Pristinamycetin strain Y3 and its application

By screening and optimizing the culture medium and growth conditions of Priestella Y3, the problem of low efficiency in microbial ammonia nitrogen removal in existing technologies was solved, and efficient ammonia nitrogen removal was achieved in complex waste components, with an ammonia nitrogen removal rate of 42.70%.

CN120699835BActive Publication Date: 2025-12-05CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510930677.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-07
Publication Date
2025-12-05
Estimated Expiration
2045-07-07

AI Technical Summary

Technical Problem

Existing technologies for nitrogen removal using microorganisms are not very efficient at removing ammonia nitrogen, especially when faced with complex waste compositions, lacking efficient and stable ammonia nitrogen removal capabilities.

Method used

A strain of Priestella Y3 was screened out. Through screening on heterotrophic nitrification medium and whole genome sequence analysis, its culture medium and growth conditions were optimized to activate ammonia oxidase activity, providing a microbial strain that can maintain efficient ammonia nitrogen removal under various environmental conditions.

Benefits of technology

It exhibits efficient and stable ammonia nitrogen removal capabilities in complex waste compositions, with an ammonia nitrogen removal rate of up to 42.70%, solving the problem of low nitrogen removal efficiency in existing technologies and reducing ammonia emissions during waste treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120699835B_ABST
    Figure CN120699835B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of microbial technology, specifically relating to a strain of *Priscilla Y3* and its applications. The *Priscilla Y3* is classified as *Priscilla* (…). Priestia The *Priestella* Y3 strain provided by this invention has ammonia removal function, providing an effective biological deodorizing strain resource for efficient ammonia removal and deodorization in waste treatment processes. It was deposited on March 28, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34006.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Priestella Y3 and its applications. Background Technology

[0002] Ammonia (NH3) is the main alkaline gas and the primary form of reactive nitrogen (Nr) in the atmosphere. Globally, nearly 200 million tons of NH3 are produced annually, with agriculture (especially livestock farming) being the largest source. Globally, agriculture accounts for 90% of total NH3 emissions, with livestock production accounting for approximately 60% of that. Meanwhile, industrial activities such as urban combustion, vehicle traffic, chemical production, and waste management also release significant amounts of NH3 into the atmosphere. With the expansion and development of industry and agriculture, the concentration of NH3 in the atmosphere is increasing, leading to air, water, and soil pollution, as well as biodiversity loss. Consequently, people are beginning to pay attention to NH3 emissions and treatment methods.

[0003] Currently, biological deodorizing agents are widely used for ammonia removal. They mainly remove odorous gases (NH3) through microbial metabolism without producing secondary pollution. The operation is simple and the investment and operating costs are low. It mainly relies on microorganisms to carry out a series of metabolic processes, such as oxidation, nitrification and denitrification, to degrade and utilize NH3 as nutrients, and finally produce stable compounds such as CO2, H2O and nitrates. Therefore, it is a feasible method to use biological deodorization technology to prepare deodorizing agents to remove NH3.

[0004] Currently, microorganisms used for nitrogen removal include photosynthetic bacteria, anaerobic ammonia-oxidizing bacteria, and aerobic denitrifying bacteria. However, these microorganisms suffer from low ammonia nitrogen removal efficiency. Therefore, existing technologies lack a microbial strain that can maintain efficient and stable ammonia nitrogen removal capabilities under various environmental conditions, especially when dealing with complex waste compositions. Summary of the Invention

[0005] To address the shortcomings of existing microbial nitrogen removal technologies for ammonia nitrogen removal, which suffer from low efficiency, this invention develops a microbial strain capable of maintaining high and stable ammonia nitrogen removal efficiency under various environmental conditions, particularly when dealing with complex waste compositions. A strain of *Priscilla* Y3 and its applications are proposed. To achieve the above objectives, this invention employs the following technical solution.

