Gene marker for melanoma and use thereof

Abstract

The application belongs to the technical field of biomedicine, and specifically discloses a gene marker of melanoma and application thereof. The gene marker is a PDP1 gene, and the application proves the correlation between the PDP1 gene and melanoma. The expression amount of the PDP1 gene in melanoma cells is significantly higher than that in normal melanocytes. The PDP1 expression is positively correlated with the pathological stage and the lymph node metastasis condition N value. The PDP1 gene influences the cell proliferation, cell apoptosis, cell migration and cell invasion of melanocytes. Therefore, the PDP1 gene can be used as a potential target for diagnosing and treating melanoma. By detecting the mRNA or protein expression level of the PDP1 gene, melanoma can be detected, and the application has good application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical technology, in particular to a melanoma gene marker and application thereof. BACKGROUND

[0002] Melanoma is a highly malignant tumor, and its incidence in China is less than one in ten thousand, which is a rare disease. After resection, melanoma still has a high probability of recurrence and metastasis of up to 50%, and is extremely insensitive to radiotherapy and chemotherapy. The current treatment regimen is targeted therapy and PD-1 immunotherapy. Targeted therapy requires patients to have Braf mutations, however, the Braf mutation rate of patients in China is less than 10%, and the target therapy benefits a very small population; the effective rate of PD-1 in China is less than 17%. The treatment of melanoma is still very poor, and new treatment regimens need to be explored urgently.

[0003] The growth and metastasis of tumor cells require the deep participation of cell metabolism. The metabolic rate of tumor cells is generally higher than that of normal tissue cells, so the regulatory proteins related to metabolism are also different from those of normal tissue cells. Clinically, this feature of tumor has been developed into a key clinical diagnosis and treatment strategy. Accurately finding the key protein of melanoma that regulates metabolism is the key to innovative diagnosis and treatment of melanoma. However, there is no diagnostic marker and drug for melanoma cells in terms of metabolism. SUMMARY

[0004] To solve the above problems, one of the purposes of the present application is to provide a gene marker related to the occurrence of melanoma, which can be applied to the clinic to achieve early diagnosis of melanoma and improve the survival rate and quality of life of patients.

[0005] To achieve the above purpose, the specific technical solutions adopted by the present application are as follows:

[0006] Pyruvate dehydrogenase phosphatase catalytic subunit 1 [Homo sapiens] (PDP1) is one of the regulatory proteins involved in cellular energy metabolism, and its role in the diagnosis and treatment of malignant melanoma has not been clearly defined. However, the inventors have found that the expression of PDP1 (pyruvate dehydrogenase phosphatase) gene in the cancer tissue of melanoma is significantly higher than that in the paracancerous tissue; the PDP1 gene is highly expressed in melanoma cells, significantly higher than that in normal melanocytes; the expression of PDP1 gene is positively correlated with the pathological stage and lymph node metastasis N value, and the survival period of patients with high expression of PDP1 is decreased; after interfering with the PDP1 gene, the proliferation ability of melanoma cells is significantly decreased, the apoptosis is significantly increased, and the migration and invasion abilities are significantly reduced. Therefore, it is determined that the PDP1 gene can be used as a potential target for the diagnosis and treatment of melanoma.

[0007] Specifically, the DNA sequence of the PDP1 gene is shown as SEQ ID NO: 1 (NCBI Reference Sequence: NM_001161779.2).

[0008] The second object of the present application is to provide an application of a reagent for detecting the expression level of a gene marker in the preparation of a product for detecting melanoma.

[0009] Preferably, the expression level of the gene marker is the mRNA expression level or the protein expression level of the PDP1 gene, and the mRNA expression level of the PDP1 gene can be detected by PCR, and the protein expression level of the PDP1 gene can be detected by immunohistochemistry.

[0010] The present application has the following beneficial effects:

[0011] It is confirmed that the expression of the PDP1 gene in the cancer tissue of melanoma is significantly higher than that in the paracancerous tissue, and is related to poor prognosis, thereby providing a new marker for the detection of melanoma.

