Cordycepin nano-delivery body as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a cordycepin nano-delivery body as well as a preparation method and application thereof. According to the method, a rolling circle amplification technology is utilized, cordycepin is connected to circular DNA through base complementary pairing, and the cordycepin nano-delivery body is obtained. The prepared cordycepin nano-carrier is a nano-particle, and the particle size of the nano-particle is 100-120nm. According to the cordycepin nano-delivery body, the characteristic that cordycepin and DNA can form unconventional base complementary pairing is utilized, biomacromolecule DNA is successfully adopted as a cordycepin carrying carrier for the first time, the cordycepin nano-delivery body which is efficient in carrying, controllable in slow release and high in biological safety is obtained, and the cordycepin nano-delivery body has good targeting performance on melanoma. The cordycepin nano-delivery body is mild and safe in preparation condition, simple in preparation process and easy to operate, and industrial production and wide clinical application of nano-carriers are facilitated.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a cordycepin nano-delivery body and a preparation method and application thereof. Background Art

[0002] Cordycepin, also known as 3'-deoxyadenosine, is a nucleoside antibiotic with diverse biological activities, including antibacterial, anti-leukemia, immunomodulatory, free radical scavenging, and anti-ischemia-reperfusion injury pharmacological effects. In recent years, cordycepin has demonstrated promising anti-tumor activity in both in vitro and in vivo studies. However, its poor solubility, low activity, and easy metabolism after oral administration have significantly limited its application.

[0003] Melanoma is a highly malignant and easily metastatic skin tumor with an increasing incidence rate and limited effectiveness of traditional treatments. Currently, clinical treatment mainly relies on chemotherapy drugs (such as dacarbazine), targeted therapy (such as BRAF / MEK inhibitors) and immune checkpoint inhibitors (such as PD-1 antibodies), but these therapies have significant drawbacks: chemotherapy drugs have significant side effects and are prone to induce drug resistance; targeted therapy is only effective for some patients with BRAF V600E mutations, and most patients relapse within a short period of time. In addition, the dense stromal barrier and immunosuppressive microenvironment of melanoma further hinder drug penetration and efficacy. There is an urgent need to develop new treatment strategies that are both highly effective, low-toxic, and synergistic with multiple mechanisms.

[0004] Cordycepin, a natural nucleoside analog, has emerged as a potential candidate for melanoma treatment due to its multi-target anti-tumor mechanisms and high safety profile. Studies have shown that cordycepin can induce tumor cell apoptosis by activating the Caspase-3 / 9 pathway and inhibiting cell proliferation through the PI3K / AKT / mTOR signaling pathway. It can also downregulate MMP-2 / 9 and VEGF expression, inhibiting tumor invasion and metastasis. Furthermore, cordycepin exhibits significantly lower toxicity to normal cells than traditional chemotherapy drugs and lacks serious side effects such as bone marrow suppression, further highlighting its unique advantages in overcoming drug resistance and improving overall therapeutic efficacy.

[0005] However, the clinical application of cordycepin is limited by its inherent defects: poor water solubility results in an oral bioavailability of less than 5%; it is easily degraded by adenosine deaminase (ADA) in the body, resulting in a short half-life (<1 hour); and free drugs have difficulty penetrating the dense matrix of melanoma. To address these problems, the innovative design of nanoparticle delivery systems has become the key to breaking through the bottleneck. The use of carriers to deliver cordycepin can protect cordycepin from degradation by enzymes in the body, ensuring that the drug remains active before reaching the target site, and has the advantages of improved targeting. However, in existing cordycepin delivery research, whether it is cordycepin nanoparticles or research on cordycepin preparations, the carriers are mostly concentrated on chemical substances, such as polyethylene glycol, biotin, etc., and these materials have varying degrees of biological toxicity.

[0006] In the previous research of the inventor's research group, a new method of molecular dynamics simulation and experimental collaboration was used to accelerate the screening of DNA base-organic small molecule interaction structures, and it was found that cordycepin can form a triplex structure with thymine through unconventional base complementary pairing (Xinyu Feng et al. Angew Chem Int Ed. 2024Aug 26; 63(35): e202408003.). Based on this discovery, cordycepin is expected to be delivered through biological carriers.

