLU antibody can be 12289-1-AP of Proteintech or an enzyme-linked immunosorbent assay (ELISA) kit purchased from Jiangsu Liancheng Biotechnology Co., Ltd.
[0033] The application provides a drug for treating keloids, which comprises the reagent for promoting overexpression of the CLU gene and a pharmaceutically acceptable excipient.
[0034] In the application, the reagent for promoting overexpression of the CLU gene can be the only active ingredient, or can be combined with other active drugs for preventing and / or treating keloids. The excipient comprises a lentivirus, an adenovirus, an adeno-associated virus or a lipofectamine 3000 reagent. The drug is administered in a manner of oral administration or injection; the injection administration manner is preferably selected from intravenous injection, intramuscular injection, intracoronary injection and cardiac injection, so as to achieve the purpose of preventing and / or treating keloids. The reagent for promoting overexpression of the CLU gene comprises the above-mentioned overexpression CLU gene recombinant vector or overexpression CLU liposome complex.
[0035] In the application, all raw material components are commercially available goods well known to those skilled in the art, unless otherwise specified.
[0036] The technical solutions provided by the application will be described in detail below in combination with embodiments, but they should not be understood as limiting the scope of protection of the application.
[0037] Example 1
[0038] 1.1 CLU in keloid tissue has a significant effect on proliferation and apoptosis of primary fibroblasts
[0039] 1.1.1 The experiment is divided into a keloid group (Keloid) and a normal group (Control). The keloid group is the scar tissue of patients diagnosed with keloids, and the normal group is the skin tissue of healthy people. The expression of CLU, pro-apoptotic gene BAX and anti-apoptotic gene BCL2 in the keloid group and the normal group is detected by qRT-PCR method respectively.
[0040] 1.1.2 The experiment is divided into a keloid group (Keloid) and a normal group (Control). The keloid group is the primary fibroblasts extracted from the scar tissue of patients diagnosed with keloids, and the normal group is the primary fibroblasts extracted from the skin tissue of healthy people. The expression of CLU, pro-apoptotic gene BAX and anti-apoptotic gene BCL2 in each primary fibroblast in the keloid group and the normal group is detected by qRT-PCR method respectively.
[0041] Among them, the preparation method of primary fibroblasts: after obtaining the keloid tissue or normal skin tissue, after removing the epidermis and subcutaneous fat, cut into 10mm×10mm square tissue, add 1μL type I collagenase (purchased from Shanghai Yuan Ye Biotechnology Co., Ltd., product number S10053), place in a 37℃ shaking bed for 3h, centrifuge to remove the supernatant, add DMEM high-sugar culture medium (purchased from Gibco, Thermo Fisher Scientific) containing 10% fetal bovine serum (Every Green, purchased from Zhejiang Tianhang Biotechnology Co., Ltd.), place in a 37℃, 5% CO2 incubator, replace the culture medium every 2 days, when the cell confluence reaches more than 80%, obtain the primary fibroblasts derived from the skin of keloid patients or the primary fibroblasts derived from the skin of normal people respectively.
[0042] The primary fibroblasts derived from the skin of keloid patients or the primary fibroblasts derived from the skin of normal people are passaged using trypsin (purchased from Gibco, Thermo Fisher Scientific), and generally not more than 7 generations.
[0043] Total RNA extraction from tissue or cells and qRT-PCR gene detection:
[0044] Total RNA in each primary fibroblast or tissue is extracted using Trizol reagent from Invitrogen company, and cDNA first strand synthesis is performed using reverse transcription kit from Roche company. SYBR Green Supermix from Roche company is used for gene expression analysis, and the instrument is iQ5 Multicolor Real-Time PCR Detection System from Bio-Rad company. The analysis result adopts 2 -△△CtmRNA levels were calculated. The level of mRNA was calibrated with GAPDH housekeeping gene. The primer sequences used were as follows: (all primer directions are 5'-3')
[0045] GAPDH forward primer: GTCTCCTCTGACTTCAACA (SEQ ID NO. 1);
[0046] GAPDH reverse primer: CTCTTCCTCTTGTGCTCTT (SEQ ID NO. 2);
[0047] CLU forward primer: TTCGTTCATTAACATTCTCTGAT (SEQ ID NO. 3);
[0048] CLU reverse primer: CTGACTTTACTCTGAATTTCCTT (SEQ ID NO. 4);
[0049] BAX forward primer: CTCACCATCTGGAAGAAGA (SEQ ID NO. 5);
[0050] BAX reverse primer: TCCCGAAGGAGGTTTATTAC (SEQ ID NO. 6);
[0051] BCL2a forward primer: TTAAGAGGTGGCTGATATTCT (SEQ ID NO. 7);
[0052] BCL2a reverse primer: GGAAAGTTTAATGGCAATGTG (SEQ ID NO. 8).
