Method for detecting nucleotide sequence of coded mouse monoclonal antibody by using IgG variable region signal peptide

Abstract

The invention discloses a method for detecting a nucleotide sequence of a coded mouse monoclonal antibody by using an IgG variable region signal peptide. The invention provides a method for detecting a nucleic acid sequence of a variable region of a coded mouse monoclonal antibody, which comprises the following steps: extracting mRNA (messenger ribonucleic acid) from a mouse hybridoma cell secreting a mouse monoclonal antibody to be detected, and carrying out reverse transcription to obtain cDNA (complementary deoxyribonucleic acid); the cDNA is taken as a template, PCR amplification is carried out, a front primer in a used primer pair is located in a signal peptide region of a variable region of a coding mouse monoclonal antibody, and a rear primer is located in a constant region; and sequencing the obtained amplification product to obtain a nucleic acid sequence for coding the variable region of the mouse monoclonal antibody to be detected. The method provided by the invention can be used for more completely and more accurately determining the nucleic acid sequences of the IgG heavy chain and light chain genes, and provides a basis for subsequent further engineering.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for detecting a nucleic acid sequence encoding a mouse monoclonal antibody by utilizing an IgG variable region signal peptide. Background Art

[0002] Immunoglobulins (Ig) are polyclonal or monoclonal antibodies secreted by B lymphocytes (plasma cells) and include five types: IgM, IgG, IgA, IgE, and IgD. IgM is produced early upon antigen exposure, followed by IgG, which is the predominant antibody type. The basic structure of IgG consists of a Y-shaped structure consisting of two heavy (H) chains and two light (L) chains. The heavy and light chains of an antibody contain genes encoding the variable region (VR) and constant region (CR), respectively. The genes encoding the variable region are unique in that they consist of several separate gene segments during B cell lineage development, which are then rearranged to form a continuous gene. These gene segments include the variable (V), diversity (D), and joining (J) regions, designated V, D, and J regions, respectively. Gene rearrangement occurs first at the heavy chain (IgH) locus and then at the light chain (IgK or IgL) loci. According to the central dogma of molecular biology, after V(D)J rearrangement, the gene is transcribed into messenger RNA (mRNA), then translated into protein in the ribosome, and then undergoes post-translational modification to form an Ig molecule. Common IgG molecules contain an antigen-binding fragment (Fab), a hinge region, and a crystallizable fragment (Fc). Fab is composed of the IgG heavy chain variable region (VH), constant region 1 (CH1), and the light chain variable region (VL) and constant region (CL), responsible for binding to specific antigens with high affinity. The Fc segment is composed of the heavy chain constant regions 2 (CH2) and 3 (CH3), responsible for binding to immune cell receptors or complement to trigger effector functions.

[0003] The IgG heavy chain variable region is composed of four framework regions (FR) and three complementarity-determining regions (CDR) arranged in alternating patterns. The variable sequences generated by V(D)J rearrangement are primarily located in the CDR region, which determines the antibody's specificity and affinity for antigen binding. The FR region is closely related to the antibody's germline.

[0004] Monoclonal antibodies (mAbs) are produced by a single B cell clone and recognize a single epitope on an antigen (usually a protein). They are highly specific and structurally identical to IgG antibodies. mAbs targeting a specific antigen are typically obtained through artificial methods such as hybridoma technology or recombinant DNA technology. Mouse hybridoma technology remains a mainstream technology for obtaining antibodies specific for human disease-associated proteins, widely used in targeted tumor therapy, tumor immunotherapy, and the treatment of autoimmune diseases. Immunization protocols are typically formulated based on the characteristics of the antigen. Balb / c mice are used as the immunization animals, and splenic lymphocytes from these mice are fused with myeloma cells of the same strain. Hybridomas are then screened on a specialized culture medium to generate the hybridomas. Once the fused hybridomas are obtained, further screening for specific antibodies is required. The fused cells are diluted sufficiently to a limit so that the number of cells distributed into each well of the culture plate ranges from one to several cells. After culture, the supernatant is collected and selected using ELISA to identify cells with high antibody secretion. This process is often referred to as cloning. These cloned positive cell lines are called monoclonal cell lines and are used for mAb production. After proliferation, monoclonal cell lines are cultured in vitro or cryopreserved. mAbs produced by mouse splenic B lymphocytes against specific antigens are encoded by V(D)J rearrangement genes. Engineering these antibodies requires analysis of the mAb gene coding sequence.

[0005] The traditional method for analyzing the gene coding sequence of mAbs is to design upstream degenerate primers (a mixture of over 100 primers) and downstream constant region primers targeting the DNA sequence at the beginning of the framework 1 region (FR1). The heavy and light chain FR1 regions and a portion of the constant region of the IgG are amplified, and then the mAb variable region and partial constant region sequences are obtained using first-generation (Sanger) sequencing. Specifically, mouse hybridoma mRNA is reverse-transcribed into cDNA, which is used as a template. Upstream degenerate primers are designed targeting the beginning of the heavy and light chain FR1 regions, and downstream primers are designed targeting the constant region as a template. After PCR (polymerase chain reaction) amplification, the purified PCR product is subjected to traditional first-generation sequencing to analyze the mAb variable region sequence.

[0006] Traditional methods target the FR1 nucleic acid sequence using PCR with over 100 degenerate primers. Because primer-template binding requires a perfect match between the 3' end DNA sequence and the 5' end, incomplete matching is permitted. Furthermore, even first-generation sequencing cannot fully sequence the primer-binding region of the DNA template. While PCR products can be loaded into a vector to address this issue, this method is time-consuming and labor-intensive. Consequently, traditional degenerate primer-based PCR sequencing yields incomplete FR1 region sequences. Second-generation high-throughput sequencing can also sequence cDNA from mouse hybridoma cells. This technique breaks the DNA into small fragments, captures them using chips or microbeads, and then sequences them separately. Finally, a program splices the sequences of each fragment into a complete sequence. Second-generation sequencing offers high efficiency, allowing it to read large amounts of data in a single pass, yielding a wealth of sequence information. However, read lengths are typically less than 150 nt. Since the DNA sequences encoding IgG are highly similar, and the second-generation sequencing has a short read length for each sequence, it involves the splicing of multiple short sequences. Therefore, problems such as incorrect amplification of small fragments and incorrect insertion of bases may occur during the splicing process, affecting the accuracy of the sequencing results. In this case, it is necessary to increase the sequencing depth for correction, which will increase the time and cost. At the same time, the second-generation sequencing instruments are relatively high-end, not only expensive, but also require professional personnel for instrument use and data processing. Therefore, they are not universal laboratory methods. The first-generation sequencing and second-generation sequencing methods each have their own advantages and disadvantages. Therefore, most laboratories currently choose the appropriate method to sequence antibody sequences based on their actual needs and cost budget. Summary of the Invention

[0007] The purpose of the present invention is to provide a method for detecting a nucleic acid sequence encoding a mouse monoclonal antibody using an IgG variable region signal peptide.

