TsRNA marker for diagnosing and evaluating vascular aging, kit and application of tsRNA marker

By detecting the expression level of tsRNA-3031b, the problem of vascular aging assessment was solved, efficient diagnosis and prognosis assessment were achieved, and a new biomarker and potential therapeutic target for vascular aging was provided.

CN120700128AActive Publication Date: 2025-09-26SECOND MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510472023.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-15
Publication Date
2025-09-26
Estimated Expiration
2045-04-15

AI Technical Summary

Technical Problem

Existing technologies lack inspection and testing methods to accurately assess vascular aging, especially in the early stages of the disease, making intervention difficult. tsRNA detection methods are immature and difficult to use as biomarkers of vascular aging.

Method used

tsRNA-3031b is provided as a marker of vascular aging. tsRNA-3031b expression levels are detected by RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms. Specific primers and kits are used for diagnosis, screening, prognosis assessment, and differentiation of vascular aging.

Benefits of technology

tsRNA-3031b was significantly upregulated in patients with vascular aging, and the ROC curve showed high sensitivity and specificity, which could reflect the severity of vascular aging and demonstrate potential as a therapeutic target at the cellular level to slow down the aging process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120700128A_ABST
    Figure CN120700128A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a substance for detecting a tsRNA marker. The application comprises one or more of the following applications: A1) an application in preparation of a product for diagnosing vascular aging; a2) is applied to preparation of products for screening vascular senescence; a3) in preparation of products for treating vascular aging; a4) in preparation of a vascular aging prognosis evaluation product; a5) application in preparation of products for identifying and distinguishing vascular senescence and other diseases; the tsRNA marker is tsRNA-3031b, and the nucleotide sequence of the tsRNA marker is as shown in SEQ ID No. 1. The expression quantity of the tsRNA-3031b marker provided by the invention in blood plasma of a vascular senescence patient is remarkably increased compared with that of a healthy control person, which indicates that the tsRNA-3031b is a potential vascular senescence biomarker. The ROC curve of the efficacy of the tsRNA-3031b in the aspect of diagnosing vascular aging patients shows that the tsRNA-3031b has good diagnosis efficacy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a marker for diagnosing vascular aging, specifically a tsRNA marker, and also relates to a kit for detecting the tsRNA marker and application thereof, belonging to the field of medical molecular diagnosis. Background Art

[0002] Although the prevalence of cardiovascular disease has declined over the past 30 years, it remains the leading cause of morbidity and mortality worldwide. It is estimated that by 2030, the population over 65 years old will account for 20% of the total population, and cardiovascular disease (CVD) will account for 40% of all deaths in this age group, becoming the leading cause of death. In addition, the cost of treatment and hospitalization for cardiovascular disease is expected to more than triple during this period. It is worth noting that 90% of cardiovascular diseases occur in adults aged 40 and above. Among the heart and vascular diseases related to aging, vascular aging has become an important research direction in the era of aging population. In the past, the two fields of cardiovascular disease and molecular biology of aging were basically independent, but with the increasing attention paid to changes in the vascular system with age, how to improve the early diagnosis of vascular aging has become an important direction of cardiovascular disease research.

[0003] Characteristics of vascular aging include luminal dilation, increased arterial stiffness, endothelial dysfunction, and diffuse intimal thickening. Increased arterial stiffness is the most prominent feature, primarily due to multiple factors, including accelerated elastin breakdown and depletion in the vascular media and collagen deposition. Increased arterial stiffness leads to increased blood pressure due to an earlier return of the reflected wave during systole.

[0004] tRNA-derived small RNAs (tsRNAs) are a class of small non-coding RNAs. Advances in research technology have revealed that tsRNAs are not random products of tRNA degradation, but rather small RNAs cleaved according to specific sequences and associated with a variety of diseases. Numerous studies have shown that, depending on the tRNA cleavage site, tsRNAs can function as functional molecules, influencing disease progression. Because the onset and progression of vascular aging are relatively subtle, clinical tests and assays are currently lacking to accurately assess vascular aging. This is particularly true in the early stages of the disease, before cardiac function has significantly diminished, making intervention more difficult. Therefore, the discovery of new biomarkers of vascular aging is urgently needed. Changes in non-coding RNAs occur upstream of transcription, occurring more rapidly and at earlier stages. In the past, tsRNA detection was difficult due to the immaturity of detection methods. However, with technological advances, tsRNA detection methods are becoming increasingly sophisticated, making it a promising new biomarker for the diagnosis and assessment of vascular aging. Summary of the Invention

[0005] The primary technical problem to be solved by the present invention is to provide a new application of a tsRNA marker, which can be used to prepare new uses in materials for diagnosis, screening, prognosis assessment and differentiation of vascular aging.