[0006] This invention provides a strain of Priestella Y3, which was deposited on March 28, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34006. The address of the depository is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0007] This invention utilizes a heterotrophic nitrification medium to screen for a bacterium with high efficiency in removing ammonia nitrogen. Building upon traditional strain identification techniques, it incorporates whole-genome sequence analysis for more accurate species identification. Further optimization of the culture medium accelerates cell division and proliferation while activating ammonia oxidase activity, enhancing ammonia nitrogen removal efficiency and providing technical support for efficient ammonia and odor removal in waste treatment processes. The *Priscilla Y3* strain provided by this invention is a microbial strain capable of maintaining high and stable ammonia nitrogen removal efficiency under various environmental conditions, especially when facing complex waste components. It exhibits a high ammonia nitrogen removal rate, thereby reducing ammonia emissions during waste treatment and overcoming the shortcomings of existing microbial ammonia nitrogen removal technologies.

[0008] Preferably, the nucleotide sequence of the 16S rRNA of Priestella Y3 is shown in SEQ ID NO.1.

[0009] The present invention also provides a microbial inoculant, comprising the aforementioned Priestella Y3.

[0010] The present invention also provides the application of the Priestella Y3 or the microbial agent in the removal of ammonia nitrogen from waste, the waste including at least one of ammonia nitrogen-containing wastewater, landfill leachate and livestock and poultry manure.

[0011] Preferably, the Priestella Y3 or the microbial agent is added to the ammonia-nitrogen-containing wastewater to carry out a reaction.

[0012] Preferably, the Priestella Y3 or the microbial agent is used to metabolize the ammonia nitrogen in the ammonia nitrogen-containing wastewater through nitrification.

[0013] Preferably, the volume ratio of the Priestella Y3 or the microbial agent added to the ammonia nitrogen-containing wastewater is 1% to 5%.

[0014] Preferably, the OD of the *Priestella Y3* or the microbial agent is... 600 The value is 1.6~1.8.

[0015] Preferably, the reaction conditions are pH 7.8~8.2, temperature 34℃~36℃, and C / N ratio of 12; where C / N refers to the carbon-nitrogen ratio.

[0016] Preferably, the ammonia nitrogen concentration in the ammonia nitrogen-containing wastewater is 200 mg / L to 500 mg / L.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. This invention provides a strain of Priestella Y3. The Priestella Y3 provided by this invention is a microbial strain capable of maintaining efficient and stable ammonia nitrogen removal under various environmental conditions, especially when facing complex waste components. It has a high ammonia nitrogen removal rate, thereby reducing ammonia emissions during waste treatment and solving the deficiency of low ammonia nitrogen removal efficiency in existing microbial nitrogen removal technologies.

[0019] 2. This invention addresses the health and environmental problems caused by NH3 by employing microbial deodorization technology to remove ammonia, providing microbial strain resources. By screening ammonia-removing strains from compost samples, strain Y3 with the best ammonia removal capacity is selected as the target strain. The strain is identified through 16S rRNA gene phylogenetic analysis, whole genome sequence analysis, and morphological and physiological-biochemical characteristics to determine its taxonomic position. The optimal growth conditions for the strain are determined by optimizing environmental factors such as pH, temperature, carbon source, and C / N ratio, thereby improving the ammonia nitrogen removal efficiency and providing an effective biological deodorization strain resource for efficient ammonia and odor removal in waste treatment processes.

[0020] 3. This invention screens strains with high ammonia removal efficiency from compost samples. Taking the strain Priestella Y3 with the best ammonia removal capacity as the target, the strain is identified through polyphasic analysis of 16S rRNA gene phylogenetic analysis, whole genome sequence analysis, and morphological and physiological biochemical characteristics. After clarifying and refining the taxonomic position of the strain, the culture conditions of the strain are optimized to improve its ammonia nitrogen removal rate, providing strain resources and potential functional products for efficient biological ammonia removal and deodorization. Attached Figure Description

[0021] Figure 1 The ammonia nitrogen removal rate of strain Y3 in this invention is given.

[0022] Figure 2 This is the growth curve of strain Y3 in this invention.

[0023] Figure 3 The colony and cell morphology of strain Y3 in this invention are shown; wherein, Figure 3 Figure A in the diagram shows the colony morphology of strain Y3; Figure 3 Figure B in the figure shows the cell morphology of strain Y3.