[0008] In a first aspect, the present invention claims a method for detecting a nucleic acid sequence encoding a variable region of a mouse monoclonal antibody.

[0009] The method for detecting the nucleic acid sequence encoding the variable region of a mouse monoclonal antibody claimed in the present invention may comprise the following steps:

[0010] (A1) extracting mRNA from mouse hybridoma cells secreting the mouse monoclonal antibody to be tested and reverse-transcribing it to obtain cDNA;

[0011] (A2) using the cDNA obtained in (A1) as a template, PCR amplification was performed using primer pair A and primer pair B, respectively;

[0012] The forward primer in the primer pair A is designed based on the nucleic acid sequence encoding the signal peptide located in the heavy chain variable region of a mouse monoclonal antibody (such as the signal peptide encoding nucleic acid sequence in the Ighv gene), and the rear primer is designed based on the nucleic acid sequence encoding the heavy chain constant region of a mouse monoclonal antibody;

[0013] The forward primer in primer pair B is designed based on the nucleic acid sequence encoding the signal peptide located before the light chain variable region of a mouse monoclonal antibody (such as the signal peptide encoding nucleic acid sequence in the Igkv gene), and the rear primer is designed based on the nucleic acid sequence encoding the light chain constant region of a mouse monoclonal antibody;

[0014] (A3) Sequencing the product obtained by PCR amplification of primer pair A in (A2) to obtain a nucleic acid sequence encoding the heavy chain variable region of the mouse monoclonal antibody to be tested; sequencing the product obtained by PCR amplification of primer pair B in (A2) to obtain a nucleic acid sequence encoding the light chain variable region of the mouse monoclonal antibody to be tested.

[0015] Furthermore, the forward primer in the primer pair A is designed based on the conserved region of the nucleic acid sequence encoding the signal peptide located in the heavy chain variable region of the mouse monoclonal antibody; the forward primer in the primer pair B is designed based on the conserved region of the nucleic acid sequence encoding the signal peptide located in front of the light chain variable region of the mouse monoclonal antibody.

[0016] The conserved region refers to a specific segment of the nucleotide sequence that remains highly stable and has an extremely low mutation rate during the evolution process (eg, the nucleotide sequence identity is greater than or equal to 80%).

[0017] Furthermore, when designing primers, the 5 consecutive nucleotides from the 3' end of both the forward primer in primer pair A and the forward primer in primer pair B completely match the conserved region of the nucleic acid sequence encoding the corresponding signal peptide.

[0018] Furthermore, the mouse monoclonal antibody is a mouse IgG monoclonal antibody. In one embodiment of the present invention, the light chain type of the mouse IgG monoclonal antibody is a kappa chain.

[0019] More specifically, the conserved regions of the nucleic acid sequences encoding the signal peptides of the heavy chain variable regions of the mouse monoclonal antibodies are shown in Table 1. The conserved regions of the nucleic acid sequences encoding the signal peptides of the light chain variable regions of the mouse monoclonal antibodies are shown in Table 2.

[0020] In the present invention, the front primer in the primer pair A can be selected from one or more of the following:

[0021] (a1) Primer H1 shown in SEQ ID No. 1 (corresponding to the Ighv gene subtype Ighv1-1);

[0022] (a2) Primer H2 shown in SEQ ID No. 2 (corresponding to the Ighv gene subtype Ighv1-2);

[0023] (a3) Primer H3 shown in SEQ ID No. 3 (corresponding to the Ighv gene subtype Ighv2);

[0024] (a4) Primer H4 shown in SEQ ID No. 4 (corresponding to the Ighv gene subtype Ighv3 / 12);

[0025] (a5) Primer H5 shown in SEQ ID No. 5 (corresponding to the Ighv gene subtype Ighv4 / 16);

[0026] (a6) Primer H6 shown in SEQ ID No. 6 (corresponding to the Ighv gene subtype Ighv5);

[0027] (a7) Primer H7 shown in SEQ ID No. 7 (corresponding to the Ighv gene subtype Ighv6);

[0028] (a8) Primer H8 shown in SEQ ID No. 8 (corresponding to the Ighv gene subtype Ighv7);

[0029] (a9) Primer H9 shown in SEQ ID No. 9 (corresponding to the Ighv gene subtype Ighv8);

[0030] (a10) Primer H10 shown in SEQ ID No. 10 (corresponding to the Ighv gene subtype Ighv9);

[0031] (a11) Primer H11 shown in SEQ ID No. 11 (corresponding to the Ighv gene subtype Ighv10);

[0032] (a12) Primer H12 shown in SEQ ID No. 12 (corresponding to the Ighv gene subtype Ighv11 / 13);

[0033] (a13) Primer H13 shown in SEQ ID No. 13 (corresponding Ighv gene subtype is Ighv14 / 15).

[0034] That is, different front primers correspond to different Ighv gene subtypes (different Ighv gene subtypes have different signal peptide sequences).

[0035] The rear primer in the primer pair A is primer CH1 shown in SEQ ID No. 29.

[0036] In the present invention, the front primer in the primer pair B can be selected from one or more of the following:

[0037] (b1) Primer K1 shown in SEQ ID No. 14 (corresponding to the Igkv gene subtype Igkv1-1);

[0038] (b2) Primer K2 shown in SEQ ID No. 15 (corresponding to the Igkv gene subtype Igkv1-2);

[0039] (b3) Primer K3 shown in SEQ ID No. 16 (corresponding to the Igkv gene subtype Igkv2);

[0040] (b4) Primer K4 shown in SEQ ID No. 17 (corresponding to the Igkv gene subtype Igkv3);

[0041] (b5) Primer K5 shown in SEQ ID No. 18 (corresponding to the Igkv gene subtype Igkv4);

[0042] (b6) Primer K6 shown in SEQ ID No. 19 (corresponding to the Igkv gene subtype Igkv5);

[0043] (b7) Primer K7 shown in SEQ ID No. 20 (corresponding to the Igkv gene subtype Igkv6 / 7);

[0044] (b8) Primer K8 shown in SEQ ID No. 21 (corresponding to the Igkv gene subtype Igkv8);

[0045] (b9) Primer K9 shown in SEQ ID No. 22 (corresponding to the Igkv gene subtype Igkv9);

[0046] (b10) Primer K10 shown in SEQ ID No. 23 (corresponding to the Igkv gene subtype Igkv10 / 11);

[0047] (b11) Primer K11 shown in SEQ ID No. 24 (corresponding to the Igkv gene subtype Igkv12 / 15-1);

[0048] (b12) Primer K12 shown in SEQ ID No. 25 (corresponding to the Igkv gene subtype Igkv13);

[0049] (b13) Primer K13 shown in SEQ ID No. 26 (corresponding to the Igkv gene subtype Igkv14);

[0050] (b14) Primer K14 shown in SEQ ID No. 27 (corresponding to the Igkv gene subtype Igkv15-2 / 16 / 19);

[0051] (b15) Primer K15 shown in SEQ ID No. 28 (corresponding Igkv gene subtype is Igkv17 / 18 / 20).