[0006] Another technical problem to be solved by the present invention is to provide a kit for detecting new tsRNA markers, which can be used for diagnosis, screening, prognosis evaluation and differentiation of vascular aging.

[0007] Another technical problem to be solved by the present invention is to provide a primer for detecting a new tsRNA marker, which can be used for diagnosis, screening, prognosis evaluation and differentiation of vascular aging.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0009] According to a first aspect of an embodiment of the present invention, there is provided an application of a substance for detecting a tsRNA marker, including one or more of the following applications:

[0010] A1) Application in the preparation of products for diagnosing vascular aging;

[0011] A2) Application in the preparation of products for screening vascular aging;

[0012] A3) Use in the preparation of products for treating vascular aging;

[0013] A4) Application in the preparation of products for the prognosis assessment of vascular aging;

[0014] A5) Application in the preparation of products for identifying and distinguishing vascular aging from other diseases;

[0015] The tsRNA marker is tsRNA-3031b, and the nucleotide sequence is shown in SEQ ID No.1.

[0016] The "product" described above can be a product for diagnosing vascular aging by detecting the expression level of tsRNA-3031b through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

[0017] In the above application, the expression of tsRNA-3031b was significantly upregulated in the plasma samples of patients with vascular aging; the expression level of tsRNA-3031b in healthy people was significantly lower than that in patients with vascular aging.

[0018] Preferably, the substance is a reagent for detecting the expression level of tsRNA-3031b, or a reagent for specifically recognizing tsRNA-3031b, or a reagent for detecting the content of tsRNA-3031b.

[0019] Preferably, the substance is a substance for detecting tsRNA-3031b, specifically the following a), b) or c)

[0020] a) primers for detecting or specifically recognizing tsRNA-3031b;

[0021] b) a reagent set containing the reagent described in a);

[0022] c) A kit containing a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0024] According to a second aspect of an embodiment of the present invention, a kit for detecting a tsRNA marker is provided, the kit comprising one or more of the following applications:

[0025] A1) Application in the preparation of products for diagnosing vascular aging;

[0026] A2) Application in the preparation of products for screening vascular aging;

[0027] A3) Use in the preparation of products for treating vascular aging;

[0028] A4) Application in the preparation of products for the prognosis assessment of vascular aging;

[0029] A5) Application in the preparation of products for identifying and distinguishing vascular aging from other diseases;

[0030] The tsRNA marker is tsRNA-3031b, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying tsRNA-3031b, or a reagent for detecting the expression level of tsRNA-3031b.

[0031] The kit provided by the present invention can be used to detect the expression of the characteristic gene sequence of tsRNA-3031b shown in SEQ ID NO.1 in the peripheral blood of the subject, and then the probability of vascular aging in the subject can be determined based on the information of upregulation or downregulation of these gene expressions, thereby realizing the diagnosis of vascular aging.

[0032] The kits provided herein may include appropriate packaging and instructions for use in the methods disclosed herein. The detection kits provided herein are nucleic acid detection kits that include reagents required for RNA extraction and real-time quantitative PCR (qRT-PCR). The kits may further include an appropriate buffer and polymerase, and may also include control primers and / or probes.

[0033] Preferably, the reagent for detecting or specifically identifying tsRNA-3031b is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0034] According to a third aspect of an embodiment of the present invention, a primer for detecting a tsRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0035] A1) Application in the preparation of products for diagnosing vascular aging;

[0036] A2) Application in the preparation of products for screening vascular aging;

[0037] A3) Use in the preparation of products for treating vascular aging;

[0038] A4) Application in the preparation of products for the prognosis assessment of vascular aging;

[0039] A5) Application in the preparation of products for identifying and distinguishing vascular aging from other diseases;

[0040] The primers are primers for detecting the expression level of tsRNA-3031b or specifically recognizing tsRNA-3031b.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The present invention provides a tsRNA (tsRNA-3031b) marker that can be used as a diagnostic marker for vascular aging. Clinical validation trials have shown that the expression level of tsRNA-3031b in the plasma of patients with vascular aging is significantly higher than that in healthy controls, indicating that tsRNA-3031b is a potential biomarker for vascular aging.

