Method for determining high-temperature tolerance of small yellow croakers and screening genes based on dynamic temperature rise mode

Abstract

The invention discloses a method for determining high-temperature tolerance and screening genes of small yellow croakers based on a dynamic heating mode, which comprises the following steps: performing high-temperature treatment on a small yellow croaker full-sib family according to a certain heating mode, and accurately obtaining the high-temperature-resistant phenotype of each individual by taking the survival time of the individual as the phenotype of the high-temperature-resistant character. High-temperature-resistant phenotype related SNP sites are screened through whole genome association analysis, candidate genes are obtained through annotation of the SNP sites, GO and KEGG function enrichment analysis is conducted on the candidate genes, common candidate genes on remarkably-enriched GO and KEGG channels are screened out, and the number of the candidate genes is further reduced. Meanwhile, a high-temperature stress differential expression gene expression profile is constructed through transcriptome sequencing analysis, the screened candidate genes are mapped to the differential gene expression profile, and the candidate genes successfully mapped to the expression profile are the high-temperature stress key candidate genes. According to the method, the number of candidate genes is effectively reduced, and the target gene is quickly locked.

Description

Technical Field

[0001] The present invention relates to the field of aquatic animal genetic technology, and in particular to a method for determining the high-temperature tolerance of small yellow croaker and screening genes based on a dynamic temperature increase method. Background Art

[0002] Temperature is a key factor affecting the physiological functions of fish. High temperatures trigger stress responses in fish, affecting their normal growth and development and even leading to individual mortality. As one of my country's four traditional seafoods, small yellow croaker (Pseudosciaena spp.) holds significant economic value. Artificial breeding of small yellow croaker was first successfully achieved in 2015. With the increasing maturity of large-scale artificial breeding and aquaculture technologies, small yellow croaker is poised to become a new target for marine aquaculture in my country, with promising prospects. During the aquaculture process, water temperature directly impacts the survival rate and growth rate of aquacultured fish and is a crucial factor requiring close attention. The safe water temperature for small yellow croaker aquaculture should be below 32°C. In my country's aquaculture areas, water temperatures often exceed 32°C for extended periods during the summer, posing significant risks. Therefore, cultivating high-temperature-tolerant small yellow croaker strains is a key approach to promoting the rapid development of the small yellow croaker industry.

[0003] The discovery of functional genes related to individual high-temperature tolerance traits has important guiding significance for the breeding of improved varieties. Many current methods for mining functional genes, such as genome-wide association analysis (GWAS), require the combination of accurate phenotypic information to ensure the accuracy of gene mining. Therefore, accurate measurement of individual phenotypic traits is crucial. Currently, the determination of high-temperature tolerance phenotypes is mostly based on whether or not the animal dies after being treated at a certain temperature for a certain period of time. It is impossible to accurately measure the temperature tolerance of each individual, which brings significant interference to the accurate determination of heat-tolerance traits. In addition, GWAS analysis usually obtains dozens or hundreds of candidate genes, which brings great difficulties to subsequent verification.

[0004] Therefore, the present invention develops a method for accurately measuring the high temperature resistance phenotype of small yellow croaker and screening key candidate genes, which lays an important foundation for quickly locking the functional genes related to high temperature resistance of small yellow croaker for breeding of improved varieties. Summary of the Invention

[0005] In view of this, the present invention provides a method for determining high temperature tolerance of small yellow croaker and screening genes based on a dynamic temperature increase method.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0007] The method for determining the high temperature tolerance of small yellow croaker based on a dynamic temperature increase method comprises the following steps:

[0008] (a) The high temperature tolerance phenotyping experiment was started when the full-sib families of small yellow croaker were grown to 8 months of age and the culture water temperature was maintained at (15±0.5)℃ for one week;

[0009] (b) Raise the temperature from (15±0.5)°C to (32±0.2)°C at a rate of 1°C / 4h and maintain this temperature to observe individual deaths;

[0010] (c) If no individual dies for 4 consecutive hours, the water temperature is raised by another 1°C, and this temperature is maintained while observing individual deaths. If no individual dies for 4 consecutive hours, the water temperature is raised by 1°C, and this process is repeated until all individuals die.

[0011] (d) During the temperature treatment, the experimental subjects were observed for death every 1 h. Death was indicated by lying on the bottom of the bucket or floating on the water surface and no response to touch. Dead individuals were fished out promptly and their survival time was recorded.

