Buchnera ruralis 33, vegetable preservative and application thereof

By using *Bacillus chubbyi* 33 as a vegetable preservative, the yellowing problem of broccoli was solved, achieving significant inhibition of yellowing and improvement of antioxidant capacity, thus extending the shelf life of broccoli.

CN120718805BActive Publication Date: 2026-02-17BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510949596.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-10
Publication Date
2026-02-17
Estimated Expiration
2045-07-10

AI Technical Summary

Technical Problem

Existing technologies are not ideal in delaying the yellowing of broccoli. Physical preservation techniques are simple to operate but not very effective, while chemical preservative treatments require strict control and pose safety risks.

Method used

Using *Bacillus chub* 33 from the countryside as a vegetable preservative, the preservation effect is achieved by inhibiting yellowing of vegetables and improving their antioxidant capacity.

Benefits of technology

It significantly inhibits postharvest yellowing of broccoli, enhances the antioxidant capacity of vegetables, and extends their shelf life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120718805B_ABST
    Figure CN120718805B_ABST
Patent Text Reader

Abstract

The present application relates to the field of microorganism, and particularly to a strain of Buttiauxella agrestis 33, a vegetable fresh-keeping agent and application thereof.The present application provides a strain of Buttiauxella agrestis 33, and the preservation number of the strain is CGMCC No.34251.After the strain is used to treat green flower, the yellowing of the green flower after harvesting can be significantly inhibited.Then, the expression of genes related to chlorophyll metabolic pathway and antioxidant enzyme in the green flower treated by the Buttiauxella agrestis 33 is detected by real-time fluorescent quantitative reverse transcription PCR, and the result shows that the Buttiauxella agrestis 33 can inhibit the yellowing of the green flower after harvesting and improve the antioxidant capacity of the green flower by activating the expression of genes related to chlorophyll synthesis and antioxidant enzyme.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbiology, and in particular to a strain of rural Bacteroides 33, a vegetable preservative and its application. Background Technology

[0002] Broccoli, also known as green cauliflower, is an annual plant belonging to the Brassicaceae family. It is a popular vegetable, prized for its delicious flavor, rich nutritional value, and high medicinal properties, and is widely cultivated throughout both northern and southern my country. Its crisp texture and abundant nutrients make it a favorite among many. However, broccoli is extremely prone to yellowing and rotting at room temperature, severely impacting its commercial and nutritional value. Therefore, proper treatment can slow down the yellowing process and extend its shelf life.

[0003] Currently, methods for delaying the yellowing of broccoli include: 1. Physical preservation techniques, such as refrigeration, controlled atmosphere storage, ultraviolet treatment, and heat shock treatment; 2. Chemical preservation techniques, such as preservative treatment, ethanol treatment, plant growth regulator treatment, and coating treatment. Physical preservation techniques are relatively easy to implement and operate, but their effect in delaying yellowing is not ideal. Chemical preservation techniques, which involve fumigation, spraying, or soaking with chemical preservatives, require strict control of the dosage and attention to the safety of the agents, and their effects are also not ideal. Therefore, it is necessary to find a microbial preparation that is both effective and safe. Summary of the Invention

[0004] The purpose of this invention is to provide a strain of *Bacillus chub* 33 from rural areas, a vegetable preservative, and its application, in order to solve the problems existing in the prior art.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a strain of Buttiauxella agrestis 33, which has the accession number CGMCC No. 34251.

[0007] This invention provides the application of the above-mentioned *Bacillus chub* 33 in the preparation of vegetable preservatives.

[0008] Preferably, the vegetable preservative achieves the effect of preserving vegetables by inhibiting yellowing and improving their antioxidant capacity.

[0009] Preferably, the vegetable includes broccoli.

[0010] The present invention provides a vegetable preservative, which includes the above-mentioned *Bacillus simulans* 33.

[0011] Preferably, the vegetable preservative achieves the effect of preserving vegetables by inhibiting yellowing and improving their antioxidant capacity.

[0012] Preferably, the vegetable includes broccoli.

[0013] This invention provides the application of the above-mentioned *Bacillus chub* 33 or the above-mentioned vegetable preservative in vegetable preservation.

[0014] The present invention provides a method for preserving vegetables, comprising the step of applying the above-mentioned *Bacillus simulans* 33 or the above-mentioned vegetable preservative to the vegetables.