[0007] However, it is not clear how to construct an effective cordycepin nanoorganism based on this invention and provide a nanoorganism that can efficiently carry and deliver cordycepin for the treatment of melanoma. This is a technical problem that needs to be solved. Summary of the Invention

[0008] In order to solve the above technical problems, one of the objectives of the present invention is to provide a method for preparing cordycepin nanoparticles.

[0009] The present invention adopts the following technical solutions:

[0010] A method for preparing a cordycepin nanoparticle delivery system comprises the following steps:

[0011] S1. Preparation of circular DNA: Mixing a primer strand solution with a template strand solution, and forming a circular DNA product through annealing and ligation reaction, wherein the sequence of the primer strand is shown in SEQ ID No: 1, and the sequence of the template strand is shown in SEQ ID No: 2.

[0012] S2. Rolling circle amplification: The prepared circular DNA was mixed with the cordycepin solution to prepare a rolling circle amplification reaction system. The reaction was carried out at 30°C for 10-60 minutes in a PCR instrument. The reaction was then terminated by incubating at 75°C for 10 minutes to obtain the desired cordycepin nanoparticle delivery system.

[0013] Preferably, the PCR reaction time is 30°C for 30 minutes.

[0014] Preferably, in step S1, after the primer chain solution and the template chain solution are mixed, a ligation buffer is added, and after annealing is completed using a PCR instrument, T4 ligase is added, and the mixture is allowed to stand at 25°C for 3 hours for ligation, and then the reaction is terminated by incubating at 65°C for 10 minutes.

[0015] Preferably, the primer strand solution and the template strand solution are mixed in a molar ratio of (2-4):1, 5 μL of 10× ligation buffer is added, and double-distilled water is added to a final volume of 50 μL before annealing.

[0016] Preferably, the annealing procedure is: 95°C for 2 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and 22°C for 30 min.

[0017] Preferably, the dosage of the T4 ligase is 10-20 U / μL.

[0018] More preferably, the primer strand solution and the template strand solution are mixed at a concentration ratio of 2:1; and the amount of the T4 ligase used is 10 U / μL.

[0019] Preferably, in step S2, the rolling circle amplification reaction system includes circular DNA, cordycepin solution, Φ29 DNA polymerase, dNTP, BSA, and Φ29 DNA polymerase reaction buffer.

[0020] Preferably, in the rolling circle amplification reaction system, the final concentration of cordycepin is 10-16 mM, the final concentration of Φ29 DNA polymerase is 2-3 U / μL, and the final concentration of dNTP is 1-2 mM / μL.

[0021] More preferably, the final concentration of cordycepin is 16 mM, the final concentration of Φ29 DNA polymerase is 2 U / μL, and the final concentration of dNTP is 2 mM / μL.

[0022] The second object of the present invention is to provide a cordycepin nanoparticle delivery system, which is prepared using the above-mentioned preparation method.

[0023] Preferably, the cordycepin nanoparticles are nanoparticles with a particle size of 100-120 nm.

[0024] The third object of the present invention is to provide the use of the cordycepin nano-delivery body described above in the preparation of a drug for treating melanoma.

[0025] The beneficial effects of the present invention are:

[0026] 1. Based on the previous research of the inventors' research group, this application successfully uses the biological macromolecule DNA as a cordycepin carrier for the first time. DNA is highly designable, modifiable, programmable, biocompatible, and biodegradable. When used as a drug carrier, it has the advantages of good biosafety and strong adjustable controlled release. This application takes advantage of the fact that cordycepin can form unconventional base complementary pairing with DNA and uses RCA technology to construct a cordycepin carrier. Based on DNA hydrogel, a cordycepin nanodelivery with high efficiency, controlled sustained release, and high biosafety is obtained.

[0027] 2. The clinical administration limitations of cordycepin are primarily due to the inherent physical and chemical property defects of the free drug, which have resulted in a failure to significantly improve its therapeutic efficacy. Specifically, unmodified cordycepin molecules have key issues such as poor water solubility, a short biological half-life, and insufficient targeting. Simply formulating the naked drug into an oral formulation also has oral first-pass effect and enterohepatic circulation, which greatly reduces the therapeutic effect of cordycepin. Cordycepin has a therapeutic effect on tumors, so the present invention uses DNA nanocarriers to carry cordycepin, allowing it to be slowly released locally in the tumor, thereby achieving the purpose of enhancing tumor treatment.