[0012] The method for screening genes based on a dynamic temperature increase method includes the following steps:

[0013] (1) Genome resequencing and data processing: Extract genomic DNA, construct sequencing library after qualified detection, and sequence on the machine;

[0014] (2) Remove sites with minor allele frequency < 0.05; remove sites with deletion rate > 0.5; remove sites with heterozygous ratio > 0.8;

[0015] (3) Genome-wide association analysis (GWAS) of sites related to high temperature resistance: Based on the determination of the high temperature resistance phenotype (survival time) of small yellow croaker by dynamic temperature increase, GWAS analysis of SNP sites related to survival time traits was conducted, the screened SNP sites were annotated to obtain related genes, and functional enrichment analysis of the genes was performed to screen key KEGG pathways and key genes, which were candidate genes related to high temperature resistance;

[0016] (4) Detection of candidate gene expression: Samples from the high-temperature treatment group and the normal-temperature control group were collected, total RNA from the tissues was extracted, and a library was constructed for HiSeq sequencing. The obtained data were filtered and aligned to the reference genome, and the expression levels of each gene were counted. The high-temperature treatment group and the normal-temperature control group were compared, and differentially expressed genes were screened according to the criteria to construct a differentially expressed gene expression profile dataset;

[0017] (5) Joint analysis to screen key genes for high temperature resistance: Find candidate genes related to high temperature resistance from the expression profile dataset of differentially expressed genes, which are key genes for high temperature resistance.

[0018] Preferably, in step (1), the obtained raw sequencing data filters out sequencing adapter sequences, low-quality reads, sequences with high deletion rates, and sequences that are too short; the above data are aligned to the small yellow croaker reference genome using BWA software, and the processed alignment file is subjected to Variant detection of multiple samples using the Unified Genotyper module of GATK software, and the detected variants are filtered using Variant Filtration; and non-diallelic sites are removed from the obtained marker sites.

[0019] Preferably, in the step (3), the survival time of each small yellow croaker measured based on the dynamic temperature increase method is used as the high temperature resistance phenotype, and GWAS analysis is performed to screen genes.

[0020] Preferably, in step (3), survival-related SNP sites are screened with a threshold of P < 0.05, and the 50 kb interval near the SNP is annotated to obtain related genes; GO and KEGG functional enrichment analysis are performed on the obtained genes to screen out GO and gene pathways with P < 0.05, as well as candidate genes related to high temperature resistance.

[0021] Preferably, in step (4), differentially expressed genes are screened according to the annotations of FDR<0.01 and |Log2FC|>1.

[0022] Preferably, in step (4), the key high-temperature-resistant gene is a high-temperature-resistant candidate gene whose expression is significantly differentially expressed under high-temperature stress conditions verified by RNA-seq sequencing.

[0023] Preferably, in step (4), the RNA-seq sequencing samples are liver tissue samples of small yellow croaker and liver tissue of a normal temperature control group after the aquaculture water temperature is raised from a normal temperature of 20±0.5°C to a high temperature of 32°C at a rate of 2°C / h and continuously treated for 6 hours.

[0024] Preferably, the key gene for high temperature resistance is the grk5 gene.

[0025] Preferably, the correlation between the gene and the body's high temperature resistance is measured by measuring the expression level of the grk5 gene under high temperature stress conditions.

[0026] Compared with the prior art, the present invention has achieved the following technical effects:

[0027] The method of the present invention effectively reduces the number of candidate genes and quickly locks on the target gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a time point curve diagram of the temperature control of the present invention;

[0029] Figure 2This is a graph of grk5 gene expression levels in individuals with different survival times under 32°C high temperature stress conditions of the present invention. DETAILED DESCRIPTION

[0030] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0031] The present invention discloses a method for measuring the high temperature tolerance of small yellow croaker based on a dynamic temperature increase method, comprising the following steps:

[0032] (a) The high temperature tolerance phenotyping experiment was started when the full-sib families of small yellow croaker were grown to 8 months of age and the culture water temperature was maintained at (15±0.5)℃ for one week;

[0033] (b) Raise the temperature from (15±0.5)°C to (32±0.2)°C at a rate of 1°C / 4h and maintain this temperature to observe individual deaths;

[0034] (c) If no individual dies for 4 consecutive hours, the water temperature is raised by another 1°C, and this temperature is maintained while observing individual deaths. If no individual dies for 4 consecutive hours, the water temperature is raised by 1°C, and this process is repeated until all individuals die.