[0024] Figure 4 This is a phylogenetic tree of the 16S rRNA gene of strain Y3 in this invention.

[0025] Figure 5 This is the phylogenetic tree of strain Y3 in this invention.

[0026] Figure 6These are the ANI values ​​of strain Y3 and the reference strain in this invention, where: 1: Y3; 2: ... Priestia aryabhattai JCM 13839; 3: Priestia megaterium ATCC 14581T; 4: Metabacillus herbersteinensis CCM 7228; 5: Bacillus basilensis 403507-21; 6: Robertmurraya yapensis XXST-01; 7: Viridibacillus soli YIM B01967; 8: Bacillus suaedaesalsae RD4P76; 9: Pseudoneobacillus rhizosphaerae CIP 111885T; 10: Bacillus pretiosus SAICEU11T;11: Bacillus proteolyticus MCCC 1A00365; 12: Bacillus songklensis CCUG 61889; 13: Bacillus nitratireducens 4049; 14: Metabacillus iocasae DSM 104297T; 15: Priestia flexa NBRC 15715T; 16: Priestia veravalensis SGD-V-76T.

[0027] Figure 7 This invention illustrates the effect of pH on the growth of strain Y3.

[0028] Figure 8 This illustrates the effect of temperature on the growth of strain Y3 in this invention.

[0029] Figure 9 This invention illustrates the effect of different carbon sources on the growth of strain Y3.

[0030] Figure 10 This invention illustrates the effect of different carbon-nitrogen ratios on the growth of strain Y3.

[0031] Figure 11 The ammonia nitrogen removal rate of strain Y3 in this invention is given. Detailed Implementation

[0032] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0033] Example 1: Screening and identification of strain Y3

[0034] 1. Screening of strain Y3

[0035] Take 5g of compost sample (with 5 glass beads of 3mm diameter) and add them to 100mL of enrichment medium. Incubate at 30℃ and 180r·min. -1 After continuous constant temperature culture on a shaker until turbidity is reached, 5 mL of culture medium is added to 100 mL of fresh enrichment medium. The same operation is repeated four times to obtain the enriched bacterial solution.

[0036] The compost came from Tangshan Dabeinong Livestock Farm.

[0037] The enrichment medium is a liquid culture medium with the following composition: 5.0g sucrose, 5.0mL ammonia water (concentration of 26%, filtered and sterilized before addition), 2.0g sodium chloride, 2.0g potassium dihydrogen phosphate, 0.05g zinc sulfate, 2.0g peptone, 0.5g magnesium sulfate, 0.04g ferrous sulfate, and 1000mL distilled water.

[0038] Take 100 μL of the enriched bacterial solution and mix it with sterile water at a volume ratio of 1:9. Then, take another 100 μL of the mixed solution and mix it with sterile water at a volume ratio of 1:9. Repeat the above steps to dilute the bacterial solution concentration to 10. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 and 10 -8 Take 0.1 mL of each of the following solutions, resulting in a dilution factor of 10: -5 10 -6 10 -7 and 10 -8 The bacterial suspension was inoculated onto screening agar plates, with each dilution gradient replicated three times, and incubated upside down in a 30°C incubator. Single colonies were picked up with sterilized toothpicks and repeatedly streaked for isolation and purification until no contaminants were observed under a microscope. Ten strains were selected, and the pure strains were preserved in 40% glycerol (v / v) and stored in an ultra-low temperature freezer at -80°C for subsequent experiments.

[0039] Of these, 10 strains were selected and named as belonging to the genus *Pseudomonas* (…). Amycolatopsis sp.), Burkholderia spp. ( Paraburkholderia sp.), Pseudomonas (sp.), Pseudomonas spp. Pseudomonas One strain each of *Bacillus subtilis* sp. and *Bacillus* spp. Bacillus sp.), Lactobacillus ( Lactiplantibacillus sp.), Priestella ( Priestia Two strains of each of *Bacillus* sp., and two strains of *Bacillus* spp. Brevibacillus sp.) one strain.