[0028] 3. The preparation conditions of the cordycepin nanocarrier provided in this application are mild and safe, do not use acids, bases or organic solvents, and do not produce toxic byproducts. The preparation process is simple and easy to operate, which is conducive to the industrial production of nanocarriers and their wide clinical application.

[0029] 4. The high expression of MDR1 (multidrug resistance protein, i.e. P-glycoprotein) in melanoma cells is an important mechanism for the development of chemotherapy resistance. The RCA-CCS nanocarrier constructed in this application based on rolling circle amplification technology has achieved a dual functional design by introducing an MDR1 aptamer into the primer chain sequence: first, the aptamer specifically binds to the P-glycoprotein overexpressed on the surface of tumor cells, giving the nanoparticles the ability to actively target and identify melanoma cells; second, the carrier is efficiently loaded with cordycepin, and the nanoparticles can protect it from nuclease degradation, thereby achieving efficient drug loading and release of cordycepin. This drug delivery system has successfully broken through the limitations of traditional chemotherapy, and through the "recognition-blocking-killing" trinity mode of action, it provides an innovative solution for overcoming multidrug resistance in melanoma. Its core value lies in combining the natural anti-tumor activity of cordycepin with the precise manipulation of nanotechnology, laying an important theoretical foundation for the development of targeted anti-cancer preparations based on natural products. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the preparation of cordycepin nanoparticle delivery system in this application.

[0031] Figure 2This is the gel electrophoresis characterization of RCA-CCS. Figure A shows the successful binding of the primer chain to the template chain, and Figure B shows the successful synthesis of the RCA product.

[0032] Figure 3 These are the scanning electron microscopy results of RCA-CCS. Figures A and B are the observation results at different magnifications.

[0033] Figure 4 The HPLC characterization results of RCA-CCS.

[0034] Figure 5 These are the experimental results of RCA-CCS targeting B16F10 cells and Hacat cells.

[0035] Figure 6 The effect of RCA-CCS on B16F10 cell viability.

[0036] Figure 7 Flow chart of drug administration for mouse melanoma experiments.

[0037] Figure 8 These are photos of the appearance of mice in different groups at the end of drug administration in the mouse melanoma experiment.

[0038] Figure 9 These are photos of melanoma tumor tissues obtained from different groups of mice in a mouse melanoma experiment.

[0039] Figure 10 Figure 2 shows the changes in tumor tissue volume (Figure A) and weight (Figure B) in a mouse melanoma experiment.

[0040] Figure 11 The results of TUNEL staining of tumor tissues of mice in different groups.

[0041] Figure 12 The results of ELISA detection of IFN-γ in the serum of mice in each group.

[0042] Figure 13 These are H&E stained sections of the main organs (heart, liver, spleen, lung, and kidney) of mice in each group. DETAILED DESCRIPTION

[0043] The technical solution of the present invention is described in more detail below in conjunction with experiments.

[0044] Experimental cells: Mouse melanoma cells B16F10 were purchased from Wuhan Punosai Life Science Technology Co., Ltd.

[0045] Experimental animals: SPF-grade C57BL / 1 magnetic mice, 6–8 weeks old and weighing 20 ± 1 g, were purchased from Saiye (Suzhou) Biotechnology Co., Ltd. The animal room was maintained at an ambient temperature of 25 ± 1°C with a 12-h light / dark cycle and free access to food. Experiments were conducted after 7 days of acclimatization.

[0046] Main drugs: cordycepin, purchased from Shanghai Aladdin Company; DNA primer chain, purchased from General Biotechnology (Anhui) Co., Ltd.