[0052] That is, different forward primers correspond to different Igkv gene subtypes (different Igkv gene subtypes have different signal peptide sequences).

[0053] The rear primer in the primer pair B is the primer CL shown in SEQ ID No.30.

[0054] Because the monoclonal antibody secreted by a specific hybridoma cell line is unique, and the subtypes of its Ighv and Igkv genes and the signal peptide sequences of the light and heavy chain variable regions of a fixed monoclonal antibody are determined, the appropriate primers for detecting the variable region-encoding nucleic acid sequence of the secreted monoclonal antibody of a specific hybridoma cell are not determined. Therefore, in actual testing, all forward primers are typically combined with the rear primers to form primer pairs, and then PCR amplification is performed one by one. Amplified products are subsequently sequenced (most do not).

[0055] That is, the specific operations of (A2) and (A3) mentioned above are as follows:

[0056] Using the cDNA obtained in (A1) as a template, PCR amplification is performed using each primer pair in primer pair group A, and the amplification products obtained by the primer pairs that produce amplification products (most primer pairs do not produce amplification products, and one or a few primer pairs produce amplification products) are sequenced to obtain a nucleic acid sequence encoding the heavy chain variable region of the mouse monoclonal antibody to be tested; Using the cDNA obtained in (A1) as a template, PCR amplification is performed using each primer pair in primer pair group B, and the amplification products obtained by the primer pairs that produce amplification products (most primer pairs do not produce amplification products, and one or a few primer pairs produce amplification products) are sequenced to obtain a nucleic acid sequence encoding the light chain variable region of the mouse monoclonal antibody to be tested;

[0057] In the primer pair group A, the forward primers in each primer pair are designed based on the nucleic acid sequence encoding the signal peptide located in the heavy chain variable region of the mouse monoclonal antibody, and the only difference is that the forward primers in different primer pairs correspond to different Ighv gene subtypes; further, the primer pair group A consists of a total of 13 primer pairs, and the forward primers in the 13 primer pairs are as shown in (a1) to (a13) above, and the rear primers are all the primers CH1 described above;

[0058] In the primer pair group B, the forward primers in each primer pair are designed based on the nucleic acid sequence encoding the signal peptide located in the light chain variable region of the mouse monoclonal antibody, and the only difference is that the forward primers in different primer pairs correspond to different Igkv gene subtypes; further, the primer pair group B consists of a total of 15 primer pairs, and the forward primers in the 15 primer pairs are shown as (b1) to (b15) above, and the rear primers are all the primers CL described above.

[0059] Furthermore, in step (A3), the sequencing is Sanger sequencing.

[0060] Furthermore, in step (A3), after sequencing, the obtained sequence information is analyzed using a bioinformatics tool to determine whether the obtained sequence is an antibody functional gene sequence (the purpose is to exclude pseudogenes and screen out functional genes). The bioinformatics tool can be IgBLAST (Immunoglobulin BLAST).

[0061] In a second aspect, the present invention claims a set of primer pairs for detecting nucleic acid sequences encoding the variable regions of mouse monoclonal antibodies.

[0062] The set of primer pairs for detecting nucleic acid sequences encoding mouse monoclonal antibody variable regions claimed in the present invention consists of primer pair group A and primer pair group B;

[0063] The primer pair group A consists of 13 primer pairs, wherein the front primers of the 13 primer pairs are as shown in (a1) to (a13) described above (i.e., SEQ ID No. 1 to SEQ ID No. 13), and the back primers are all the primer CH1 described above (i.e., SEQ ID No. 29);

[0064] The primer pair group B consists of 15 primer pairs, the front primers in the 15 primer pairs are as shown in (b1) to (b15) described above (i.e., SEQ ID No.14 to SEQ ID No.28), and the rear primers are all the primers CL described above (i.e., SEQ ID No.30).

[0065] In a third aspect, the present invention claims a primer pair set for detecting a nucleic acid sequence encoding a heavy chain variable region of a mouse monoclonal antibody.

[0066] The primer pair group for detecting the nucleic acid sequence encoding the heavy chain variable region of the mouse monoclonal antibody claimed in the present invention is the primer pair group A described in the second aspect above.

[0067] In a fourth aspect, the present invention claims a primer pair set for detecting a nucleic acid sequence encoding a light chain variable region of a mouse monoclonal antibody.

[0068] The primer pair group for detecting the nucleic acid sequence encoding the light chain variable region of a mouse monoclonal antibody claimed in the present invention is the primer pair group B described in the second aspect above.

[0069] In a fifth aspect, the present invention claims the use of the set of primer pairs described in the second aspect above in detecting nucleic acid sequences encoding the variable regions of mouse monoclonal antibodies.

[0070] In a sixth aspect, the present invention claims protection for the use of the primer pair group described in the third aspect above (ie, the primer pair group A described in the second aspect above) in detecting nucleic acid sequences encoding the heavy chain variable region of a mouse monoclonal antibody.

[0071] In a seventh aspect, the present invention claims protection for the use of the primer pair group described in the fourth aspect above (i.e., primer pair group B described in the second aspect above) in detecting nucleic acid sequences encoding the light chain variable region of a mouse monoclonal antibody.

[0072] In the related aspects above, the mouse monoclonal antibody is a murine IgG monoclonal antibody.

[0073] Furthermore, the light chain type of the murine IgG monoclonal antibody is a κ chain.

[0074] The present invention collects and organizes the coding genes of mouse heavy chains and light chains in the database. Through multiple nucleic acid sequence alignment and analysis, it is found that there is a conserved nucleic acid (DNA) sequence of about 21-31 nt in the signal peptide region of the mouse IgG heavy chain and light chain variable region genes, which can be used as the starting position for nucleic acid amplification of the IgG gene. Using the DNA at this position as the front primer and the DNA encoding the constant region of the IgG heavy chain or light chain as the back primer, nucleic acid amplification is performed to obtain a more complete and accurate variable region sequence of the monoclonal antibody.