[0040] Ten strains preserved in glycerol were inoculated into 100 mL of LB liquid medium for activation, and then inoculated into 100 mL of heterotrophic nitrification medium at a 5% (v / v) inoculation rate, at 180 rpm. -1 Incubate at a constant temperature of 30℃. At 24h and 48h of incubation, take 5mL of bacterial suspension in a clean bench and incubate at 12000r·min. -1 Centrifuge for 2 min, take the supernatant and determine the ammonia nitrogen content in the solution according to the steps in "HJ 533-2009 Determination of Ammonia in Ambient Air and Waste Gas by Nessler's Reagent Spectrophotometric Method". Calculate the residual ammonia nitrogen content in the solution according to formula (11), and then calculate the ammonia nitrogen removal rate of the strain according to formula (2). Compare the ammonia oxidation capacity of each strain and select the strain with better ammonia removal effect for subsequent experiments.

[0041] (1);

[0042] In the above formula, A 菌 The absorbance of the added bacterial solution; A 白 α is the absorbance of the blank control group; a is the intercept of the calibration curve; b is the slope of the calibration curve; V is the sample volume in mL.

[0043] (2);

[0044] In the above formula: ammonia nitrogen content CK The ammonia nitrogen content in an equal volume of uninoculated heterotrophic nitrification medium is expressed in mg·L⁻¹. -1 ammonia nitrogen content 菌 The ammonia nitrogen content in the heterotrophic nitrification medium after inoculation of equal volumes is expressed in mg·L. -1 .

[0045] The heterotrophic nitrification medium, a liquid medium, was prepared from the following raw materials at a final concentration: (NH4)2SO4 1.42 g·L⁻¹. -1 MgSO4 0.06 g·L -1 12.25 g·L⁻¹ Na₃C₆H₅O₇ -1 0.25 g·L⁻¹ K₂HPO₄ -1 NaCl 0.125 g·L -1 Fe2(SO4)3 0.0025 g·L -1 and MnSO4 0.001 g·L -1 .

[0046] The selected strains were further inoculated into 100 mL of LB liquid medium and incubated at 30 °C and 180 rpm.-1 Under shaking conditions, culture for 20 hours until the liquid becomes turbid. Then, add 3 mL of the activated bacterial solution to 100 mL of heterotrophic nitrification medium and incubate at 180 rpm. -1 The samples were continuously shaken and cultured at 30℃ for 24 hours, with samples taken every 2 hours for each group to measure OD. 600 To determine the OD value, on a clean bench, transfer 5 mL of sterile liquid culture medium into a cuvette, select 600 nm, press the BLANK button, discard the culture medium, and then transfer another 5 mL of the test bacterial suspension to measure its value. Finally, plot the incubation time of the strain on the x-axis and measure the OD value. 600 The values ​​are plotted on the ordinate to create growth curves. Strains with fast growth rates and strong ammonia oxidation capabilities are selected for further experiments based on their growth rate and ammonia nitrogen removal rate.

[0047] The results are as follows Figure 1 and Figure 2 As shown, strain Y3 had the highest ammonia removal efficiency, with ammonia nitrogen removal rates greater than 40% at both 24h and 48h. Considering the strain's growth rate, strain Y3 was selected for subsequent experiments.

[0048] 2. Identification of strain Y3

[0049] Strain Y3 was identified and described using a multiphasic identification method, including molecular biological identification and phenotypic characteristic observation, proving that it belongs to a potential new species in the genus *Priscilla*. Details are as follows:

[0050] (1) Analysis of colony morphology characteristics

[0051] Strain Y3 was Gram-negative. After incubation on LB medium at 30°C for 24 h, the colonies of strain Y3 were 4 mm to 5 mm in diameter, yellow, round, translucent, moist, glossy, and with neat edges. The bacterial cells were rod-shaped, with a width of 12 μm to 15 μm and a length of 20 μm to 25 μm. Figure 3 ).