[0012] By specifically interfering with the PDP1 gene, the proliferation and migration of malignant melanoma cells can be effectively inhibited, thereby inhibiting the malignant development of melanoma, and providing a basis for the clinical treatment research of melanoma.

[0013] The role of the PDP1 gene in melanoma is confirmed for the first time, and it can be used as a potential target for the diagnosis and treatment of clinical melanoma; a kit for detecting the PDP1 gene is also provided, which can be quickly and highly sensitively detected, and has good application value. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 : The result figure of the Kaplan-Meier survival analysis in Example 2.

[0015] Figure 2 : The result figure of the PCR detection of the mRNA expression of the PDP1 gene in Example 3.

[0016] Figure 3 : The result figure of the CCK-8 cell proliferation experiment in Example 3.

[0017] Figure 4 : The result figure of the apoptosis experiment in Example 3.

[0018] Figure 5 : The result figure of the scratch test (cell migration) in Example 3.

[0019] Figure 6 : The result figure of the tumor invasion and metastasis Transwell experiment in Example 3. DETAILED DESCRIPTION

[0020] The present application is further illustrated in the following with reference to the accompanying drawings and specific examples.

[0021] Example 1. Big data analysis

[0022] RNA sequencing data and corresponding clinical information of melanoma patients were downloaded from The Cancer Genome Atlas (TCGA, n=472) and Genotype Tissue Expression (GTEx, n=323) projects, respectively. Among the samples in TCGA database, there was 1 normal sample and 471 cancer samples, so 323 normal samples were selected from GTEx database for analysis, in which the melanoma patients were distinguished into primary and metastatic types according to the sample information provided by TCGA. The expression difference of PDP1 in normal samples, primary samples and metastatic samples was analyzed. The results showed that there were significant differences among the three, and the expression of PDP1 was gradually up-regulated with the progression of melanoma disease.

[0023] Example 2. Clinical sample analysis

[0024] 1) Sample tissue source and collection

[0025] The melanoma clinical samples were from Zhongshan Hospital Affiliated to Fudan University, and the consent of the patients was obtained and approved by the Ethics Committee of Zhongshan Hospital Affiliated to Fudan University. A total of 109 melanoma tissue samples were collected. The normal skin tissue more than 5 cm away from the tumor tissue was defined as the paracancer tissue, and a total of 19 paracancer samples were collected.

[0026] A part of the intraoperative tissue was immediately placed in 4% paraformaldehyde for fixation, and the subsequent section and immunohistochemical staining were used; another part was immediately placed in liquid nitrogen for freezing and then transferred to a -80°C refrigerator for storage, which was used for subsequent extraction of RNA and protein.

[0027] 2) Tissue section and immunohistochemistry

[0028] The tissue section was fixed in 4% paraformaldehyde for 24 h. After fixation, the tissue section was embedded in the embedding frame and then dehydrated by gradient alcohol: alcohol (70%, 80%, 95%, 95%, 100% I and 100% II) for 45 min each, alcohol-dimethylbenzene for 30 min, dimethylbenzene for 20 min, dimethylbenzene-paraffin for 30 min, low melting point paraffin for 45 min, and high melting point paraffin for 45 min.

[0029] Embedding paraffin section (5 μm thick) was performed by using a section machine, and the cut tissue piece was placed in a 37°C oven overnight. Then, deparaffinization by dimethylbenzene and gradient alcohol hydration were performed in turn: alcohol (70%, 80%, 95%, 95%, 100% I and 100% II) for 3 min each, and water flushing for 5 min.

[0030] The slice was immersed in citrate buffer for antigen repair in a boiling water bath for 10 min, and then taken out and naturally cooled. The cooled slice was placed in PBS and washed on a shaker for 3 times, 5 min each time. 3% hydrogen peroxide solution was dropped on the tissue slice, and after being placed at 37°C for 20 min, it was washed with PBS for 3 times, 5 min each time. Blocking serum (10% goat serum) was added to the tissue slice, and placed at 37°C for 60 min; the serum was gently shaken off, and PDP1 antibody (Abeam, ab52893, dilution ratio 1:100) diluted with 0.5% BSA-PBS was added to the slice, and placed in a refrigerator at 4°C overnight.