[0075] Beneficial effects of the present invention: The method of the present invention (named the SP primer method) can more completely and accurately determine the nucleic acid sequences of IgG heavy chain and light chain (kappa) genes, and more completely and accurately analyze the nucleic acid (DNA) coding sequences of the heavy and light chains of mouse monoclonal antibodies against human proteins, providing a simple and reliable method for the application of mouse monoclonal antibody humanization and chimeric antigen receptors, and providing a basis for subsequent further engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] Figure 1 Rearrangement and transcription of the genes encoding IgG heavy and light chains. The white rectangle represents the signal peptide (L), the black rectangle represents the variable region, and the red rectangle represents the constant region. (Source: Sun et al. Annu. Rev. Anim. Biosci. 2020. 8:145–69)

[0077] Figure 2 The improved (SP primer) method and the traditional method show the primer positions and comparisons. VH and CH represent the heavy chain variable and constant regions, respectively; VL and CL represent the light chain variable and constant regions, respectively. The four FR regions and three CDR regions are arranged in an alternating pattern. SP represents the signal peptide. The forward primer is "F" and the reverse primer is "R."

[0078] Figure 3 This figure shows the alignment and conservation analysis of the signal peptides encoding mouse IgG heavy chain genes (Part 1). (a) shows a multiple alignment analysis of the DNA sequence of the Ighv1-1 gene signal peptide; (b) shows a multiple alignment analysis of the DNA sequence of the Ighv1-2 gene signal peptide. The numbers in the figure indicate the location of the signal peptide DNA. The size of the DNA letters reflects the frequency of sequence occurrence; large, single-letter fonts indicate high conservation.

[0079] Figure 4 This figure shows the alignment and conservation analysis of the signal peptides encoded by mouse IgG heavy chain genes (Part II). (a) shows the multiple alignment analysis of the DNA sequence of the Ighv2 gene signal peptide; (b) shows the multiple alignment analysis of the DNA sequence of the Ighv3 and Ighv12 gene signal peptides; (c) shows the multiple alignment analysis of the DNA sequence of the Ighv4 and Ighv16 gene signal peptides; (d) shows the multiple alignment analysis of the DNA sequence of the Ighv5 gene signal peptide; (e) shows the multiple alignment analysis of the DNA sequence of the Ighv6 gene signal peptide; and (f) shows the multiple alignment analysis of the DNA sequence of the Ighv7 gene signal peptide. The numbers in the figure indicate the location of the signal peptide DNA. The size of the DNA letters reflects the frequency of sequence occurrence. Large, single characters indicate high conservation.

[0080] Figure 5This figure shows the alignment and conservation analysis of the signal peptides encoded by mouse IgG heavy chain genes (Part 3). (a) shows the multiple alignment analysis of the DNA sequence of the Ighv8 gene signal peptide; (b) shows the multiple alignment analysis of the DNA sequence of the Ighv9 gene signal peptide; (c) shows the multiple alignment analysis of the DNA sequence of the Ighv10 gene signal peptide; (d) shows the multiple alignment analysis of the DNA sequence of the Ighv11 and Ighv13 gene signal peptides; and (e) shows the multiple alignment analysis of the DNA sequence of the Ighv14 and Ighv15 gene signal peptides. The numbers in the figure indicate the position of the signal peptide DNA. The size of the DNA letter reflects the frequency of sequence occurrence. Large, single fonts indicate high conservation.

[0081] Figure 6 This figure shows the alignment and conservation analysis of the signal peptides encoding mouse IgG light chain genes (Part 1). (a) shows a multiple alignment analysis of the DNA sequence of the Igkv1-1 gene signal peptide; (b) shows a multiple alignment analysis of the DNA sequence of the Igkv1-2 gene signal peptide. The numbers in the figure indicate the location of the signal peptide DNA. The size of the DNA letters reflects the frequency of sequence occurrence; large, single-letter fonts indicate high conservation.

[0082] Figure 7 This figure shows the alignment and conservation analysis of the signal peptides of mouse IgG light chain encoding genes (Part II). (a) shows the multiple alignment analysis of the DNA sequence of the Igkv2 gene signal peptide; (b) shows the multiple alignment analysis of the DNA sequence of the Igkv3 gene signal peptide; (c) shows the multiple alignment analysis of the DNA sequence of the Igkv4 gene signal peptide; (d) shows the multiple alignment analysis of the DNA sequence of the Igkv5 gene signal peptide; (e) shows the multiple alignment analysis of the DNA sequence of the Igkv6 and Igkv7 gene signal peptides; and (f) shows the multiple alignment analysis of the DNA sequence of the Igkv8 gene signal peptide. The numbers in the figure indicate the position of the signal peptide DNA. The size of the DNA letter reflects the frequency of sequence occurrence. Large, single fonts indicate high conservation.

[0083] Figure 8This figure shows the alignment and conservation analysis of the signal peptides of mouse IgG light chain encoding genes (Part 3). (a) shows the multiple alignment analysis of the DNA sequence of the Igkv9 gene signal peptide; (b) shows the multiple alignment analysis of the DNA sequence of the Igkv10 and Igkv11 gene signal peptides; (c) shows the multiple alignment analysis of the DNA sequence of the Igkv12 and Igkv15 gene signal peptides; (d) shows the multiple alignment analysis of the DNA sequence of the Igkv13 gene signal peptide; (e) shows the multiple alignment analysis of the DNA sequence of the Igkv14 gene signal peptide; (f) shows the multiple alignment analysis of the DNA sequence of the Igkv15, Igkv16, and Igkv19 gene signal peptides; and (g) shows the multiple alignment analysis of the DNA sequence of the Igkv17, Igkv18, and Igkv20 gene signal peptides. The numbers in the figure indicate the location of the signal peptide DNA. The size of the DNA letter reflects the frequency of sequence occurrence. Large and single fonts indicate high conservation.

[0084] Figure 9 This is a PCR electrophoresis analysis of hybridoma IgG heavy chain variable region SP primers. "Mark" indicates DNA size, and H1-H13 are IgG heavy chain V region SP primers (corresponding to Table 1).

[0085] Figure 10 This is a PCR electrophoresis analysis of hybridoma cells using SP primers for the variable region of the IgG light chain. "Mark" indicates DNA size, and K1-K15 are SP primers for the IgG light chain (kappa) V region (corresponding to Table 2).

[0086] Figure 11 Comparison of partial peaks from sequencing the heavy chain variable region of hybridoma cell line 10-5-1 using heavy chain FR1 primers (top) and SP primers (bottom). The red line indicates the additional, more complete and accurate sequence obtained using SP primers.

[0087] Figure 12 Comparison of partial peaks from sequencing the light chain variable region of hybridoma cell line 10-5-1 using primers targeting the light chain FR1 region (top) and SP primers (bottom). The red line indicates the additional, more complete and accurate sequence obtained using the SP primers. DETAILED DESCRIPTION

[0088] Polyclonal or monoclonal antibodies against human antigens (mainly proteins) are produced by mouse B lymphocytes. According to the central dogma, after antigen stimulation, mouse B lymphocytes undergo DNA V(D)J rearrangement, transcribe into pre-mRNA (Pri-RNA), and then form mature mRNA containing PolyA. The mouse monoclonal antibody is encoded by mRNA and translated into protein (antibody) on the ribosome.