[0053] Figure 1 The results show that, compared with the normal group, the expression of CLU and the apoptosis marker gene BAX in the keloid tissue of the keloid group decreased, and the expression of BCL2 increased, indicating that the proliferation of the keloid tissue may be negatively correlated with the expression of CLU.
[0054] Figure 2 The results show that, compared with the normal group, the expression of CLU and the apoptosis marker gene BAX in the primary fibroblasts of the keloid group decreased, and the expression of BCL2 increased, indicating that the proliferation of the primary fibroblasts may be negatively correlated with the expression of CLU.
[0055] 1.1.3 Immunohistochemical detection and analysis of tissue sections
[0056] For immunohistochemistry (IHC) analysis, keloid tissue (keloid group, denoted as Keloid) and normal skin tissue (normal group, denoted as Control) were obtained from the Rujian People's Hospital on January 10-20, 2025. The samples were fixed in 4% paraformaldehyde and then embedded in paraffin. 4-μm-thick sections were prepared from formalin-fixed, paraffin-embedded tissue. According to the standard protocol, these sections were deparaffinated and rehydrated. Antigen retrieval was performed by heating the slides in citrate buffer (pH 6.0) at 95°C for 20 min. The first antibody for CLU (1:1200 dilution, 12289-1-AP from Proteintech) was applied and incubated at room temperature for 15 min. After washing with phosphate-buffered saline (PBS), the slides were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody at room temperature for 1 h. Immunoreactivity was observed using 3,3'-diaminobenzidine (DAB) as a chromogenic agent, followed by hematoxylin counterstaining. The slides were then counterstained with hematoxylin, dehydrated, and covered with a coverslip for further analysis. Imaging was achieved using a Nikon A1R HD25 confocal microscope.
[0057] Figure 3 The results show that the expression level of CLU in keloid tissue is down-regulated compared with the normal group.
[0058] In summary, the change in the expression amount of CLU can be used for the diagnosis and / or treatment of keloid.
[0059] Example 2
[0060] Application of CLU in the preparation of a drug for treating keloid
[0061] This example uses the primary fibroblasts prepared in section 1.1.2 of Example 1 from the skin of keloid patients or extracted from the skin tissue of healthy people.
[0062] 2.1 Effect of overexpression of CLU on keloid
[0063] The experiment is divided into a control group and a treatment group, wherein the cells containing pcDNA3.1+ empty plasmid are used as the control group (denoted as Keloid), and the cells containing the pcDNA3.1+-CLU overexpression plasmid are used as the treatment group (denoted as Ke-CLU);
[0064] The preparation of the pcDNA3.1+-CLU overexpression plasmid is to connect the CLU gene with the nucleotide sequence as shown in SEQ ID NO. 9 to the Nhel and Xhol enzyme cutting sites of pcDNA3.1+ to obtain the pcDNA3.1+-CLU overexpression plasmid. It is detected that the pcDNA3.1+-CLU overexpression plasmid successfully overexpresses CLU. The pcDNA3.1+-CLU overexpression plasmid is entrusted to Shanghai Qilong Biological Technology Co., Ltd. for synthesis.