[0031] The slice was taken out the next day and placed at room temperature for 60 min, and then washed with PBS for 3 times, 5 min each time; secondary antibody (Abeam, ab150083, dilution ratio 1:1000) diluted with 0.5% BSA-PBS was added to the slice, and incubated at 37°C for 60 min, and then washed with PBS for 3 times, 5 min each time; DAB developing solution was prepared and added to the slice, and reacted at room temperature, and then observed under a microscope; according to the color development, the reaction was terminated in water, the color development time was recorded, and the slice was washed with running water for 5 min; the slice was dyed with hematoxylin for 1 min, and then washed with running water for 5 min, and then observed under a microscope; the slice was neutralized with hydrochloric alcohol for 2 s, and then washed with running water for 5 min. The slice was dehydrated with gradient alcohol: 70% alcohol, 80% alcohol, 90% alcohol, 100% alcohol I, 100% alcohol II, each for 2 min, xylene I and xylene II, each for 2 min; the slice was mounted with neutral resin, dried in a fume hood, and then placed under a upright microscope for photographing.

[0032] 3) Data processing and statistical analysis

[0033] The expression level of PDP1 in 109 cases of clinical melanoma tissues and 19 cases of normal cancer-adjacent tissue pathological sections was detected by immunohistochemical technology. According to the thirteen-point scoring standard of immunohistochemistry, it was found that the expression amount of PDP1 in melanoma tissues was ≥≥5 (++~+++), and that in normal tissues was ≤5 (0~+).

[0034] Thirteen-point scoring standard of immunohistochemistry:

[0035] ① Positive cell score: no positive signal in cytoplasm, cell membrane or nucleus <0%-0 points-negative

[0036] 0% < positive cell ratio <25% 1 point-positive

[0037] 25% ≤ positive cell ratio <50% 2 points-positive

[0038] 50% ≤ positive cell ratio <75% 3 points-positive

[0039] 4 points - positive

[0040] ② Staining intensity score: cytoplasm, membrane or nucleus staining depth score 0-3 points

[0041] No signal color in cytoplasm, membrane or nucleus and stroma 0 points - negative

[0042] Light yellow in cytoplasm, membrane or nucleus and stroma 1 point - positive

[0043] Brownish yellow in cytoplasm, membrane or nucleus and stroma 2 points - positive

[0044] Dark brown in cytoplasm, membrane or nucleus and stroma 3 points - positive

[0045] Results: Positive cell score * staining intensity score determines the IHC result, the higher the score, the higher the antibody expression.

[0046] 0 points - negative, 1-4 points - positive +, 5-8 points - positive ++, 9-12 points - positive +++

[0047] Mann-Whitney U analysis showed that the expression of PDP1 gene was significantly different from the pathological stage and lymph node metastasis N value and other pathological data.

[0048] Further Spearman rank correlation analysis (Table 1) showed that the expression of PDP1 gene was positively correlated with pathological stage and lymph node metastasis N value and other pathological data, that is, as the malignant degree of tumor deepened, the expression of PDP1 gene increased.

[0049] Table 1

[0050]

[0051] According to Kaplan-Meier survival analysis (Table 2), the expression of PDP1 gene was significantly correlated with the overall survival (OS) of melanoma, that is, as the expression of PDP1 gene increased, the survival time shortened. Figure 1

[0052] Example 3. Experimental analysis of human melanoma cells

[0053] ​Cell culture: Cell lines A375, MUM-2B and SK-MEL-28 melanoma cells were purchased from American Type Culture Collection (ATCC) (MD, USA). The cells were inoculated into DMEM medium added with 10% heat-inactivated fetal bovine serum (FBS) and 100 IU / mL penicillin and 100 μg / mL streptomycin, and incubated in a CO2incubator with an environmental condition of 5% CO2and 37°C.