[0015] Preferably, the vegetable includes broccoli.

[0016] The present invention discloses the following technical effects:

[0017] This invention provides a strain of *Buttiauxella agrestis* 33, with the accession number CGMCC No. 34251. Treatment of broccoli with this strain significantly inhibited postharvest yellowing. Subsequently, real-time quantitative reverse transcription PCR (RT-qPCR) was used to detect the expression of genes related to chlorophyll metabolism pathways and antioxidant enzymes in broccoli treated with *Buttiauxella agrestis* 33. The results showed that *Buttiauxella agrestis* 33 inhibited postharvest yellowing of broccoli and enhanced its antioxidant capacity by activating the expression of genes related to chlorophyll synthesis and antioxidant enzymes. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 Phenotype of the original supernatant of various microorganisms washed off the surface of broccoli, plus 20% glycerol;

[0020] Figure 2 The morphology of various microorganisms washed off the surface of broccoli after culturing in LB solid medium;

[0021] Figure 3 Results from the NCBI database;

[0022] Figure 4 This is a phylogenetic tree; where Bacteria is strain 33;

[0023] Figure 5This refers to the growth morphology of the colony;

[0024] Figure 6 This refers to the phenotype of broccoli;

[0025] Figure 7 This is a statistical graph showing the expression of genes related to the chlorophyll metabolism pathway (A) and antioxidant enzymes (B) detected by real-time quantitative reverse transcription PCR. Graph A shows the expression of chIG, CAO, hemA, and NYC1 ((a)-(d)) related to the chlorophyll metabolism pathway detected by real-time quantitative reverse transcription PCR; Graph B shows the expression of LOX, POD, APX, and SOD ((a)-(d)) related to antioxidant enzymes detected by real-time quantitative reverse transcription PCR.

[0026] Figure 8 A chart showing the rate of weight gain;

[0027] Figure 9 These are schematic diagrams of HE staining of the intestine, liver, and kidney of CK1 mice; where A is a schematic diagram of HE staining of the mouse intestine; B is a schematic diagram of HE staining of the mouse liver; and C is a schematic diagram of HE staining of the mouse kidney.

[0028] Figure 10 These are schematic diagrams of HE staining of the intestine, liver, and kidney of CK2 mice; where A is a schematic diagram of HE staining of the mouse intestine; B is a schematic diagram of HE staining of the mouse liver; and C is a schematic diagram of HE staining of the mouse kidney.

[0029] Figure 11 These are schematic diagrams of HE staining of the intestine, liver, and kidney of CK3 mice; where A is a schematic diagram of HE staining of the mouse intestine; B is a schematic diagram of HE staining of the mouse liver; and C is a schematic diagram of HE staining of the mouse kidney.

[0030] Figure 12 These are schematic diagrams of HE staining of the intestine, liver, and kidney of T1 mice; where A is a schematic diagram of HE staining of the mouse intestine; B is a schematic diagram of HE staining of the mouse liver; and C is a schematic diagram of HE staining of the mouse kidney.

[0031] Figure 13 These are schematic diagrams of HE staining of the intestine, liver, and kidney of T2 mice; where A is a schematic diagram of HE staining of the mouse intestine; B is a schematic diagram of HE staining of the mouse liver; and C is a schematic diagram of HE staining of the mouse kidney.

[0032] Figure 14 The diagrams show HE staining of the intestine, liver, and kidney of T3 mice; where A is a schematic diagram of HE staining of the mouse intestine; B is a schematic diagram of HE staining of the mouse liver; and C is a schematic diagram of HE staining of the mouse kidney. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] Example 1: Isolation and Identification of Buttiauxella agrestis 33

[0039] 1. Collection, isolation, and PCR of microorganisms on the surface of broccoli

[0040] Each time, take 10g of broccoli florets as a sample and add it to a sterile homogenizing bag containing 100mL of sterile water. Shake at 150-200 rpm for 30-60 minutes, sonicate for 5 minutes, and then shake at 150-200 rpm for another 30-60 minutes. Add the supernatant to a new sterile homogenizing bag and repeat the above steps until all broccoli florets have been collected. Collect the final supernatant and add it to a 50mL centrifuge tube. Take 1mL of the supernatant as the stock solution and store it at -4℃ for the next separation step. Add 20% glycerol to the remaining supernatant and store it at -80℃ to obtain the stock solution of various microorganisms eluted from the surface of the broccoli. Figure 1 As shown.