[0089] In mature mRNA encoding monoclonal antibodies, the heavy chain consists of a signal peptide (SP) or leading sequence (L), a V(D)J rearrangement region, and a constant region, while the light chain consists of a signal peptide, a VJ rearrangement region, and a constant region ( Figure 1 ). The signal peptide (L or SP) is always in front of the V region and does not undergo rearrangement. The signal peptide is located at the N-terminus of the secretory protein or membrane protein. It is generally a short hydrophobic peptide of 15-30 amino acids, which guides the protein to organelles such as the endoplasmic reticulum for protein modification and processing, and becomes a mature protein after excision. The signal peptide of IgG or antibody can help the processing and transport of immunoglobulins within the cell and secrete them outside the cell. The signal peptide sequence (DNA) encoding the IgG heavy chain and light chain is located before the V region. It is retained when transcribed into mRNA and is also retained after reverse transcription, and it does not undergo rearrangement. Therefore, when analyzing the signal peptides of the mouse antibody (IgG) heavy chain and light chain, if there is sequence conservation, it can be used as a primer for PCR to amplify the nucleic acid sequences of the V(D)J rearrangement region and the constant region.

[0090] The complete IgG heavy chain mRNA includes a V region signal peptide (L or SP), variable region (four FR regions, three CDR regions), and constant regions CH1, CH2, and CH3. The IgG light chain mRNA includes a V region signal peptide (L), variable region (four FR regions, three CDR regions), and constant region CL. The V region signal peptide is followed by the heavy or light chain variable region, and the entire variable region can be amplified by PCR without rearrangement.

[0091] Currently, most monoclonal antibodies against human proteins are produced in mouse hybridoma cells. Humanized versions of these genes are then constructed and applied in pharmaceutical, basic, and clinical medicine. Decoding mAb-encoding genes requires in-depth analysis of the mouse IgG heavy and light chain variable regions. The common Balb / c and C57bl / 6 mouse IgG heavy chain Igh loci (germline Igh locus) are divided into 15 subclasses (Ighv1-Ighv15) before rearrangement. For details, see Watson et al. Immunology & Cell Biology 2019;97:888–901. The immunoglobulin database IMGT (https: / / www.imgt.org / ) contains 16 subclasses of mouse heavy chain Ighv genes. Genes encoding IgG heavy and light chains exhibit a biased and uneven distribution of subclasses, with approximately 40% of IgG heavy chains encoded by the Ighv1 subclass (Watson et al. 2019). Because 95% of mouse IgG light chains are kappa (κ) chains and only 5% are lambda (λ) chains (see Larijani et al. Molecular Immunology, 2006, 43(7): 870-881 for details), the present invention selected genes encoding kappa chains for mouse IgG research. The present invention collected a variety of mouse heavy and light chain DNA sequences from the IMGT database, merged DNA sequences with similar sequences from 16 subclasses of heavy chain Ighv, and obtained a total of 207 nucleic acid sequences from 13 types of mouse heavy chain genes. Similarly, the present invention searched the IMGT professional database (Giudicelli et al. Nucleic Acids Research, 2006, 34, D781-D784), collected 20 subclasses of mouse light chain (kappa) genes Igkv, merged nucleic acid sequences with similar subclasses, and obtained 123 nucleic acid sequences from 15 types of mouse light chain genes.

[0092] Multiple sequence alignment and visualization analysis were then performed using Weblogo (see Crook et al. Genome Research, 2004, 14:11188-1190). Conserved 21-31 nucleotides (nt) or DNA sequences were found in the signal peptide (SP or L) regions of both Ighv and Igkv genes encoding mouse antibodies (Tables 1 and 2). This conserved DNA sequence was suitable as a forward primer for PCR amplification to obtain the complete nucleic acid sequences of the IgG heavy and light chain variable regions.

[0093] Table 1. Conserved nucleic acid sequence of the Ighv signal peptide encoding the mouse IgG heavy chain gene

[0094] serial number DNA sequence(5'-3') V genotype Sp-Hv1-1 TTTGGTAGCAACAGCTACAGGTGTCCACT Ighv1-1 Sp-Hv1-2 TCTTCCTCCTGTCAGTAACTGCAGGTGT Ighv1-2 Sp-Hv2 TCTGCCTGGTGACATTCCCAAGCTGT Ighv2 Sp-Hv3-v12 GTACCTGTTGACAGCCCTTCCTGGTA Ighv3 / 12 Sp-Hv4-v16 TTTTTTTATTGTTGCTCTTTTAAAAGG Ighv4 / 16 Sp-Hv5 GATTTTCCTTGTCCTTATTTTAAAAGGTGT Ighv5 Sp-Hv6 CTGTGTTTTCATTGTTGTTCTCTTAAAAGG Ighv6 Sp-Hv7 ATGAAGTTGTGGCTGAACTGG Ighv7 Sp-Hv8 ATGGACAGGCTTACTTCCTCATTC Ighv8 Sp-Hv9 TGTGGAACTTGCTATTCCTGATGGCAGC Ighv9 Sp-Hv10 AAGTGGGTTTTCTTTGTTGTTTTTTATCAAG Ighv10 Sp-Hv11-v13 ACTGAGCTTAATTTTCATTTTTGCTCTTTT Ighv11 / 13 Sp-Hv14-v15 TGGGTCATCTTCTTCCTGATGGCAG Ighv14 / 15

[0095] Table 2. Conserved nucleic acid sequence of the Igkv signal peptide encoding the mouse IgG light chain gene

[0096] serial number DNA sequence(5'-3') V genotype Sp-Kv1-1 ATGAAGTTGCCTGTTAGGCTGTTGGTGCT Igkv1-1 Sp-kv1-2 TTTCTGTTTCTGTTAATGCTCTGGATT Igkv1-2 Sp-kv2 CTGGGGCTGCTTGTGCTCTGGATC Igkv2 Sp-kv3 CTCCTGCTATGGGTGCTGCTGCTCTG Igkv3 Sp-kv4 GTGCAGATTTTCAGCTTCCTGCTAATCAGTG Igkv4 Sp-kv5 CTTGGACTTATGCTTTTCTGGA Igkv5 Sp-kv6-v7 TTCGTATTGCTCTGGGTGTCTGGTG Igkv6 / 7 Sp-kv8 ATGTTCTTGCTGCTATGGGTATCTG Igkv8 Sp-kv9 TTTTGGCTTCTTGTTGCTGTGGTTTC Igkv9 Sp-kv10-v11 CTCTGCTCAGTTCCTTGGTCTCCTGTTG Igkv10 / 11 Sp-kv12-v15 CACTCAGCTCCTGGGGTTGCTGCTG Igkv12 / 15-1 Sp-kv13 ATGAAGTTTCCTTCTCAACTTCTGCTC Igkv13 Sp-kv14 ATCTTGTTGCTCTGGTTTCCAGG Igkv14 Sp-kv15-v16-v19 TCCATGTTCAGCTCCTGGGGCT Igkv15-2 / 16 / 19 Sp-kv17-v18-v20 ATGACCATGCTCTCACTAGCTC Igkv17 / 18 / 20