[0044] (2) The efficacy of tsRNA-3031b in diagnosing patients with vascular aging was evaluated using the ROC curve, and the results showed that it had high sensitivity and specificity, indicating that it has good diagnostic efficacy as a diagnostic tool.

[0045] (3) In clinical trials, researchers explored the relationship between PWV (pulse wave velocity) and tsRNA-3031b expression and found a positive correlation between the two. PWV is an important clinical indicator for assessing vascular stiffness and aging. Therefore, the level of tsRNA-3031b in plasma can reflect the severity of vascular aging and can be used to assess the prognosis of vascular aging.

[0046] (4) In in vitro cellular experiments, vascular smooth muscle cells (VSMCs) treated with the senescence inducer D-gal showed increased expression of tsRNA-3031b. This finding provides a cellular and molecular basis for tsRNA-3031b as a diagnostic biomarker for vascular aging.

[0047] (5) Further experiments showed that knocking down tsRNA-3031b reduced the mRNA expression levels of P21 and IL-1β, which are related to aging, indicating that knocking down tsRNA-3031b can slow down the cellular aging process. In addition, knocking down tsRNA-3031b also reduced the expression of β-galactosidase, which further confirmed that knocking down tsRNA-3031b can reduce the degree of cell aging induced by D-gal, thereby demonstrating the potential of tsRNA-3031b as a therapeutic target for vascular aging at the cellular level. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The heat map of tsRNA expression differences between senescent VSMCs and normal controls obtained by sequencing;

[0049] Figure 2 To determine the plasma tsRNA-3031b content in patients with vascular aging and normal controls using qRT-PCR;

[0050] Figure 3 ROC curve for tsRNA-3031b in diagnosing patients with vascular aging;

[0051] Figure 4 To determine the tsRNA-3031b content in the plasma of patients with vascular aging and normal controls in the external validation population again using qRT-PCR;

[0052] Figure 5 ROC curve for tsRNA-3031b diagnosis of vascular aging patients in the external validation population;

[0053] Figure 6 The relationship between the patient's PWV and the expression level of tsRNA-3031b;

[0054] Figure 7 is the relationship between the positive ratio of β-galactosidase, a senescence marker, and the expression level of tsRNA-3031b in VSMCs induced by D-gal;

[0055] Figure 8A is a graph showing the expression of tsRNA-3031b after VSMCs were transfected with tsRNA-3031b small interfering RNA (siRNA);

[0056] Figure 8B The figure shows the expression of messenger RNA (mRNA) after VSMCs were transfected with tsRNA-3031b siRNA;

[0057] Figure 9A The expression of P21 mRNA in VSMCs induced by D-gal after siRNA knockdown of tsRNA-3031b in VSMCs;

[0058] Figure 9B The expression of IL-1β mRNA in VSMCs induced by D-gal after siRNA knockdown of tsRNA-3031b in VSMCs;

[0059] Figure 10A The expression of galactosidase in VSMCs of the control group after treatment with D-gal;

[0060] Figure 10B After knocking down tsRNA-3031b, the expression of galactosidase, a marker protein of cell senescence, was determined by galactosidase staining under a light microscope. DETAILED DESCRIPTION

[0061] The present invention is further described below with reference to specific examples. These examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Experimental methods in the following examples, where specific conditions are not specified, are generally performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred embodiments and materials described herein are for exemplary purposes only.

[0062] First, total RNA was extracted from three aged VSMCs and three normal control VSMCs and sent to Guangzhou Epigenetics for tsRNA sequencing. tsRNAs with significant expression differences (Fold change ≥ 2.0, P value < 0.05) were screened. The levels of the top 10 tsRNAs in the patient's plasma were then measured using qRT-PCR, and the first one with significant increase was selected for subsequent experiments. The relationship between tsRNA-3031b expression and vascular aging was then verified again using in vitro experimental cell levels. The specific data are as follows:

[0063] Example 1 Screening and Correlation Study of Vascular Aging tsRNA Markers

[0064] 1. Clinical samples:

[0065] Venous blood was collected from 50 patients aged 60 to 90 years admitted to the PLA General Hospital between 2020 and 2023, excluding those with other vascular diseases. Venous blood was also collected from 50 healthy individuals aged 30 years or younger undergoing physical examinations. These individuals were divided into a control group and an aging group for subsequent determination of plasma tsRNA levels.