[0035] (d) During the temperature treatment, the experimental subjects were observed for death every 1 h. Death was indicated by lying on the bottom of the bucket or floating on the water surface and no response to touch. Dead individuals were fished out promptly and their survival time was recorded.

[0036] The present invention also discloses a method for screening genes based on a dynamic temperature increase method, comprising the following steps:

[0037] (1) Genome resequencing and data processing: Genomic DNA was extracted, and sequencing libraries were constructed after passing the test, and sequencing was performed on a HiSeq X10 PE150.

[0038] The obtained raw sequencing data was filtered to remove sequencing adapter sequences, low-quality reads, sequences with high N rates, and sequences that were too short. The data were aligned to the small yellow croaker reference genome using BWA software. The processed alignment files were then subjected to variant detection for multiple samples using the Unified Genotyper module of GATK software. Detected variants were filtered using Variant Filtration. The obtained marker loci were filtered according to the following criteria: Non-diallelic loci were removed;

[0039] (2) Remove sites with a minor allele frequency (MAF) < 0.05; remove sites with a deletion rate > 0.5; remove sites with a heterozygous ratio > 0.8;

[0040] (3) GWAS analysis of sites related to high temperature resistance: The survival time of each small yellow croaker measured by dynamic temperature increase was used as the high temperature resistance phenotype. The GLM model in gemma software was used to perform GWAS analysis of SNP sites related to survival time traits. The selected SNP sites were annotated to obtain related genes, and functional enrichment analysis of the genes was performed to screen key KEGG pathways.

[0041] Survival-related SNPs were screened using a P < 0.05 threshold, and the 50 kb region surrounding the SNPs was annotated to identify related genes. GO and KEGG functional enrichment analysis was performed on the obtained genes to identify GO and gene pathways with P values ​​less than 0.05, as well as candidate genes associated with high temperature tolerance.

[0042] (4) Detection of candidate gene expression: Samples from the high-temperature treatment group and the normal-temperature control group were collected, total RNA from the tissues was extracted, and a library was constructed for HiSeq sequencing. The obtained data were filtered and aligned to the reference genes. The expression levels of each gene were statistically analyzed, and the high-temperature treatment group and the normal-temperature control group were compared. Differentially expressed genes were selected according to the annotations of FDR < 0.01 and |Log2FC| > 1, and a differentially expressed gene expression profile dataset was constructed;

[0043] (5) Joint analysis to screen key genes for high temperature resistance: Find candidate genes related to high temperature resistance from the expression profile dataset of differentially expressed genes, which are key genes for high temperature resistance.

[0044] In step (4), the key high-temperature-resistant genes are high-temperature-resistant candidate genes whose expression is significantly differentially expressed under high-temperature stress conditions verified by RNA-seq sequencing.

[0045] In step (4), the RNA-seq sequencing samples are liver tissue samples of small yellow croaker after the aquaculture water temperature is raised from a normal temperature of 20±0.5°C to a high temperature of 32°C at a rate of 2°C / h and continuously treated for 6 hours, and liver tissue of the normal temperature control group.

[0046] The key gene for high temperature resistance is grk5.

[0047] The correlation between the grk5 gene and the body's high temperature tolerance was measured by measuring the expression level of the grk5 gene under high temperature stress conditions.

[0048] Example 1:

[0049] Small yellow croakers of about 8 months old (weight: 42.3±13.4g; body length: 14.1±1.5cm) were used as experimental subjects. The natural water temperature was (15±0.5)℃ and the temperature treatment was started after about one week of breeding. The water temperature was raised from (15±0.5)℃ to (32±0.2)℃ at a rate of 1℃ / 4h. It took 64h to rise to 32℃ and then stabilized at 32℃. The death of fish was observed at any time and the dead fish were removed in time. When the water temperature was maintained at 32℃ for 4 consecutive hours without individual death, the water temperature was raised by another 1℃. The death of fish was observed at any time during the heating process and the dead fish were removed in time. The same temperature adjustment method was used until all the experimental fish died. Figure 1 When dead fish were removed, their survival time was recorded and fin ray samples were collected and stored in anhydrous ethanol for future use.

[0050] Table 1 shows the mortality history of the experimental fish. As can be seen, fish began to die 50 minutes after the water temperature rose to 32°C, and the mortality lasted for 1210 minutes. Individuals began to die 20 minutes after the water temperature rose to 33°C, and the mortality lasted for 250 minutes. At 34°C, mortality began 90 minutes later, with the last fish dying 15 minutes later. Using the water temperature reaching 32°C as the starting point, the survival time of each experimental fish was used as a phenotypic trait for individual high-temperature tolerance, and this phenotypic value was used in subsequent GWAS analyses.