[0097] Structurally, monoclonal antibodies and IgG molecules have the same structure, and the 5' end of the heavy chain and light chain genes is a signal peptide (SP or L) and a variable region (V) sequence. The variable regions of the heavy chain and light chain are generally composed of four framework regions (FR) and three CDRs arranged alternately ( Figure 2 ). The traditional method for analyzing the coding sequence of mAb genes is to reverse transcribe the mRNA of mouse hybridoma cells into cDNA, use this as a template, design upstream degenerate primers for the starting part of the heavy chain and light chain FR1 region, and design downstream primers for the constant region as a template, amplify the signal through PCR, collect the PCR products, perform first-generation Sanger sequencing, and analyze the mAb variable region sequence. The present invention improves the method by designing the position of the front primer on the signal peptide before the Ighv gene V region, which is named as the signal peptide (SP) primer method. At the same time, downstream primers are designed for the nucleic acid sequence of the constant region, and the nucleic acid sequence of the heavy chain and light chain V region is amplified by PCR. The variable region and partial constant region sequence of mAb are obtained by Sanger sequencing ( Figure 2 ).

[0098] The present invention prepared mouse hybridoma cell lines 10-5-1, 10-5-2, and 15-3-2, which encode monoclonal antibodies against the human ABCG2 protein (associated with drug resistance in tumor cells). mRNA was extracted from each of the three cell lines and reverse-transcribed into cDNA. Using this as a template, a set of specific upstream primers was designed targeting the conserved signal peptide sequence, and downstream primers were designed using the constant region as a template for PCR amplification and sequencing. Compared with the traditional FR1 region degenerate primer method, the SP primer method of the present invention can obtain a more complete variable region sequence encoding the ABCG2 mouse monoclonal antibody. Using degenerate primer PCR for FR1 requires a complete match between the 3' end DNA sequence and the template, but the 5' end DNA may not be completely matched. Furthermore, the primer binding region sequence of the DNA template is less complete using first-generation sequencing. Therefore, the variable region sequence of the mouse monoclonal antibody resolved using the improved signal peptide primer method is more accurate. This allows for the design of chimeric antigen receptors (CARs) targeting this antigen, and the genetic subtype of the IgG antibody mouse can be identified based on the sequencing results of its heavy chain constant region sequence (DNA, mRNA, or cDNA). For example, the sequencing results can be imported into the website (https: / / www.ncbi.nlm.nih.gov / igblast / igblast.cgi) to perform IgBLAST to determine the sequence of the variable region and the V gene subtype.

[0099] The primer DNA sequences used in the signal peptide (SP) primer method are shown in Tables 3 and 4.

[0100] Table 3. PCR primers for IgG heavy chain signal peptide

[0101]

[0102]

[0103] Table 4. PCR primers for IgG light chain signal peptide

[0104] Primer number Primer sequence (5'-3') V genotype K1 AAGTTGCCTGTTAGGCTGTTG(SEQ ID No.14) Igkv1-1 K2 TGTTTCTGTTAATGCTCTGGATT(SEQ ID No.15) Igkv1-2 K3 GGCTGCTTGTGCTCTGGATC(SEQ ID No.16) Igkv2 K4 CTCCTGCTATGGGTGCTGCT(SEQ ID No.17) Igkv3 K5 CAGATTTTCAGCTTCCTGCTAAT(SEQ ID No.18) Igkv4 K6 CTTGGACTTATGCTTTTCTGGA(SEQ ID No.19) Igkv5 K7 TATTGCTCTGGGTGTCTGGTG(SEQ ID No.20) Igkv6 / 7 K8 TTCTTGCTGCTATGGGTATCTG(SEQ ID No.21) Igkv8 K9 GCTTCTTGTTGCTGTGGTTTC(SEQ ID No.22) Igkv9 K10 TCAGTTCCTTGGTCTCCTGTTG(SEQ ID No.23) Igkv10 / 11 K11 AGCTCCTGGGGTTGCTGCTG(SEQ ID No.24) Igkv12 / 15-1 K12 AAGTTTCCTTCTCAACTTCTGCTC(SEQ ID No.25) Igkv13 K13 TTGTTGCTCTGGTTTCCAGG(SEQ ID No.26) Igkv14 K14 CATGTTCAGCTCCTGGGGCT(SEQ ID No.27) Igkv15-2 / 16 / 19 K15 ATGACCATGCTCTCACTAGCTC(SEQ ID No.28) Igkv17 / 18 / 20

[0105] Heavy chain post-PCR primer: 5′-CTGGACAGGGATCCAGAGTT-3′ (SEQ ID No. 29, corresponding to the heavy chain CH1 region);

[0106] Light chain post-PCR primer: 5'-CTAACACTCATTCCTGTTGAAGCTC-3' (SEQ ID No. 30, corresponding to the light chain CL region).

[0107] The primers used in the signal peptide (SP) primer method were only verified against monoclonal antibodies against ABCG2 in subsequent implementation cases of the present invention. However, these primers were generated by extensively analyzing the signal peptide sequences at the beginning of the heavy and light chain genes encoding IgG in mouse B cells and are theoretically universal and applicable.

[0108] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0109] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0110] The three mouse hybridoma cell lines used in the following examples were obtained from the applicant's previous work and have been deposited with the China National Center for the Administration of Culture Collection of Microorganisms. Specific deposit information is as follows:

[0111] The hybridoma (mouse origin) ABCG2-PKU1 was deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms (CGMCC) on June 16, 2016, and the registration number of the deposit center is CGMCC No.12653.

[0112] The mouse hybridoma cell line ABCG2-PKU1-1 was deposited in the China General Microbiology Center (CGMCC) on September 5, 2017, with the registration number 14683.

[0113] The mouse hybridoma cell line ABCG2-PKU2 was deposited in the China General Microbiology Center (CGMCC) on September 5, 2017, with the registration number CGMCC No. 14684.