[0047] Example 1

[0048] See also Figure 1 The preparation method of the cordycepin nanoparticle delivery system comprises the following steps:

[0049] S1. Preparation of circular DNA:

[0050] Primer strand sequence: ACTGTTTACCGTGTAGGCATCCC AGTGTCCGCGA (SEQ ID No: 1);

[0051] Template chain (Circular Strand) sequence: GGGATGCCTACACGGTAAAC AGTTAAAAAAAAAAAAAAAAAAAAAAAAAAATACT AGATGCTGAGGTACAGG TTTCGCGGACACT (SEQ ID No: 2);

[0052] The complementary pairing sequence of the MDR1 aptamer is underlined.

[0053] Dilute the two single-stranded DNAs: centrifuge the primer tube (1000-3000 rpm) for several minutes to allow the DNA to aggregate at the bottom of the tube. After adding an appropriate amount of double-distilled water, cover the tube, heat in a water bath, and vortex to mix to fully dissolve the DNA. The DNA concentration is about 10 μM.

[0054] Mix the primer strand solution with the template strand solution, add 5 μL of 10× ligation buffer, and add double-distilled water to a final volume of 50 μL. Anneal the system using a PCR instrument. The annealing program is as follows: 95°C for 2 minutes, 65°C for 30 minutes, 50°C for 30 minutes, 37°C for 30 minutes, and 22°C for 30 minutes. After annealing, add T4 ligase (10 U / μL) to the system and let it stand at 25°C for 3 hours for ligation. After the standing period, inactivate the T4 ligase at 65°C for 10 minutes to terminate the reaction. The product, i.e., circular DNA, is stored in a 4°C refrigerator until ready for use.

[0055] S2. Rolling circle amplification (RCA): The product of step S1 above was mixed with cordycepin solution, Φ29 DNA polymerase, dNTPs, BSA (1X), and 10×Φ29 DNA polymerase reaction buffer to obtain a rolling circle amplification reaction system. The reaction was carried out using a PCR instrument at 30°C for 30 min. The reaction was terminated by incubating at 75°C for 10 min to obtain the desired cordycepin nanoparticles (RCA-CCS).

[0056] verify

[0057] 1) Characterization by native polyacrylamide gel electrophoresis

[0058] RCA-CCS was characterized by 8% non-denaturing polyacrylamide gel electrophoresis. Figure 2 As shown in Figure A, the primer chain and the template chain form a new structure through base complementary pairing. The new structure has a larger structure and appears relatively higher on the gel image. Figure 2 As shown in B, the RCA product accumulated in the loading well, proving that the large-structured nanocarrier was successfully synthesized through the RCA reaction.

[0059] 2) Scanning electron microscopy characterization

[0060] Take 30 μL of the prepared RCA-CCS and perform gradient dehydration and desalting using anhydrous ethanol of different concentrations.

[0061] First, add 500 μL of 50% anhydrous ethanol according to the gradient, mix for 2 to 3 minutes, centrifuge at 12,000 rpm for 12 minutes, discard the liquid, and retain the precipitate; then add 500 μL of 75% anhydrous ethanol, mix for 2 to 3 minutes, centrifuge at 12,000 rpm for 12 minutes, discard the liquid, and retain the precipitate; finally, add 500 μL of 95% anhydrous ethanol, mix for 2 to 3 minutes, centrifuge at 12,000 rpm for 12 minutes, discard part of the liquid, use a pipette to blow the remaining product evenly, and evenly spread it on an 8 mm * 8 mm square silicon wafer.

[0062] The silicon wafer is sprayed with platinum, fixed on the sample stage, and measured on the machine.

[0063] like Figure 3 As shown, the scanning electron microscopy results show that nanoparticles with uniform particle size can be seen in the field of view, indicating that the cordycepin nanoparticles prepared by this method have uniform particle size and the particle size distribution is between 100-120nm.

[0064] 3) High performance liquid chromatography (HPLC) characterization

[0065] In order to prove that cordycepin was successfully loaded on RCA, the HLPC method was used to determine the content of cordycepin in cordycepin nanoparticles.

[0066] 600 μL of the prepared RCA-CCS was taken and ultrafiltered four times using a 10Kd ultrafiltration tube to filter out excess free small molecule cordycepin. The waste liquid from each ultrafiltration was retained and A260 nm was measured.