[0052] (2) 16S rRNA sequence analysis:

[0053] Genomic DNA was extracted from the strain using a bacterial DNA extraction kit. Using the genomic DNA of strain Y3 as a template, the 16S rRNA gene was amplified using universal primers 27F and 1492R, following the PCR reaction system and procedure shown in Tables 1 and 2. After splicing, the similarity was compared with bacteria in the NCBI online BLAST program, and a phylogenetic tree of the 16S rRNA gene was constructed using MEGA 11 software to determine the phylogenetic relationship between strain Y3 and closely related strains.

[0054] The bacterial DNA extraction kit was purchased from Beijing Bomed Gene Technology Co., Ltd.

[0055] The nucleotide sequence of universal primer 27F is shown in SEQ ID NO.2: 5'~AGAGTTTGATCCTGGCTCAG~3'.

[0056] The nucleotide sequence of 1492R is shown in SEQ ID NO.3: 5'~GGTTACCTTGTTACGACTT~3'.

[0057] Table 1 Reaction system (50µL)

[0058]

[0059] Table 2 Reaction Procedure

[0060]

[0061] Note: "-" indicates that this step is not repeated.

[0062] The results are as follows Figure 4 As shown, strain Y3 and *Priscilla auriculata* (…) P. aryabhattai JCM 13839) is the most closely related phylogenetically. Therefore, strain Y3 was identified as Priestella Y3.

[0063] (3) Whole genome sequence analysis

[0064] Strain Y3 was sent to Beijing Aovisen Gene Technology Co., Ltd. for second-generation and third-generation whole-genome sequencing. Using the Ilimina Hiseq sequencing platform and the PacBio RS II real-time sequencing platform, the established library underwent whole-genome sequencing analysis. The data was then assembled and corrected using software. A phylogenetic tree was constructed using the Type (Strain) Genome Server (TYGS). To more accurately determine the strain's taxonomic position, the strain's whole-genome sequence was uploaded to the online platform JSpecies Web Server and compared with all known strains in the Genbank database. The average nucleotide similarity (ANI) between the two strains was calculated. DNA-DNA hybridization (dDDH) values ​​were obtained using the TYGS platform and compared with known strains in the database, and a phylogenetic tree of the whole-genome sequence was constructed.

[0065] The results are as follows Figure 5 . Figure 6As shown in Table 3, the complete genome size of strain Y3 is 9 Mb, the N50 read length of the genome completion map is 5202769 bp, the G+C mol% content of the genome is 38.08%, and 5879 coding genes were predicted. A phylogenetic tree was used to compare this strain with... Priestia aryabhattai JCM 13839 is a separate strain, but the dDDH and ANIb values ​​of strain Y3 and similar standard strains are between 20.0% and 67.9% and 66.8% and 95.6%, respectively. Furthermore, strain Y3 is most closely related to the standard strain. P. aryabhattai The dDDH and ANIb values ​​of JCM 13839 were 67.9% and 95.6%, respectively, both below the threshold for new species classification, proving that strain Y3 is a new species in the genus *Priscilla*.

[0066] The nucleotide sequence of the 16S rDNA of Priscilla Y3 is shown in SEQ ID NO.1:

[0067] .

[0068] Currently, *Priestella Y3* is deposited at the China General Microbiological Culture Collection Center, with accession number 34006, and the address of the depository is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing.

[0069] Table 3. dDDH values ​​of strain Y3 and reference strain

[0070]

[0071] (4) Physiological and biochemical characteristics

[0072] The results of API 20E enzyme activity detection, as shown in Table 4, indicate that strain Y3 can utilize o-nitrophenyl galactoside, arginine, pyruvate, and Kohn gelatin. Further investigation revealed that strain Y3 lacks metabolic response to amino acids such as lysine and ornithine, inorganic salts such as sodium thiosulfate, and nitrogen-containing heterocyclic compounds such as urea and tryptophan. Detection of sugar alcohol substrates showed that strain Y3 also lacks the ability to utilize common carbohydrates such as inositol, sorbitol, rhamnose, sucrose, and melibiose, and is also unable to utilize plant-derived glycosides such as amygdalin and arabinose.

[0073] Table 4 Physiological and biochemical indicators of strain Y3

[0074]

[0075] Note: "+" indicates a positive reaction, and "-" indicates a negative reaction.