[0051] Table 1: Number of fish deaths under different water temperature conditions

[0052]

[0053]

[0054] Fin ray tissue samples were collected, and genomic DNA of each sample was extracted using a kit. Qualified DNA was tested to construct a sequencing library, and the library was sequenced using a Hiseq X10 PE150. The raw sequencing data obtained filtered out sequencing adapter sequences, low-quality reads, sequences with a high N rate, and sequences that were too short to obtain high-quality sequencing data. The above data were aligned to the small yellow croaker reference genome using the alignment software BWA software. We used the software GATK UnifiedGenotyper module to perform Variant detection on multiple samples of the processed alignment files. The detected variations were filtered using VariantFiltration. A total of 5,536,056 SNP sites were detected, and the number of SNP sites in each sample ranged from 454,754 to 5,423,121. The obtained marker sites were filtered according to the following conditions: remove non-binary sites;

[0055] (2) Sites with a minor allele frequency (MAF) < 0.05, sites with a deletion rate > 0.5, and sites with a heterozygous ratio > 0.8 were removed. Ultimately, 5,427,485 high-quality SNP sites were obtained. Table 2 shows the statistical results of high-throughput sequencing data from 120 full-sibling individuals and their parents.

[0056] Table 2: Sample sequencing data statistics

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063] GWAS analysis of loci related to high temperature tolerance traits:

[0064] A GWAS analysis of SNPs associated with heat tolerance was performed using a GLM model in gemma software (v0.98.1). The selected SNPs were annotated to identify associated genes, and functional enrichment analysis was performed on these genes to identify key KEGG pathways. Using a P < 0.05 threshold, 27 SNPs associated with survival were successfully identified. Annotation was performed within the 50 kb region surrounding the SNPs, resulting in 66 candidate genes. KEGG functional enrichment analysis of these 66 candidate genes revealed five significantly enriched pathways, including Cushing syndrome, basal cell carcinoma, morphine addiction, melanogenesis, and insulin resistance. Six candidate genes were enriched, namely grk5, fzd10, gfpt1, pde11a, ppp1r3c, and tcf7l1a, as shown in Table 3.

[0065] Table 3: Statistics of high temperature tolerance related sites and gene annotation results of small yellow croaker

[0066]

[0067] Comparative transcriptome analysis of acute hyperthermia treatment:

[0068] Eight-month-old yellow croaker (Pseudosciaena spp.) were selected for this study. A total of 180 fish were divided into two groups, each containing three replicates and 30 fish per replicate. The control group received no treatment and was maintained at a natural water temperature of 20°C. The high-temperature treatment group was maintained at 32°C at a rate of 2°C / h for 6 hours. Nine samples were collected from each of the high-temperature treatment and control groups, with three replicates per group. Liver tissue was dissected and quickly frozen in liquid nitrogen. Total RNA was extracted from the tissue using an RNA extraction kit, and a library was constructed for HiSeq sequencing. After filtering low-quality data using Cutadapt software, the data were aligned to the yellow croaker reference gene using HISAT software. StringTie software was used to analyze the expression levels of individual genes. The R package was used to compare the high-temperature treatment group with the normal temperature control group. Differentially expressed genes were identified based on an FDR < 0.01 and |Log2FC| > 1, and a differentially expressed gene expression profile dataset was constructed.

[0069] The six high-temperature-resistance candidate genes obtained by GWAS were mapped to the above differential expression profiles, and it was found that the grk5 gene was differentially expressed, thus confirming that this gene was a key gene for high-temperature stress response. The information of key genes for high-temperature stress response screened by combined GWAS and transcriptome analysis is shown in Table 4.

[0070] Table 4: Information on key genes responding to high temperature stress screened by combined GWAS and transcriptome analysis

[0071]

[0072] Gene expression trends under high temperature stress conditions:

[0073] The livers of 8-month-old yellow croaker were frozen in liquid nitrogen and stored after death. RNA was extracted and tested for grk5 gene expression using fluorescence quantitative detection. The primer sequences used for quantification were as follows:

[0074] Upstream 5′-3′:TCAAGAGACTGGAGGCTGGA;

[0075] Downstream 5'-3':TGGGATGGAAACACTGCCTG.