[0067] After ultrafiltration, approximately 260 μL of final product was obtained. 32 μL of 10× reaction buffer and 28 μL of DNase I were added and the reaction system was incubated at 37°C for 12 hours. At the end of the reaction, 32 μL of 25 mM EDTA was added and the PCR reaction was inactivated at 65°C for 10 minutes to yield approximately 350 μL of product. DNase I treatment of the ultrafiltration product disrupts the DNA structure, exposing the small molecule drug cordycepin and freeing it for concentration testing.

[0068] About 5 mL of double-distilled water was added to the product (about 350 μL) to dilute the sample and measure it on the instrument.

[0069] The results are as follows Figure 4 As shown, it can be seen that the product has the characteristic absorption peak of cordycepin, and the concentration of cordycepin is 4.74 μg / mL, which proves that the delivery vector provided by the present application has a good carrying efficiency for cordycepin.

[0070] Example 2

[0071] Targeting of cordycepin nanoparticles

[0072] Mouse melanoma cells (B16F10) were cultured in a 37°C incubator using 1640 culture medium containing 10% fetal bovine serum. Human immortalized keratinocytes (HaCat) were cultured in a 37°C incubator using DMEM culture medium containing 10% fetal bovine serum. Cell slides were placed in 24-well plates, and B16F10 cells and HaCat cells in the logarithmic growth phase were collected and moved to 24-well culture plates. After the cells adhered, cordycepin nanoparticles made with Cy3-labeled fluorescent dUTPs were added (the preparation method was the same as in Example 1, except that dNTPs used fluorescently modified dUTPs). After 2 hours of co-culture, the cells were washed with PBS and fixed with 4% paraformaldehyde (PFA) at 4°C for 30 minutes. Subsequently, the liquid was removed and the cell nuclei were stained with DAPI stain at 4°C for 5 minutes. Finally, the cell slides were removed from the 24-well plates, dried, mounted on glass slides, and observed using a laser confocal microscope.

[0073] like Figure 5 As shown, laser confocal microscopy results showed that the uptake of cordycepin nanoparticles by B16F10 cells was significantly higher than that by HaCat cells, which was attributed to the overexpression of MDR1 on B16F10 cells. In this design, the RCA product contains abundant MDR1 aptamers, which can selectively target B16F10 cells with high MDR1 expression.

[0074] Example 3

[0075] Cordycepin nanoparticles inhibit tumor cell activity

[0076] Mouse melanoma cells (B16F10) were cultured in a 37°C incubator using 1640 medium containing 10% fetal bovine serum. Cells in the logarithmic growth phase were harvested and transferred to a 6-well plate for culture. RCA-CCS was added at 0.4 ng / μL, 0.8 ng / μL, 1.2 ng / μL, 1.6 ng / μL, and 2 ng / μL for co-culture for 24 hours. After co-culture, Fixable ViabilityDye eFluor TM 520 activity dye was used to detect cell viability.

[0077] like Figure 6 As shown in the data, cordycepin nanoparticles can reduce the viability of B16F10 cells, and the inhibitory effect becomes stronger with increasing dose, with significant differences (**p<0.001; *p<0.05).

[0078] Example 4

[0079] Cordycepin nanoparticles improve B16F10 cell-induced melanoma in mice

[0080] 1. RCA-CCS preprocessing

[0081] Prior to administration, the RCA-CCS product prepared in Example 1 was ultrafiltered five times to remove excess free cordycepin. The steps were as follows: 1) the ultrafiltration tube was rinsed with double-distilled water and centrifuged at 1000 rpm for 5 minutes; 2) 200 μL of the RCA-CCS product was added, followed by 300 μL of 1×TAE / Mg, the mixture was allowed to stand for 3 minutes, and then centrifuged at 7000 rpm for 10 minutes; 3) the waste liquid was discarded, 1×TAE / Mg was added to the ultrafiltration tube to the 500 μL mark, the mixture was allowed to stand for 3 minutes, and then centrifuged at 7000 rpm for 10 minutes; 4) step 3) was repeated three times. After the final ultrafiltration, the final product in the ultrafiltration tube was collected to obtain the RCA-CCS for experimental use.