[0076] Example 2: Culture conditions of strain Y3

[0077] This invention provides a cultivation method suitable for the growth of strain Y3 and achieving a high ammonia nitrogen removal rate. Optimization conditions include pH, temperature, carbon source, and carbon-to-nitrogen ratio. The optimal culture medium is determined using the growth rate of strain Y3 as the measurement index.

[0078] (1) pH optimization

[0079] Prepare LB liquid medium and heterotrophic nitrification medium. After autoclaving, inoculate strain Y3 into 100 mL of LB liquid medium using an inoculation loop for activation. Incubate at 30 °C and 180 rpm. -1 After culturing on a shaker for 24 hours, the culture medium was inoculated into 100 mL of heterotrophic nitrification medium and cultured at pH values ​​of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0. After sterilization of the heterotrophic nitrification medium, 0.1 mol·L⁻¹ solution was used. -1 dilute hydrochloric acid and 0.1 mol·L -1 The pH of the heterotrophic nitrification medium was adjusted with sodium hydroxide solution, and three replicates were set for each pH. The medium was heated at 30°C and 180 r·min. -1 The culture was incubated on a shaker for 24 hours. Every 2 hours, the optical density of the bacterial culture was measured at a wavelength of 600 nm using a spectrophotometer with a blank culture medium as the calibration.

[0080] The results are as follows Figure 7As shown, strain Y3 grows in the pH range of 6.0 to 10.0, with the optimal pH being 9.0. After 8 hours of shaking culture, the bacterial concentration reaches its peak, with the highest OD value being 0.995.

[0081] (2) Temperature optimization

[0082] Prepare LB liquid medium and heterotrophic nitrification medium. After autoclaving, inoculate strain Y3 into 100 mL of LB liquid medium using an inoculation loop for activation. Incubate at 30 °C and 180 r·min. -1 After 24 hours of shaking culture, the culture medium was inoculated into 100 mL of heterotrophic nitrification medium and cultured at temperatures of 25℃, 30℃, 35℃, 40℃, 45℃, and 50℃, with three replicates at each temperature. At 30℃, the culture temperature was 180 r·min. -1 The culture was incubated on a shaker for 24 hours. Every 2 hours, the optical density of the bacterial culture was measured at a wavelength of 600 nm using a spectrophotometer with a blank culture medium as the calibration.

[0083] The results are as follows Figure 8 As shown, strain Y3 grows in the temperature range of 25℃ to 40℃, with the optimum temperature being 40℃. After 6 hours of cultivation, the bacterial concentration reaches a peak of 1.246.

[0084] (3) Carbon source optimization

[0085] Prepare LB liquid medium and heterotrophic nitrification medium. After autoclaving, inoculate strain Y3 into 100 mL of LB liquid medium using an inoculation loop for activation. Incubate at 30 °C and 180 r·min. -1 After 24 hours of shaking culture, 5% (v / v) of the bacterial solution was inoculated into culture media with glucose, mannitol, sodium acetate, sodium succinate, sodium pyruvate, and trisodium citrate as carbon sources, respectively. Three replicates were set up for each culture medium. The optical density of the bacterial solution was measured at 600 nm using a spectrophotometer with blank culture medium as calibration at 0 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, 24 h, and 48 h.

[0086] The results are as follows Figure 9 As shown, using trisodium citrate as a carbon source is most favorable for the growth of strain Y3.

[0087] (4) Optimization of carbon-nitrogen ratio

[0088] Prepare LB liquid medium and heterotrophic nitrification medium. After autoclaving, inoculate strain Y3 into 100 mL of LB liquid medium using an inoculation loop for activation. Incubate at 30 °C and 180 r·min. -1 After 24 hours of shaking culture, the nitrogen content in the modified culture medium was fixed at 100 mg·L⁻¹. -1Different amounts of the optimal carbon source were added to culture media with C / N ratios of 4, 8, 12, 16, 20 and 24, respectively. Under aseptic conditions, 5% (v / v) bacterial suspension was inoculated, and the optical density of the bacterial suspension was measured at a wavelength of 600 nm using a spectrophotometer with blank culture medium as calibration at 0 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, 24 h and 48 h, respectively.