[0065] The nucleotide sequence of the CLU gene is as follows:
[0066] atgatgaagactctgctgctgtttgtggggctgctgctgacctgggagagtgggcaggtcctgggggaccagacg
[0067] gtctcagacaatgagctccaggaaatgtccaatcagggaagtaagtacgtcaataaggaaattcaaaatgctgtcaacgg
[0068] ggtgaaacagataaagactctcatagaaaaaacaaacgaagagcgcaagacactgctcagcaacctagaagaagccaa
[0069] gaagaagaaagaggatgccctaaatgagaccagggaatcagagacaaagctgaaggagctcccaggagtgtgcaatg
[0070] agaccatgatggccctctgggaagagtgtaagccctgcctgaaacagacctgcatgaagttctacgcacgcgtctgcaga
[0071] agtggctcaggcctggttggccgccagcttgaggagttcctgaaccagagctcgcccttctacttctggatgaatggtgac
[0072] cgcatcgactccctgctggagaacgaccggcagcagacgcacatgctggatgtcatgcaggaccacttcagccgcgcgt
[0073] CCTGCTGGAGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCC GGAGCTGCTGCTGGAGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGT GTCCC
[0074] TGCCCCACC GGGGCCTC ACTTCTTCTTTCCCAAGTCCC GATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTG
[0075] AAGTCCACGCCATGTTCAGCCCTTCCTTGAGATGATACACGAGGCTCAGCAGGC CATGGACATCCACTTCCATAGCCC
[0076] GCCTTCCAGCACCCGCAACAGAATTCA TACGAGAAGGCACGATGACC GGACTGTGTGCCGGGAGATCCGCCACAAC
[0077] CCACGGGCTGCCTGC GGATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTT GTCTGTGGACTGTTCCACCAACAACCCC
[0078] TCCCAGGCTAAGCTGC GGC GGA GCTCGACGAA TCCCTCCAGGTCGCTGAGAGGTTGACCAGGA AATCAACGAGCTG
[0079] CTAAAGTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCC GG
[0080] CTGGCAAACCTCACGCAAGGC GAAGACCAGTACTATCTGC GGGTCACCA CGGTGGCTTCCCACACTTCTGACTC GGACGT
[0081] TCCTTCCGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCC ATC ACTGTGACGGTCCCTG TAGAAGTCTCCAGGA
[0082] agaaccctaaatttatggagaccgtggcggagaaagcgctgcaggaataccgcaaaaagcaccgggaggagtga (S
[0083] EQ ID NO.9).
[0084] The preparation method of the cells containing pcDNA3.1+ empty plasmid or the cells containing pcDNA3.1+-CLU overexpression plasmid is as follows:
[0085] The primary fibroblasts from the scarred patient's skin prepared in section 1.1.2 of Example 1 were seeded into a 96-well plate at a density of 8000 cells per well, and after reaching 70% confluence, transfection was started. 3 mL of Opti-MEM medium was mixed with 6 μL of lipofectamine 3000 liquid, stirred uniformly, and diluted lipofectamine 3000 liquid was obtained. 3 mL of Opti-MEM medium was mixed with 6 μg of pcDNA3.1+ plasmid or pcDNA3.1+-CLU overexpression plasmid, respectively, to prepare pcDNA3.1+ premix or pcDNA3.1+-CLU premix, respectively. 1 μg of pcDNA3.1+ premix or 1 μg of pcDNA3.1+-CLU premix was added to 1 μL of diluted lipofectamine 3000 liquid, respectively, and incubated at room temperature for 20 min to obtain pcDNA3.1+-liposome complex or pcDNA3.1+-CLU-liposome complex. Then, the pcDNA3.1+-liposome complex or the pcDNA3.1+-CLU-liposome complex was added to the primary fibroblasts from the scarred patient's skin, respectively, and finally, the cells were incubated in a 37°C cell incubator to obtain cells containing pcDNA3.1+ empty plasmid or cells containing pcDNA3.1+-CLU overexpression plasmid. Then, cell viability or apoptosis experiment was performed for detection, and in the apoptosis experiment detection, no plasmid was added as a blank control group (control). Each group had three biological replicates.
[0086] Cell viability detection: After incubating the cells in the above 37°C cell incubator for 24 h or 48 h, the culture medium was removed from the cells containing pcDNA3.1+ empty plasmid or the cells containing pcDNA3.1+-CLU overexpression plasmid at each time point, respectively, and 100 μL of MTT solution (the volume ratio of MTT to culture medium in the MTT solution was 1:9) was added. Then, each cell was cultured in a 37°C incubator for another 4 hours, and then 100 μL of 20% SDS solution was added to each well. After 20 hours of incubation, the absorbance at 570 nm was measured using a microplate reader.