[0114] Example 1. Conservative Analysis of Signal Peptide Sequences of Mouse IgG Heavy and Light Chain Variable Region V Genes and Primer Design

[0115] From "Rearrangement and transcription of genes encoding IgG heavy and light chains" ( Figure 1) process, it was found that the signal peptide (SP or L) sequence is located upstream of each heavy chain and light chain (kappa) V gene. Mouse hybridoma cells and monoclonal antibodies also meet this feature. In order to cover all SP or L sequences as much as possible, the signal peptide sequences of heavy and light chains of different gene subtypes of mouse antibodies were collected from the IMGT database. After removing the pseudogene sequences, the remaining sequences were classified according to similarity and a multiple nucleic acid sequence alignment was performed using the Weblogo analysis website (https: / / weblogo.berkeley.edu / logo.cgi), showing the frequency of nucleotides at each position. The numbers on the horizontal axis in the figure represent the position of the nucleic acid sequence encoding the signal peptide. The nucleotide letters that appear represent the nucleotide at that position, and the size reflects the relative frequency of the nucleotide at that position. The larger the proportion of letters, the higher the frequency of the nucleotide at that position and the higher the conservation.

[0116] By merging V gene types with low frequencies and similar nucleic acid sequences, we obtained 13 mouse heavy chain Ighv genes, a total of 207 mouse heavy chain V genes containing complete signal peptide (SP or L) DNA sequences; at the same time, by merging Igkv gene subtypes with low frequencies and similar nucleic acid sequences, we obtained 15 mouse light chain Igkv gene subtypes, a total of 123 DNA sequences containing complete light chain signal peptides.

[0117] From the weblogo Multiple DNA Sequence Alignment ( Figure 3 As can be seen from (a)), the DNA from position 35 to position 52 of Ighv1-1 is highly conserved, and the front primer of the heavy chain was designed within this position. Figure 3 As can be seen in (b), positions 32 to 50 of Ighv1-2 are highly conserved, so the heavy chain forward primer was designed within this position. The design positions of the remaining heavy chain SP primers were also selected in this manner. Figure 4 and Figure 5 The conserved nucleic acid sequence of the Ighv signal peptide encoding gene of mouse IgG heavy chain was finally obtained by multiple alignment analysis of the DNA sequence of other Ighv gene signal peptides as shown in Table 1.

[0118] from Figure 6 As can be seen from (a), the conservation of nucleic acid from position 1 to position 30 of Igkv1-1 is high, so the present invention chooses to design the front primer of light chain within this position. Figure 6 As can be seen in (b), positions 25 to 45 of Igkv1-2 are highly conserved, so the present invention chose to design the light chain forward primer within this position. The design positions of the remaining light chain SP primers were also selected in the same manner. Figure 7 and Figure 8The conserved nucleic acid sequence of the Igkv signal peptide of the mouse IgG light chain encoding gene was finally obtained by multiple alignment analysis of the DNA sequence of other Igkv gene signal peptides as shown in Table 2.

[0119] The PCR forward primers for the IgG heavy chain signal peptide were finally obtained as shown in Table 3 (see above), the PCR forward primers for the IgG light chain signal peptide were shown in Table 4 (see above), and the IgG heavy chain PCR rear primers and IgG light chain rear primers were as follows:

[0120] Heavy chain post-PCR primer: 5′-CTGGACAGGGATCCAGAGTT-3′ (SEQ ID No. 29, corresponding to the heavy chain CH1 region);

[0121] Light chain post-PCR primer: 5'-CTAACACTCATTCCTGTTGAAGCTC-3' (SEQ ID No. 30, corresponding to the light chain CL region).

[0122] In order to avoid the missing and inaccurate starting sequence of the FR1 region caused by the characteristics of Sanger first-generation sequencing itself in traditional methods, as well as the differences in sequencing results caused by the incomplete matching characteristics of primers, the present invention designs the binding position of the upstream primer to be located upstream of the FR1 region, that is, the signal peptide (SP) region. In this way, the missing or inaccurate starting sequence of the first-generation sequencing and the sites of incomplete primer matching all occur within the SP sequence, thereby ensuring the accuracy and completeness of the downstream variable region sequence.

[0123] Specific application cases of the primers in Example 2 and Example 1

[0124] The present invention was directed against the hybridoma (murine origin) ABCG2-PKU1 (accession number CGMCC No. 12653, hereinafter referred to as hybridoma cell 10-5-1), mouse hybridoma cell ABCG2-PKU1-1 (accession number CGMCC No. 14683, hereinafter referred to as hybridoma cell 10-5-2), and mouse hybridoma cell ABCG2-PKU2 (accession number CGMCC No. 14684, hereinafter referred to as hybridoma cell 15-3-2), which secrete a monoclonal antibody against human ABCG2 protein. mRNA was extracted from each of the three cell lines, reverse transcribed into cDNA, and used as a template for PCR amplification using the primers designed in Example 1. The PCR products were separated by 1% agarose gel electrophoresis, purified by gel excision, and subjected to first-generation sequencing.

[0125] The electrophoresis results showed that the IgG heavy chain V region of mouse hybridoma cell lines 10-5-1, 10-5-2 and 15-3-2 was amplified using the H1 upstream primer to produce a band of about 500 bp ( Figure 9), which is consistent with the expected product size. The signal of the IgG heavy chain V region is the strongest for the Ighv1-1 subtype. All the PCR products of the above bands were excised and recovered, purified and subjected to Sanger sequencing. According to a similar idea, the cDNAs of hybridoma cells 10-5-1, 10-5-2 and 15-3-2 were PCR amplified using light chain SP primers, and then the products were subjected to nucleic acid electrophoresis. The electrophoresis results showed that the light chain K1 and K4 upstream primers of hybridoma cell 10-5-1 could amplify a bright band of about 700 bp in size, the light chain K1, K4, K13 upstream primers of hybridoma 10-5-2 could also amplify a bright band of about 700 bp in size, and the light chain K1, K4, K13 upstream primers of hybridoma 15-3-2 could also amplify a bright band of about 700 bp in size ( Figure 10 ), which matched the expected product size. All PCR products of the bright bands matching the above sizes were excised, recovered, purified, and sequenced. Note: Heavy chain gene Ighv subtypes have low similarity, while light chain gene Igkv subtypes have high DNA sequence similarity. PCR primers for different Igkv subtypes may amplify single or multiple bands.

[0126] The experiment also set up a control using FR1 region primers instead of SP primers (i.e., traditional method). Among them, the FR1 region primer sequence used to detect the IgG heavy chain variable region is 5'-GAAGTGCAGCTTCAGGAGTCAGG-3', and the heavy chain post-PCR primer is the same as the signal peptide primer method of the present invention. The FR1 region primer sequence used to detect the IgG light chain variable region is 5'-GACATTGTGATGACCCAGTCTCCA-3', and the light chain post-PCR primer is the same as the signal peptide primer method of the present invention.