[0066] The external validation population consisted of 52 patients aged 60 to 90 years who were hospitalized at Fuwai Hospital, Chinese Academy of Medical Sciences, between 2022 and 2023 and who had not undergone other vascular diseases. In addition, 44 healthy individuals aged 30 years or younger who underwent a physical examination were included. Venous blood samples were obtained upon admission and the patients were divided into a control group and an elderly group. Clinical data were recorded for all participants.

[0067] Inclusion criteria:

[0068] (1) Inpatients aged 60 years or younger and younger than 90 years with PWV > 1800 cm / s;

[0069] (2) healthy subjects aged ≤ 30 years with PWV < 1400 cm / s;

[0070] (3) Complete blood sample information is available.

[0071] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe blood system diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and peripheral vascular disease.

[0072] 2. Plasma extraction:

[0073] Human peripheral blood was collected using EDTA anticoagulant blood collection tubes, centrifuged at 2500 g for 15 min, and the upper plasma was transferred to a 2 ml sterile tube and frozen in a -80°C refrigerator.

[0074] 3. RNA extraction and qRT-PCR:

[0075] RNA extraction

[0076] Total RNA was extracted from plasma using the RNAsimple Total RNA Kit (DP419, TIANGEN). 1 ml of TRIZOL Reagent and 200 μl of chloroform were added to the plasma. The mixture was shaken for 20 seconds, allowed to stand at room temperature for 10 minutes, and then centrifuged at 13,000 rpm at 4°C for 15 minutes. The supernatant was carefully aspirated, and 800 μl of isopropanol was added. The mixture was gently mixed by inversion, allowed to stand at -20°C for 1 hour, and centrifuged at 13,000 rpm at 4°C for 15 minutes. The supernatant was discarded. 1 ml of 75% ethanol was added, and the precipitate was gently washed. Centrifuged at 13,000 rpm at 4°C for 5 minutes, then the supernatant was removed and air-dried. An appropriate amount of enzyme-free water was added, and the mixture was dissolved at 65°C for 10 minutes. The OD value and concentration of the RNA were determined, and the mixture was stored at -80°C until further use.

[0077] 3.2. RNA Reverse Transcription to cDNA

[0078] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A).

[0079] 3.3. Reverse transcription of tsRNA:

[0080] Operate on ice, 20 μL per reaction system, as shown in the following table:

[0081] Table 1

[0082]

[0083] 3.4. Reverse transcription of mRNA:

[0084] Operate on ice, 20 μL per reaction system, as shown in the following table:

[0085] Table 2

[0086]

[0087] The reaction procedure was: 37°C for 45 min, 85°C for 5 min, and then maintained at 4°C.

[0088] 3.5.qRT-PCR

[0089] Design tsRNA primer sequences according to tsRNA primer design principles. Dilute the cDNA obtained by reverse transcription at a 1:10 ratio and perform the following qRT-PCR reaction.

[0090] Operate on ice, 20 μL per reaction system, as shown in the following table:

[0091] Table 3

[0092]

[0093] Mix the reaction solution and perform the Real-time PCR reaction procedure as follows:

[0094] Stage 1: 95℃ for 2 min;

[0095] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;

[0096] Stage 3: 95℃15s, 60℃1min, 95℃5s;

[0097] The relative levels of each mRNA were quantified using GAPDH and expressed as relative ratios.

[0098] 4. tsRNA Sequencing Analysis:

[0099] Three naturally aged VSMCs and three normal control cells were selected to extract total RNA and sent to Guangzhou Epigenetics for tsRNA sequencing. tsRNAs with significant expression differences (Fold change ≥ 2.0, P value < 0.05) were screened and then qRT-PCR was used to determine the content of the top 10 tsRNAs in the patient's plasma. The first tsRNA with significant increase was selected for subsequent experiments. Figure 1 The volcano plot shows the differential expression of tsRNAs in senescent vascular cells (VSMCs) and normal controls, as determined by sequencing. Table 4 lists the top 10 upregulated tsRNAs identified by sequencing; the tsRNAs with the highest expression levels were selected for subsequent experiments.