[0087] Apoptosis experiment detection:
[0088] This embodiment uses Tunel apoptosis kit to detect apoptosis on flow cytometry. TUNEL Bright Red Apoptosis Detection Kit-A113 is purchased from Vazyme Biotechnology Co., Ltd. in Nanjing, China. After incubating the cells in the above-mentioned 37°C cell incubator for 24h, the normal human skin-derived primary fibroblasts (Control), the cells containing pcDNA3.1+ empty plasmid (Keloid), or the cells containing pcDNA3.1+-CLU overexpression plasmid (Ke-CLU) are evenly inoculated onto PLL-coated 24-well glass slides, respectively, fixed with 4% paraformaldehyde, washed with PBS twice, treated with 20μg / mL proteinase K solution, and incubated at room temperature for 5min. Then the cells are washed with PBS three times, and then equilibrated with TdT buffer. Subsequently, the cells are washed with PBS twice, and incubated with 1μg / mL PI solution at room temperature for 5min. After washing with PBS three times, 100μL of glycerol is added to the cell area to maintain moisture, and the fluorescence intensity change of the sample is analyzed immediately under a fluorescence microscope.
[0089] Figure 4 The results show that, after incubation in a 37°C cell incubator for 24h or 48h, the viability of the cells overexpressing CLU (Ke-CLU) is significantly decreased compared with the control group (Keloid).
[0090] Figure 5 The results show that, compared with the control group (Keloid), the apoptosis of the cells overexpressing CLU (Ke-CLU) is increased.
[0091] 2.2 Effect of knocking down CLU expression on keloid
[0092] The normal human skin-derived primary fibroblasts are used as the blank control group (Control), the CLU-scramble cells are denoted as Keloid, and the CLU-knocking-down cells are the experimental group (Nor-siCLU).
[0093] Among them, siRNA is used to knock down CLU in primary fibroblasts derived from the skin of keloid patients, and the nucleic acid sequence of the siRNA for knocking down CLU is as follows:
[0094] ACAAUUAUGAUCACUUAAGCA (SEQ ID NO. 10).
[0095] Preparation method of the knockdown CLU cell: the primary fibroblasts from the scarred skin of the patient prepared in section 1.1.2 of Example 1 were seeded into a 96-well plate at a density of 8000 cells per well, and after reaching 70% confluence, transfection was started. 3 mL of Opti-MEM medium was mixed with 6 μL of lipofectamine RNAiMAX liquid, and after stirring, a diluted lipofectamine RNAiMAX solution was obtained. 3 mL of Opti-MEM medium was mixed with 6 μg of siRNA for knocking down CLU to obtain a diluted siRNA solution. 1 μg of the diluted siRNA solution was added to 2 μL of the diluted lipofectamine RNAiMAX solution, and after incubation at room temperature for 20 min, the siRNA-liposome complex obtained was added to the primary fibroblasts, and finally, the cells were incubated in a 37°C cell incubator.
[0096] wherein the siRNA for knocking down CLU was scrambled in order, and the sequence of the knockdown CLU cell was not obtained as a negative siRNA, and the siRNA for knocking down CLU in the preparation method of the knockdown CLU cell was replaced with the negative siRNA to obtain a CLU-scramble cell.
[0097] After the cells were incubated in the 37°C cell incubator for 24 h or 48 h, the cell viability of the cells in different groups was determined according to the method for determining cell viability in section 2.1.
[0098] After the cells were incubated in the 37°C cell incubator for 24 h, the cell apoptosis of the cells in different groups was detected according to the method for detecting cell apoptosis in section 2.1.
[0099] Figure 6-7 The results show that after knocking down CLU, the cell viability is significantly enhanced, and cell apoptosis is inhibited, as compared with the Control group.
[0100] Figures 4-7 The results show that overexpression of CLU can effectively treat keloids.
[0101] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, several improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. The application of a reagent that promotes CLU gene overexpression in the preparation of products for treating keloids, characterized in that, The reagent that promotes CLU gene overexpression is a recombinant vector that overexpresses the CLU gene or a CLU liposome complex that overexpresses the CLU gene. The CLU overexpression liposome complex was obtained by mixing the CLU gene overexpression recombinant vector with lipofectamine 3000 reagent.
2. Application of reagents for detecting CLU gene expression levels in the preparation of products for predicting the risk of keloid development.
3. The application according to claim 2, characterized in that, The reagents for detecting CLU gene expression include CLU primer pairs or CLU antibodies.
4. The application according to claim 3, characterized in that, The sequences of the CLU detection primer pairs are shown in SEQ ID NO.3 to SEQ ID NO.4.
Citation Information
Patent Citations
Human nuclear clusterin, vector and application thereof
CN101816779A
Application of reagent for detecting CLU gene and / or CLU protein in preparation of meningioma related products
CN118186076A