[0054] I. PCR detection of PDP1 gene mRNA expression in melanoma cells

[0055] Cell counting and calculation of cell suspension concentration, 5 x 105cells were taken from the cell suspension and inoculated into a 6-well plate. 6 The cells were centrifuged in a 1.5 mL RNase Free centrifuge tube, and after centrifugal precipitation, the supernatant was discarded, 1 mL of TRIZOL was added by a pipette, and the cells were repeatedly blown and lysed until the liquid was uniform and transparent. The homogenate sample was incubated at 15-30°C for 5 min to completely decompose the nucleoprotein.

[0056] 0.2 mL of chloroform was added to the sample (0.2 mL of chloroform was added to every 1 mL of TRIZOL), and the test tube was gently inverted by hand for 15 seconds to mix, and it was incubated at 30°C for 5 min. It was frozen and centrifuged at 12000 rpm at 4°C for 15 min. After centrifugation, the mixture was divided into three layers: the lower red phenol-chloroform layer, the middle layer, and the upper colorless water layer. The RNA was present in the water layer. The volume of the water layer was about 60% of the volume of the added TRIZOL (about 0.5 mL).

[0057] Isopropanol was used to precipitate the RNA: the water layer was moved to a new RNase Free centrifuge tube, and 0.5 mL of isopropanol was added (0.5 mL of isopropanol was added to every 1 mL of TRIZOL during homogenization). Gently invert to mix, and incubate the mixed sample at 30°C for 10 min, and high-speed frozen centrifuge at 12000 rpm at 4°C for 10 min. The RNA in the cells formed a gel-like sheet-shaped precipitate attached to the wall and bottom of the test tube.

[0058] The upper suspension was removed, and the isopropanol on the wall was absorbed as much as possible. 1 mL of 75% ethanol (75% ethanol solution diluted with RNase-free water) was added, shaken to mix, and the RNA precipitate was washed by high-speed frozen centrifugation at 12000 rpm at 4°C for 5 min to remove the ethanol. The above steps were repeated, and the ethanol was completely volatilized at room temperature in a clean bench to obtain a pure RNA sample.

[0059] The dried RNA precipitate cannot be used directly for detection, so the resolubilization of RNA is particularly important. Add 20 μL of DEPC water, gently blow, and dissolve the precipitate. Take 1 μL of RNA solution and add 79 μL of DEPC water to measure the OD260 / OD280 value and calculate the concentration. The formula for calculating the concentration of RNA is: RNA concentration (μg / μL) = (OD260 x 40 x dilution factor) / 1000.

[0060] Prepare the reverse transcription reaction system:

[0061] Total RNA of sample 1 μg

[0062] Oligo(dT)18 Primer 1 μL

[0063] DEPC water to 6 μL

[0064] After 10 min of 70°C water bath, quickly freeze on ice for more than 2 min; centrifuge at 4°C and 1500 rpm for 30 s to make the solution gather at the bottom of the Microtube tube; and continue to configure the following reaction solution in this tube:

[0065] The above template RNA / primer denaturation solution 6 μL

[0066] 5 M-MLV buffer 2 μL

[0067] dNTP mixture 0.5 μL

[0068] RNase inhibitor 0.25 μL

[0069] RTase M-MLV 1 μL

[0070] DEPC water to 10 μL

[0071] After 1 h of 42°C water bath, warm up to 70°C water bath for 15 min, quickly freeze on ice, and obtain the cDNA solution.

[0072] Prepare the RT-PCR reaction system:

[0073] SYBR Premix Ex Taq (2x) 12.5 μL

[0074] Upstream primer (10 μM) 0.5 μL

[0075] Downstream primer (10 μM) 0.5 μL

[0076] cDNA solution 2 μL

[0077] SYBR green dye 0.5 μL

[0078] Sterile distilled water 9.5 μL

[0079] Total volume 25 μL

[0080] PCR reaction to detect the expression abundance of PDP1 gene mRNA in melanoma cells: 96-well plate film, 1500 rpm centrifugation at 4°C for 5 min, then put into the instrument (ABI PCR Thermal Cycler Dice Detection System) to carry out the reaction and analyze the data. The PCR condition is set as follows: 95°C for 15 s, 55°C for 30 s, 72°C for 30 s, 40 cycles, set the average fluorescence value in the last 10% time after each cycle to show the amount of PCR product at the end of the last cycle. Melting curve analysis program: 95°C for 15 s, 60°C for 15 s (signal collection), 95°C for 15 s, after the reaction is completed, the record curve of the sample is obtained.