[0100] Table 4 Top 10 upregulated tsRNAs obtained from sequencing data

[0101]

[0102] 5.ROC curve drawing:

[0103] The receiver operating characteristic (ROC) curve is a graph plotting the true positive rate against the false positive rate. It can be used to reflect the relationship between sensitivity and specificity. It uses sensitivity as the vertical axis and 1-specificity as the horizontal axis. Sensitivity and specificity are calculated based on a series of cutoff values ​​determined by the measured values ​​in the experimental and control groups. A line connecting these points is the ROC curve. GraphPad Prism software is used to draw ROC curves. The ROC curve reflects the diagnostic efficacy of a marker for a disease.

[0104] 6. Statistical Analysis

[0105] Student's t-test and analysis of variance were used for normal variables, and the Mann-Whitney U test and Kruskal-Wallis test were used for nonnormal variables. Statistical analyses were performed using R software (v 3.4.2) and GraphPad Prism (9.1.0). Biological replicates are shown as individual data points superimposed on the bar graph. P < 0.05 was considered significant.

[0106] 7. Experimental results:

[0107] like Figure 2 As shown, the tsRNA-3031b level in the plasma of patients with vascular aging was measured using qRT-PCR. The results showed that the expression of tsRNA-3031b in the plasma of patients with vascular aging was significantly higher than that in the plasma of healthy controls, indicating that tsRNA-3031b is a potential biomarker of vascular aging.

[0108] like Figure 3 As shown, the ROC curve of tsRNA-3031b in diagnosing patients with vascular aging shows that tsRNA-3031b has better sensitivity and specificity, indicating that it has good diagnostic efficacy.

[0109] like Figure 4 As shown, after selecting an external validation population, the qRT-PCR method was used to determine the content of tsRNA-3031b in the plasma of patients with vascular aging.

[0110] The expression of 3031b content was significantly higher than that of tsRNA-3031b in the plasma of healthy controls, verifying the reliability of tsRNA-3031b as a biomarker of vascular aging.

[0111] like Figure 5 As shown in the figure, the ROC curve of tsRNA-3031b in diagnosing patients with vascular aging in the external validation set has excellent specificity and sensitivity, indicating that tsRNA-3031b also has good diagnostic efficacy in the external validation set.

[0112] Example 2 Relationship between PWV and tsRNA-3031b expression

[0113] 1. Research Background

[0114] PWV is a noninvasive indicator of arterial elasticity and distensibility. It is used to assess the degree of arterial wall stiffness, which is closely related to brain and cardiovascular disease. It refers to the rate at which the pulse wave propagates from one specific location along the arterial wall to another. Based on the principle that the conduction velocity of the pulse wave (pulse wave) generated by blood pumping from the heart accelerates with arteriosclerosis, the conduction velocity of the pulse wave (pulse wave) between the examined sites is measured to assess the degree of vascular elasticity. Higher acquisition values ​​indicate stiffer arterial walls. The acquisition calculation formula and clinical assessment criteria are: acquisition = distance / time difference (Δt). Higher PWV values ​​indicate stiffer blood vessel walls. Clinically, the degree of vascular stiffness is often used to represent the degree of vascular aging.

[0115] PWV represents the degree of vascular stiffness. An increase in its value is a key clinical indicator for assessing vascular aging and can also provide a reliable indicator for evaluating the effectiveness of clinical interventions. The value increases with age, with a baseline value of 1400 cm / s. A higher PWV indicates more advanced vascular aging. According to the American College of Cardiology's Medical Science Report: a. PWV <1400 cm / s: Normal arteriosclerosis. b. 1400 cm / s ≤ PWV ≤ 1800 cm / s: Mild peripheral arteriosclerosis. c. PWV >1800 cm / s: Severe peripheral arteriosclerosis.

[0116] 2. Experimental methods:

[0117] PWV was measured using the fully automatic arteriosclerosis tester BP-203RPE III (manufactured by Omron, Japan). Blood pressure cuffs were placed 2-3 cm above the ankles of the subject's brachial arteries in both arms and lower limbs. All four cuffs were inflated simultaneously, and the instrument automatically measured the pulse wave transit time at the arm and ankle. The average of the pulse wave velocity values ​​in both arteries was used as the final statistical value.