[0127] The sequences of the light chain and heavy chain antibody variable regions of hybridoma cell 10-5-1 were compared using FR1 region primers and SP primers. The results showed that compared with using FR1 region primers, using SP primers to sequence the heavy chain and light chain (kappa) can obtain more complete and accurate variable region sequences ( Figure 11 and Figure 12). The improved SP primer method was used for hybridoma cell 10-5-1 to obtain a more complete heavy chain variable region FR sequence. The DNA sequence "CAGGTCCAACTGCAGCAGC" was an additional DNA sequence detected by the traditional method. Similarly, the improved SP primer method was used for hybridoma cell 10-5-1 light chain (Kappa) variable region to obtain a more complete light chain variable region FR sequence. The DNA sequence "GAAGTTGTGATGGC" was an additional DNA sequence detected by the traditional method (Note: Both K1 and K4 amplification products were sequenced, and the sequencing results showed that the K1 primer was correct (Igkv1-1 subtype). The sequence amplified using the K4 primer was sequenced, and the IgBLAST search showed that it was a pseudogene of Igkv3). Therefore, the SP primer method can more completely and accurately determine the nucleic acid sequences of IgG heavy chain and light chain (Kappa) genes, providing a basis for subsequent further engineering.

[0128] Testing confirmed that the heavy chain variable region Ighv gene subtype of hybridoma cell 10-5-1 and the other two hybridoma cells 10-5-2 and 15-3-2 were the same, all of which were Ighv1-1 type; the light chain variable genes of hybridoma cells 10-5-1, 10-5-2 and 15-3-2 were all Igkv1-1 subtype, which is the most common gene subtype, and no other subtypes were detected.

[0129] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A method for detecting a nucleic acid sequence encoding a mouse monoclonal antibody variable region, comprising the following steps: (A1) extracting mRNA from mouse hybridoma cells secreting the mouse monoclonal antibody to be tested and reverse transcribing it to obtain cDNA; (A2) using the cDNA obtained in (A1) as a template, PCR amplification was performed using primer pair A and primer pair B, respectively; The forward primer in the primer pair A is designed based on the nucleic acid sequence encoding the signal peptide located in the heavy chain variable region of a mouse monoclonal antibody, and the rear primer is designed based on the nucleic acid sequence encoding the heavy chain constant region of a mouse monoclonal antibody; The forward primer in the primer pair B is designed based on the nucleic acid sequence encoding the signal peptide located before the light chain variable region of the mouse monoclonal antibody, and the rear primer is designed based on the nucleic acid sequence encoding the light chain constant region of the mouse monoclonal antibody; (A3) Sequencing the product obtained by PCR amplification of primer pair A in (A2) to obtain a nucleic acid sequence encoding the heavy chain variable region of the mouse monoclonal antibody to be tested; sequencing the product obtained by PCR amplification of primer pair B in (A2) to obtain a nucleic acid sequence encoding the light chain variable region of the mouse monoclonal antibody to be tested.

2. The method according to claim 1, wherein: The forward primer in the primer pair A is designed based on the conserved region of the nucleic acid sequence encoding the signal peptide located in the heavy chain variable region of the mouse monoclonal antibody; The forward primer in the primer pair B is designed based on the conserved region of the nucleic acid sequence encoding the signal peptide located before the light chain variable region of the mouse monoclonal antibody; or The mouse monoclonal antibody is a mouse IgG monoclonal antibody.

3. The method according to claim 1 or 2, characterized in that: The front primer in the primer pair A is selected from one or more of the following: (a1) Primer H1 shown in SEQ ID No. 1; (a2) Primer H2 shown in SEQ ID No. 2; (a3) Primer H3 shown in SEQ ID No. 3; (a4) Primer H4 shown in SEQ ID No. 4; (a5) Primer H5 shown in SEQ ID No. 5; (a6) Primer H6 shown in SEQ ID No. 6; (a7) Primer H7 shown in SEQ ID No. 7; (a8) Primer H8 shown in SEQ ID No. 8; (a9) Primer H9 shown in SEQ ID No. 9; (a10) primer H10 shown in SEQ ID No. 10; (a11) Primer H11 shown in SEQ ID No. 11; (a12) Primer H12 shown in SEQ ID No. 12; (a13) Primer H13 shown in SEQ ID No. 13; and / or The rear primer in the primer pair A is primer CH1 shown in SEQ ID No.

29.

4. The method according to any one of claims 1 to 3, characterized in that: The front primer in the primer pair B is selected from one or more of the following: (b1) Primer K1 shown in SEQ ID No. 14; (b2) Primer K2 shown in SEQ ID No. 15; (b3) Primer K3 shown in SEQ ID No. 16; (b4) Primer K4 shown in SEQ ID No. 17; (b5) Primer K5 shown in SEQ ID No. 18; (b6) Primer K6 shown in SEQ ID No. 19; (b7) Primer K7 shown in SEQ ID No. 20; (b8) Primer K8 shown in SEQ ID No. 21; (b9) Primer K9 shown in SEQ ID No. 22; (b10) Primer K10 shown in SEQ ID No. 23; (b11) Primer K11 shown in SEQ ID No. 24; (b12) Primer K12 shown in SEQ ID No. 25; (b13) Primer K13 shown in SEQ ID No. 26; (b14) Primer K14 shown in SEQ ID No. 27; (b15) Primer K15 shown in SEQ ID No. 28; and / or The rear primer in the primer pair B is the primer CL shown in SEQ ID No.

30.

5. A set of primer pairs for detecting nucleic acid sequences encoding mouse monoclonal antibody variable regions, consisting of primer pair group A and primer pair group B; The primer pair group A consists of 13 primer pairs, the front primers in the 13 primer pairs are as shown in (a1) to (a13) in claim 3, and the rear primers are all primers CH1 in claim 3; The primer pair group B consists of 15 primer pairs, the front primers in the 15 primer pairs are as shown in (b1) to (b15) described in claim 4, and the rear primers are all primers CL described in claim 4.

6. A primer pair for detecting a nucleic acid sequence encoding a mouse monoclonal antibody heavy chain variable region, characterized in that: The primer pair group is the primer pair group A described in claim 5.

7. A primer pair set for detecting a nucleic acid sequence encoding a light chain variable region of a mouse monoclonal antibody, characterized in that: The primer pair group is the primer pair group B described in claim 5.

8. Use of the primer set according to claim 5 in detecting nucleic acid sequences encoding variable regions of mouse monoclonal antibodies.

9. Use of the primer pair set according to claim 6 in detecting a nucleic acid sequence encoding a heavy chain variable region of a mouse monoclonal antibody; or Use of the primer pair set according to claim 7 in detecting a nucleic acid sequence encoding a light chain variable region of a mouse monoclonal antibody.

10. The primer pair set or primer pair set or use according to any one of claims 5 to 10, characterized in that: The mouse monoclonal antibody is a mouse IgG monoclonal antibody.

Images