[0081] The software will automatically analyze the data, adjust the baseline, draw the amplification curve, analyze the results of the data, take GAPDH as the internal reference, calculate the 2-ΔΔCt value as the expression abundance of mRNA, and the results are shown in Table 2 and Figure 2 It can be seen that the PDP1 mRNA in melanoma cells is obviously increased, and the expression abundance of its mRNA is higher than 3.

[0082] Table 2

[0083]

[0084] II. PDP1 gene interference experiment

[0085] 1) Lentivirus infection to knock down PDP1 expression

[0086] The PDP1 interference sequence used in the case is: GAGGCCAAGAGTGTCGTGAAA (SEQ ID No. 4); GTCGACTGATATTGATGTTAA (SEQ ID No. 5); ACTTTAACAGCTTGAGGACTT (SEQ ID No. 6).

[0087] Inoculate cells to 24-well plate for routine culture, until the confluence is 70-80% for standby; add 24 μg of Polybrene to 3 mL of base medium to prepare a solution with a concentration of 8 μg / mL; add 0.5 mL of lentivirus liquid to the above solution, gently blow and mix to prepare a virus / medium mixture. Remove the original culture medium in the cell culture dish, add the virus / medium mixture, and incubate in a 37°C incubator. After 72 h, observe the transfection efficiency of the cells under a fluorescence microscope, and a transfection efficiency of >70% is considered qualified. The cells are routinely cultured, replaced, and subcultured.

[0088] 2) CCK-8 cell proliferation

[0089] Routine culture, digestion of cells, centrifugation, resuspension to prepare a cell suspension, and cell counting; dilute the cells to a concentration of 5 x 10 4 / mL with base medium, and inoculate the cells in a 48-well plate, a total of 21 wells, each well is numbered, and add to the incubator.

[0090] After 24 h, select 3 wells of cells, remove the culture medium, and add culture medium containing 10% CCK-8 to each well, gently shake the plate, and incubate in the incubator for 4 h before reading the OD value on the enzyme marker. Count once a day thereafter, and test 3 wells each time. Calculate the average value. Count continuously for 5 days, and analyze the OD value by SPSS software.

[0091] The results are shown in Figure 3 It can be seen that the number of A375 melanoma cells is reduced after interfering with the PDP1 gene, and the growth rate of the cells is negative (shPDP1-1 group is -1.3, and shPDP1-2 group is -1.7), and the proliferation ability of melanoma cells is significantly decreased.

[0092] 3) Flow cytometry for detecting cell apoptosis

[0093] Solution preparation: dilute 10x Binding Buffer to 1x Binding Buffer with deionized water.

[0094] Cell preparation: routinely inoculate, digest, centrifuge, discard the supernatant, and wash the cells with pre-cooled 4°C PBS, and resuspend to prepare a cell suspension; centrifuge at 2000 rpm for 5 min at 4°C, remove the supernatant, and wash the cells again with PBS; centrifuge at 2000 rpm for 5 min at 4°C, resuspend the cells with 500 μL of Binding Buffer, and adjust the concentration of the cell suspension to 1 x 10 6 / mL.

[0095] Staining: Add 5 μL of Annexin V-FITC to each sample, mix gently, add 5 μL of PI and mix; avoid light, incubate at room temperature, and fully react for 15 min.

[0096] Detection: Set the excitation wavelength to 488 nm and the emission light wavelength to 530 nm, and detect on the machine, and count Annexin V + The percentage of cells, lower right: Annexin V + / PI - , representing early apoptotic cells; upper right: Annexin V + / PI + , representing late apoptotic cells.

[0097] The results are shown in Figure 4 , which shows that interfering with the PDP1 gene significantly increases the apoptosis of melanoma cells.