[0118] 3. Experimental results:

[0119] Figure 6 The figure shows the relationship between PWV and tsRNA-3031b expression. Figure 6 A positive correlation was observed between PWV and tsRNA-3031b expression; PWV is a functional marker of vascular aging, and tsRNA-3031b is positively correlated with PWV levels. These results suggest that tsRNA-3031b levels in plasma may reflect disease severity.

[0120] Example 3 In vitro experimental cell level verification of the relationship between the expression level of tsRNA-3031b and vascular aging

[0121] 1. Cell culture:

[0122] Human vascular smooth muscle cell lines (VSMCs) were purchased from Wuhan Punuosai. The cells were cultured in RPMI-1640 medium plus 10% fetal bovine serum in a 5% carbon dioxide incubator at 37°C.

[0123] siRNA knockdown method: siRNA was ordered from Thermo Fisher and added according to the instructions when the cell confluence reached 70%. The knockdown effect was determined by qRT-PCR after 24 hours of induction.

[0124] 2. Cell senescence treatment:

[0125] Cultured VSMCs were exposed to 10 mM D-galactose (D-gal) to induce senescence. D-gal is a well-established senescence model-inducing agent, a more potent glycating agent than glucose and capable of inducing oxidative stress. D-gal concentrations induce cytotoxicity and senescence-like changes, leading to the secretion of senescence-associated proteins (such as P21 and IL-1β) from VSMCs. After 24 hours, the levels of tsRNA and mRNA for senescence-associated proteins in VSMCs were compared with those in the control group.

[0126] 3. The qRT-PCR method was the same as in Example 1.

[0127] 4. Beta-galactosidase staining experiment:

[0128] Staining was performed using the Beyotime Galactosidase Staining Kit (C0602). Cells cultured in a 6-well plate were aspirated for 15 minutes after the culture medium was removed and washed once with PBS. The cells were then fixed at room temperature for 15 minutes after the fixative was removed. The cells were washed three times with PBS for 3 minutes each. The PBS was aspirated and 1 ml of the staining working solution was added to each well. The staining working solution was prepared as follows: 10 μL of Galactosidase Staining Solution a, 10 μL of Galactosidase Staining Solution b, 930 μL of Galactosidase Staining Solution c, and 50 μL of X-Gal solution. Incubate at 37°C overnight. Seal the 6-well plate with plastic wrap to prevent evaporation. Note: Incubation at 37°C should not be performed in a CO2 incubator. Observe under a standard light microscope.

[0129] 5. Experimental results:

[0130] like Figure 7 As shown, the expression levels of β-galactosidase, a senescence marker of vascular cells, and tsRNA-3031b were well correlated, indicating that tsRNA-3031b has good diagnostic efficacy.

[0131] Figure 8A After VSMCs were transfected with tsRNA-3031b siRNA, the expression of tsRNA-3031b was reduced. Figure 8B This shows that the total amount of mRNA remains unchanged after tsRNA-3031b knockdown, indicating that the transfection was successful and subsequent experiments were completed on this basis.

[0132] Figure 9A and Figure 9B To detect the mRNA expression of two cell senescence markers in VSMCs after transfecting VSMCs with tsRNA-3031b siRNA. Figure 9A is the expression of senescence protein markers in P21 cells, Figure 9B The expression of IL-1β, a phenotypic marker associated with cell senescence, is shown in Figure 3. Knockdown of tsRNA-3031b reduced the expression of P21 and IL-1β mRNA, indicating that knockdown of tsRNA-3031b can slow cell senescence and may serve as a therapeutic target for vascular aging.

[0133] Figure 10A and Figure 10B This experiment measured the expression of β-galactosidase in VSMCs treated with D-gal after knockdown of tsRNA-3031b and in the control group. Normal cells cease division after a limited number of divisions, experiencing irreversible growth arrest. At this stage, cells enter senescence, and the β-galactosidase associated with senescence becomes activated. β-galactosidase is a hydrolase found in lysosomes, but its activity is upregulated in senescent cells. Based on this phenomenon and mechanism, senescent cell-specific β-galactosidase catalyzes the production of a blue product using galactosidase as a substrate. This product manifests as a blue deposit in the cytoplasm, making it easily visible under a light microscope. In the control group treated with D-gal, the amount of blue β-galactosidase-stained substrate increased, indicating more severe cellular senescence. After knocking down tsRNA-3031b, the expression level of galactosidase decreased. This result indicates that after knocking down tsRNA-3031b, the degree of cell senescence induced by D-gal was alleviated, achieving the effect of antagonizing aging. This shows that tsRNA-3031b may be used as a therapeutic target for vascular aging at the cellular level.