[0076] The results showed that the expression level of the grk gene in the liver of individuals in the early stage of high temperature stress gradually increased with the extension of survival time, reaching the highest expression level at 12 hours, and then rapidly decreased, indicating that the high temperature stress of the body exceeded the tolerance limit of the body at this time, the physiological function was severely damaged, and the gene could not play its regulatory function.

[0077] The above description is merely a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any minor modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A method for determining the high temperature tolerance of small yellow croaker based on a dynamic temperature increase method, characterized in that: The following steps are involved: (a) The high temperature tolerance phenotyping experiment was started when the full-sib families of small yellow croaker were grown to 8 months of age and the culture water temperature was maintained at (15±0.5)℃ for one week; (b) Raise the temperature from (15±0.5)°C to (32±0.2)°C at a rate of 1°C / 4h and maintain this temperature to observe individual deaths; (c) When no individual died within 4 consecutive hours, the water temperature was raised by another 1°C and maintained at this temperature while observing individual deaths; If no individuals die within 4 consecutive hours, the water temperature is raised by 1°C, and this process is repeated until all individuals die. (d) During the temperature treatment, the experimental subjects were observed for death every 1 h. Death was indicated by lying on the bottom of the bucket or floating on the water surface and no response to touch. Dead individuals were fished out promptly and their survival time was recorded.

2. A method for screening genes based on a dynamic temperature increase method, characterized in that: The following steps are involved: (1) Genome resequencing and data processing: Extract genomic DNA, construct sequencing library after qualified detection, and sequence on the machine; (2) Remove sites with minor allele frequency < 0.05; remove sites with deletion rate > 0.5; Sites with heterozygous ratios > 0.8 were removed; (3) Genome-wide association analysis (GWAS) of sites related to high temperature resistance: Based on the determination of the high temperature resistance phenotype (survival time) of small yellow croaker by dynamic temperature increase, GWAS analysis of SNP sites related to survival time traits was conducted, the screened SNP sites were annotated to obtain related genes, and functional enrichment analysis of the genes was performed to screen key KEGG pathways and key genes, which were candidate genes related to high temperature resistance; (4) Detection of candidate gene expression: Samples from the high-temperature treatment group and the normal-temperature control group were collected, total RNA from the tissues was extracted, and a library was constructed for HiSeq sequencing. The obtained data were filtered and aligned to the reference genome, and the expression levels of each gene were counted. The high-temperature treatment group and the normal-temperature control group were compared, and differentially expressed genes were screened according to the criteria to construct a differentially expressed gene expression profile dataset; (5) Joint analysis to screen key genes for high temperature resistance: Find candidate genes related to high temperature resistance from the expression profile dataset of differentially expressed genes, which are key genes for high temperature resistance.

3. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: In the step (1), the obtained raw sequencing data is filtered out of sequencing adapter sequences, low-quality reads, sequences with high deletion rates, and sequences with too short lengths; the above data are aligned to the small yellow croaker reference genome using BWA software, and the processed alignment file is subjected to Variant detection of multiple samples using the Unified Genotyper module of GATK software, and the detected variants are filtered using Variant Filtration; non-diallelic sites are removed from the obtained marker sites.

4. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: In the step (3), the survival time of each small yellow croaker measured based on the dynamic temperature increase method is used as the high temperature resistance phenotype, and GWAS analysis is performed to screen genes.

5. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: In step (3), the survival-related SNP sites were screened with a threshold of P < 0.05, and the 50 kb interval near the SNP was annotated to obtain related genes; The obtained genes were subjected to GO and KEGG functional enrichment analysis to screen out GO and gene pathways with P < 0.05, as well as candidate genes related to high temperature resistance.

6. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: In the step (4), differentially expressed genes were screened according to the annotations of FDR<0.01 and |Log2FC|>1.

7. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: In the step (4), the key high-temperature-resistant gene is a high-temperature-resistant candidate gene whose expression is significantly differentially expressed under high-temperature stress conditions verified by RNA-seq sequencing.

8. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: In step (4), the RNA-seq sequencing samples are liver tissue samples of small yellow croaker after the aquaculture water temperature is raised from a normal temperature of 20±0.5°C to a high temperature of 32°C at a rate of 2°C / h and continuously treated for 6 hours, and liver tissue of the normal temperature control group.

9. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: The key gene for high temperature resistance is the grk5 gene.

10. The method for screening genes based on dynamic temperature increase according to claim 2, characterized in that: The correlation between the grk5 gene and the body's high temperature tolerance was measured by measuring the expression level of the grk5 gene under high temperature stress conditions.

Images