[0082] 2. Preparation and Administration of Mouse Melanoma Model

[0083] The experimental animals were 32 6-week-old C57BL / 6J female mice, which were randomly divided into four groups, with 8 mice in each group, namely the model group, the cordycepin gavage group, the low-dose RCA injection group and the high-dose RCA injection group.

[0084] Modeling process: Shave the hair on the right back of the mouse one day in advance. The next day, digest the prepared B16F10 cells into a centrifuge tube and resuspend them in physiological saline to adjust the cell concentration to 5*10 6 Cells / mL were injected subcutaneously into the right back of C57BL / 6J mice, with 0.1 mL injected into each mouse (note that the cell suspension needs to be mixed before each injection) to establish a melanoma xenograft model. 3 (V 肿瘤体积 = length * width 2 / 2), start medication.

[0085] Melanoma mice were randomly divided into four groups:

[0086] Group 1: Model group, injected intraperitoneally with the same volume of normal saline;

[0087] Group 2: Cordycepin gavage group, gavage administration of cordycepin, the dosage is 5mg / kg;

[0088] Group 3: RCA low-dose injection group, mice were administered ultrafiltered RCA-CCS product via tail vein at a dose of 0.05 mg / kg;

[0089] Group 4: RCA high-dose injection group, mice were administered the RCA-CCS product prepared in Example 1 via tail vein (the product was ultrafiltered 5 times before each administration to remove excess free cordycepin), with a dosage of 0.1 mg / kg;

[0090] The experimental flow chart is as follows Figure 7 As shown, the weight and tumor volume of mice were recorded before the first administration. The changes in tumor volume of mice were measured and recorded with a vernier caliper before administration every day until the tumor of mice in the model group grew to nearly 1500mm. 3 The mice were killed.

[0091] 2. Evaluation of the therapeutic effects of cordycepin nanoparticles

[0092] (1) Melanoma weight and volume

[0093] After the administration, the mice in the given group were photographed. Figure 8 As shown. Before killing, the size of the mouse tumor was recorded, the mouse was sacrificed, the dorsal tumor tissue was peeled off, weighed, and photographed. Figure 9 and Figure 10 As shown, the tumor volume and weight of melanoma in mice in Group 3 and Group 4 were smaller, which proved that the therapeutic effects of the two groups were better than those of the cordycepin gavage group, and as the dose increased, the growth inhibition effect of melanoma was also better.

[0094] (2) TUNEL staining to detect apoptotic cells in melanoma tissue

[0095] TUNEL (Terminal deoxynucleotidyl transferase dUTP Nick End Labeling) is a method for detecting DNA breaks. During apoptosis, endogenous nucleases are activated, causing DNA breaks between nucleosomes and the formation of numerous 3'-OH termini. The TUNEL technique uses terminal deoxynucleotidyl transferase (TdT) to attach labeled dUTP (e.g., fluorescent or enzymatic) to the 3'-OH termini of DNA breaks, thereby labeling cells experiencing DNA breaks.

[0096] TUNEL-positive cells are generally considered to be cells undergoing apoptosis, as DNA fragmentation is one of the key characteristics of apoptosis. In melanoma tissue, the number of TUNEL-positive cells can reflect the level of apoptosis in tumor cells and thus assess the biological behavior of the tumor or the efficacy of treatment.

[0097] like Figure 11 As shown, both Group 3 and Group 4 had more TUNEL-positive cells, proving that the therapeutic effects of the two groups were better than the cordycepin gavage group, and as the dose increased, the growth inhibition effect on melanoma was also better.

[0098] (3) ELISA detection of IFN-γ in serum

[0099] At the end of the experiment, blood was collected from the mouse eyeballs, centrifuged, and mouse serum was obtained. Following the manufacturer's instructions, the test sample was added to the wells of the ELISA plate. After the color development reaction stopped, dual-wavelength detection was performed using a microplate reader, with the detection wavelength set at 450 nm and the reference wavelength at 610 nm. The IFN-γ concentration in the sample was calculated.