[0098] 4) Scratch test

[0099] Digest the cells, centrifuge and resuspend, and count the cells;

[0100] 8 × 10 5 cells / well in a 6-well plate, 5% CO2, 37°C culture;

[0101] After the cells are fully grown, remove the culture medium;

[0102] Wash with PBS for 3 times, and slowly and evenly draw a horizontal line and a vertical line in the well with a 200 μL yellow gun head along the edge of the 6-well plate, like "+"; wash with PBS for 3 times, and wash away the cell clumps drawn, and add serum-free high-glucose DMEM solution, 5% CO2, 37°C culture;

[0103] Take photos under a microscope at 0h, 24h, and 48h, respectively; measure the scratch area in ImageJ, and the relative migration rate = (S0h-S48h) / S0h, where S0h is the scratch area of the single arm at 0h, and S48h is the scratch area of the single arm at 48h.

[0104] The results are shown in Figure 5 , which shows that interfering with the PDP1 gene significantly reduces the migration ability of melanoma cells.

[0105] 5) Tumor invasion and metastasis Transwell test

[0106] Preparation of Transwell chamber: Matrigel solution was taken out from the refrigerator, diluted with DMEM medium containing 10% BSA at a volume ratio of 1:6, and 50 μL of the diluted Matrigel solution was added to the upper chamber surface (inner surface) of the insert chamber, and the insert chamber was carefully placed into the 24-well plate and placed in a 37°C incubator for 1 h for Matrigel to solidify. According to this method, 4 chambers were prepared for each group of cells, and a total of 12 chambers were prepared.

[0107] Hydration of the basement membrane: After 1 h of incubation, the chamber plate was removed, 50 μL of DMEM medium containing 10% BSA was added to each insert chamber, and the plate was placed in a 37°C incubator for 30 min to hydrate the Matrigel basement membrane.

[0108] Preparation of cell suspension: The cells in good condition in the logarithmic growth phase were routinely digested, centrifuged, and the supernatant was discarded. The cells were washed twice with PBS. DMEM medium containing 10% BSA was added, and the cells were resuspended by gentle blowing. The cell suspension was counted, and the cells were uniformly diluted to a concentration of 1 × 10 5 / mL with DMEM medium containing 10% BSA.

[0109] Incubation of cells: 500 μL of DMEM medium containing 10% fetal bovine serum was added to the lower chamber surface of the insert chamber, i.e., the corresponding well of the 24-well plate, and the Matrigel-hydrated insert chamber was slowly placed in it. The insert chamber should be immersed in the medium on one side of the lower chamber surface first, and then slowly immersed in the entire chamber to avoid air bubbles. The prepared cell suspension was added to the upper chamber surface of the chamber at a volume of 200 μL per well to prepare a complete Transwell system. The Transwell system was labeled and placed in a 37°C incubator.

[0110] Staining and counting: After 24 h, the Transwell system was removed, and the Matrigel and remaining cells that did not pass through the membrane on the upper chamber surface of the insert chamber were gently removed with a cotton swab. The chamber was removed and inverted, and the cells on the lower chamber surface of the insert chamber were stained with a pre-prepared 0.5% crystal violet solution at room temperature for 20 min. The chamber was washed with PBS 5 times and air-dried at room temperature. The stained chamber was placed under an inverted microscope, and the cells that passed through the Matrigel microporous membrane and adhered to the lower surface of the membrane were observed under a 200x lens. Five random fields were counted directly for each well, and the average value was taken.

[0111] The results are shown in Figure 6 It can be seen that the number of melanoma cells passing through the membrane is significantly reduced when the PDP1 gene is interfered, indicating that the invasion ability is significantly reduced.

[0112] The specific embodiments are only illustrative of the present application, and are not a limitation of the present application, any change made by those skilled in the art after reading the specification of the present application will be protected by the patent law as long as it is within the scope of the claims of the present application.

Claims

1. Use of a reagent for detecting the expression level of a genetic marker in the manufacture of a product for detecting melanoma, characterized in that: The detection gene marker is a PDP1 gene, and the nucleotide sequence is shown as SEQ ID NO:

1.

2. Use according to claim 1, characterized in that: The gene marker expression level is the mRNA expression level or the protein expression level of the PDP1 gene.

Images