[0089] The results are as follows Figure 10 As shown, a suitable C / N ratio is beneficial to the growth of the strain. The optimal C / N ratio for strain Y3 is 8 and 12. A C / N ratio that is too low is detrimental to the growth of the strain due to insufficient carbon source, while a C / N ratio that is too high will also inhibit the growth of the strain to some extent due to the imbalance of the C / N ratio.

[0090] Example 3: Ammonia nitrogen removal rate of strain Y3

[0091] The strain Y3 was cultured under the optimal culture conditions obtained above. Under aseptic conditions, 5% bacterial culture was inoculated, and three replicates were set up for each culture medium. The absorbance at a wavelength of 420 nm was measured at 0h, 2h, 4h, 6h, 8h, 10h, 12h, 24h and 48h, respectively, and the ammonia nitrogen removal rate was calculated.

[0092] The optimal culture conditions were: pH 8.0, temperature 40℃, trisodium citrate as the carbon source, and carbon-nitrogen ratio of 12.

[0093] The results are as follows Figure 11 As shown, the optimal ammonia nitrogen removal rate of strain Y3 was 41.63% and 42.70% after 48 h of cultivation under C / N ratios of 8 and 12.

[0094] The results above indicate that among the 10 strains screened from soil and compost environments, strain Y3 exhibits the fastest growth rate and the strongest ammonia oxidation capacity. Polyphasic taxonomic identification revealed that it is related to the strain... P. aryabhattai JCM 13839 is the most closely related species and is a potential new species. Strain Y3 showed a high removal rate under optimized culture conditions with pH 9.0, temperature 40℃, trisodium citrate as the carbon source, and a carbon-to-nitrogen ratio of 8 or 12.

[0095] In summary, this invention screened a strain with strong ammonia oxidation ability from the composting environment, and its ammonia nitrogen removal rate can reach 42.70% after the culture medium was optimized.

[0096] It should be noted that when numerical ranges are involved in this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, this invention describes preferred embodiments.

[0097] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments, all of which fall within the scope of the invention.

Claims

1. A Pristinamycetin strain Y3, characterized in that, The Priestella ( Priestia sp. Y3 was deposited on March 28, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCCNO.34006.

2. The P. albus Y3 strain according to claim 1, characterized in that, The nucleotide sequence of 16S rRNA of the Priestia sp. Y3 is shown as SEQ ID NO.

1.

3. A microbial inoculant, characterized in that, The Priestia sp. Y3 according to claim 1.

4. The use of the microorganism of claim 1 or the microbial inoculant of claim 3 for removing ammonia nitrogen from waste, characterized in that, The waste includes at least one of ammonia-nitrogen-containing wastewater, landfill leachate and livestock manure.

5. Use according to claim 4, characterized in that, The Priestia sp. Y3 or the microbial agent is added to the ammonia-nitrogen-containing wastewater for reaction.

6. Use according to claim 5, characterized in that, The Priestia sp. Y3 or the microbial agent is used for metabolizing ammonia-nitrogen in the ammonia-nitrogen-containing wastewater through nitrification.

7. Use according to claim 5, characterized in that, The volume ratio of the Priestia sp. Y3 or the microbial agent added to the ammonia-nitrogen-containing wastewater is 1% to 5%.

8. Use according to claim 7, characterized in that, The OD of the *Priscilla Y3* or the microbial agent 600 The value is 1.6~1.

8.

9. Use according to claim 5, characterized in that, The reaction condition is pH 7.8 to 8.2, temperature 34℃ to 36℃ and C / N 12; wherein, C / N refers to carbon-nitrogen ratio.

10. Use according to claim 5, characterized in that, The ammonia-nitrogen concentration in the ammonia-nitrogen-containing wastewater is 200 mg / L to 500 mg / L.

Citation Information

Patent Citations

  • Prristeria sp. And application thereof

    CN118685309A

  • Prussella sp. And application thereof

    CN119570667A