[0100] like Figure 12 As shown, the IFN-γ concentration in the serum of mice in each drug-treated group was significantly higher than that in the model group (Group 1), and the difference was statistically significant (**p<0.001; *p<0.05). Compared with the cordycepin gavage group (Group 2), the IFN-γ concentration in the serum of mice in the two cordycepin RCA product injection groups was significantly increased, and the increase in Group 4 was more obvious, and the difference was statistically significant ( ## p<0.001), which proved that the therapeutic effects of the two groups were better than the cordycepin gavage group, and with the increase of the dose, the growth inhibition effect on melanoma was also better.

[0101] (4) Biosafety testing of cordycepin nanoparticles

[0102] H&E staining analysis is a core safety assessment method in animal experiments. By visually displaying changes in organ tissue structure and cell morphology, it can comprehensively reveal the potential toxicity of experimental interventions, verify model stability, and provide a morphological basis for mechanism research.

[0103] At the end of the experiment, the mice were anesthetized and killed, and the heart, liver, spleen, lung, and kidney were removed. The tissues were immediately placed in 4% paraformaldehyde for dehydration, paraffin embedding, sectioning, and H&E staining. The tissue sections were observed under a microscope. Figure 13 It was found that there were no organic changes in the main organs of mice in each drug-treated group, proving that the cordycepin nanoparticles have good biosafety and can ensure a balance between efficacy and safety.

[0104] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for preparing a cordycepin nanoparticle delivery system, characterized in that: Using rolling circle amplification technology, cordycepin is linked to circular DNA through base complementary pairing to obtain a cordycepin nanoparticle delivery system, which includes the following steps: S1. Preparation of circular DNA: Mixing a primer strand solution with a template strand solution, and forming a circular DNA product through annealing and ligation reaction, wherein the sequence of the primer strand is shown in SEQ ID No: 1, and the sequence of the template strand is shown in SEQ ID No:

2. S2. Rolling circle amplification: The prepared circular DNA was mixed with the cordycepin solution to prepare a rolling circle amplification reaction system. The reaction was carried out at 30°C for 10-60 minutes in a PCR instrument. The reaction was then terminated by incubating at 75°C for 10 minutes to obtain the desired cordycepin nanoparticle delivery system.

2. The method for preparing a cordycepin nanoparticle delivery system according to claim 1, wherein: In step S1, after the primer chain solution and the template chain solution are mixed, a ligation buffer is added, and after annealing is completed using a PCR instrument, T4 ligase is added, and the mixture is allowed to stand at 25° C. for 3 hours for ligation, and then the reaction is terminated by keeping the mixture at 65° C. for 10 minutes.

3. The method for preparing a cordycepin nanoparticle delivery system according to claim 2, wherein: The primer strand solution and the template strand solution were mixed at a molar ratio of (2-4):1, 5 μL of 10× ligation buffer was added, and double-distilled water was added to a final volume of 50 μL, followed by annealing.

4. The method for preparing a cordycepin nanoparticle delivery system according to claim 3, wherein: The annealing procedure is: 95° C. for 2 min, 65° C. for 30 min, 50° C. for 30 min, 37° C. for 30 min, and 22° C. for 30 min.

5. The method for preparing a cordycepin nanoparticle delivery system according to claim 3, wherein: The dosage of the T4 ligase is 10-20 U / μL.

6. The method for preparing a cordycepin nanoparticle delivery system according to claim 1, wherein: In step S2, the rolling circle amplification reaction system includes circular DNA, cordycepin solution, Φ29 DNA polymerase, dNTP, BSA, and Φ29 DNA polymerase reaction buffer.

7. The method for preparing a cordycepin nanoparticle delivery system according to claim 6, wherein: In the rolling circle amplification reaction system, the final concentration of cordycepin is 10-16 mM, the final concentration of Φ29 DNA polymerase is 2-3 U / μL, and the final concentration of dNTP is 1-2 mM / μL.

8. A cordycepin nanoparticle delivery system, characterized in that: It is prepared using the preparation method according to any one of claims 1 to 7.

9. The cordycepin nanoparticle delivery system according to claim 8, wherein: The cordycepin nano delivery body is a nanoparticle with a particle size of 100-120nm.

10. Use of the cordycepin nano-delivery agent according to claim 8 or 9 in the preparation of a drug for treating melanoma.

Images