[0134] These results demonstrate that tsRNA-3031b is significantly associated with vascular aging, making it a new biomarker of vascular aging. tsRNA-3031b expression is upregulated in vascular cells treated with the senescence-inducing agent D-gal. The receiver operating characteristic (ROC) curve demonstrates that tsRNA-3031b has good diagnostic potential for patients with vascular aging, suggesting that tsRNA-3031b may be involved in the D-gal-induced senescence of vascular cells. In summary, tsRNA-3031b has the potential to become a new diagnostic biomarker and therapeutic target for vascular aging.

[0135] Example 4 The sequences, primers and kit compositions of the present invention

[0136] The nucleotide sequence of the vascular aging marker tsRNA-3031b provided by the present invention is shown as SEQ ID No. 1, which is derived from the tRFdb database and is numbered 3031b.

[0137] SEQ ID No.1:TCGCTGGTTCGAATCCGGCTCGGAGGACCA

[0138] The primer pair provided by the present invention for specifically recognizing tsRNA-3031b includes an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3:

[0139] SEQ ID No.2:GCTGGTTCGAATCCGGCT

[0140] SEQ ID No.3:

[0141] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGTCCT

[0142] The kit provided by the present invention comprises:

[0143] 5x primer buffer, enzyme combination I, random 6mers, oligo dT primer, RNase-free water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10μM), ROX Reference dye (50x).

Claims

1. An application of a substance for detecting tsRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing vascular aging; A2) Application in the preparation of products for screening vascular aging; A3) Use in the preparation of products for treating vascular aging; A4) Application in the preparation of products for the prognosis assessment of vascular aging; A5) Application in the preparation of products for identifying and distinguishing vascular aging from other diseases; The tsRNA marker is tsRNA-3031b, and the nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The product is a product for diagnosing vascular aging by detecting the expression level of tsRNA-3031b through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use according to claim 1, characterized in that: The substance is a reagent for detecting the expression level of tsRNA-3031b, or a reagent for specifically identifying tsRNA-3031b, or a reagent for detecting the content of tsRNA-3031b.

4. The use according to claim 1, characterized in that The substance is a substance for detecting tsRNA-3031b, specifically the following a), b) or c) a) primers for detecting or specifically recognizing tsRNA-3031b; b) a reagent set containing the reagent described in a); c) A kit containing a) or b).

5. The use according to claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

6. A kit for detecting tsRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing vascular aging; A2) Application in the preparation of products for screening vascular aging; A3) Use in the preparation of products for treating vascular aging; A4) Application in the preparation of products for the prognosis assessment of vascular aging; A5) Application in the preparation of products for identifying and distinguishing vascular aging from other diseases; The tsRNA marker is tsRNA-3031b, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying tsRNA-3031b, or a reagent for detecting the expression level of tsRNA-3031b.

7. The kit according to claim 6, wherein: The reagent for detecting or specifically identifying tsRNA-3031b is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

8. A primer for detecting tsRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing vascular aging; A2) Application in the preparation of products for screening vascular aging; A3) Use in the preparation of products for treating vascular aging; A4) Application in the preparation of products for the prognosis assessment of vascular aging; A5) Application in the preparation of products for identifying and distinguishing vascular aging from other diseases; The primers are primers for detecting the expression level of tsRNA-3031b or specifically identifying tsRNA-3031b. The tsRNA marker is tsRNA-3031b, and the nucleotide sequence is shown in SEQ ID No.

1.

9. The primer according to claim 8, wherein: The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

Citation Information

Patent Citations

  • PiRNA biomarker related to bladder cancer and application thereof

    CN103627705A

  • PiRNA (piribose nucleic acid) marker for diagnosing and evaluating myocardial aging, kit and application of piRNA marker

    CN119177280A

  • Short Non-Coding Protein Regulatory RNAs (sprRNAs) and Methods of Use

    US20180273941A1

  • COMPOSITIONS AND METHODS OF USING piRNAS IN CANCER DIAGNOSTICS AND THERAPEUTICS

    US20190062740A1

  • Method of diagnosis of colorectal cancer

    US20210130904A1