[0041] The stock solution of various microorganisms washed off the surface of broccoli was diluted 10,000 times with sterile water. 50 μL of the diluted solution was evenly spread onto LB solid medium (5 g / L NaCl, 10 g / L yeast extract, 10 g / L trypsin, and 15 g / L agar) and incubated at 28°C for 24 h. The colony morphology of various microorganisms is as follows: Figure 2 As shown. Single colonies were placed in 1 mL of LB liquid medium (5 g / L NaCl, 10 g / L yeast extract and 10 g / L trypsin) and shaken at 200 r / min for 24 h at 28 °C to obtain bacterial suspensions of various microorganisms.

[0042] 2. Taxonomic identification of strains

[0043] PCR amplification of bacterial cultures from various microorganisms was performed using universal 16S primers (27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.2); 1492R: CTACGGCTACCTTGTTACGA (SEQ ID NO.3)). The amplified products were sent to BGI Genomics for sequencing, and the 16S sequence of strain 33 was finally obtained. The 16S sequence of this strain is shown in SEQ ID NO.1, specifically:

[0044]

[0045] Nucleotide sequences were uploaded to the NCBI database and compared with 16S ribosomal RNA sequences (Bacteria and Archaea) in the rRNA / ITS database. The results showed that the sequence with the highest alignment accuracy was Buttiauxella agrestisATCC33320. Figure 3 A phylogenetic tree was constructed, and this strain was clustered on the same branch as Buttiauxella agrestis ATCC 33320. Figure 4 ).

[0046] 3. Colony morphology of the strain

[0047] Single colonies of strain 33 were streaked onto LB agar and incubated at 28°C for 24 hours. The colony morphology is as follows. Figure 5 As shown in the figure. The results show that the overall colony color is pale yellow.

[0048] 4. Preservation of bacterial strains

[0049] Strain 33 was subsequently named Buttiauxella agrestis 33 and deposited on April 17, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCCNo.34251. Its classification name is Buttiauxella agrestis, and the deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0050] Example 2: Safety test of Buttiauxella agrestis (B. agrestis) in rural areas

[0051] Healthy male mice (18g–22g) were selected for the experiment. The *Buchuria cirrhosa* 33 bacterial suspension was adjusted to a concentration of 2.5 × 10⁻⁶ with physiological saline. 7CFU / mL. Mice were administered 200 μL of *Bacillus chub* 33 bacterial suspension via gavage, with an equal volume of physiological saline administered as a control. These groups were designated as the treatment group (T) and the control group (CK). Ten mice were housed in each group, with five mice per cage. The control group mice were numbered CK1-CK10, and the treatment group mice were numbered T1-T10. Mice were fed a basal diet and had free access to water during the experiment. The experiment lasted 14 days. Vital signs were observed daily from days 1-3, and every two days from days 4-14. Blood samples were taken from CK1-CK5 and T1-T5 mice on days 3 and 14, respectively. Pathological examination was performed on CK1-CK3 and T1-T3 mice on day 14. Results are as follows: Figures 8-14 As shown in Tables 1-4.

[0052] Results analysis showed that during the 14-day feeding period, except for day 3, there was no significant difference in the rate of weight gain between the treatment group and the control group. Furthermore, compared with the control group, there were no significant differences in blood test indicators among the treatment groups, and intestinal, liver, and kidney tests were all normal. Therefore, this strain is not pathogenic to animals and has extremely high safety.

[0053] Table 1. Results of blood tests on day 3

[0054]

[0055]

[0056] Note: CL1-CK5 refers to 5 mice that were given physiological saline by gavage, and T1-T5 refers to 5 mice that were given a solution of Bacillus subtilis 33 by gavage. The same applies below.

[0057] Table 2. Results of blood tests on day 3

[0058]

[0059]

[0060] Table 3. Results of blood tests on day 14

[0061]

[0062] Table 4. Results of blood tests on day 14

[0063]

[0064]

[0065] Example 3: Application of Buttiauxella agrestis (B. agrestis) in rural areas

[0066] The experiment selected broccoli of uniform size, color, and maturity, free from mechanical damage or pests / diseases ("excellent cold-resistant variety"). The broccoli were immediately transported to the laboratory after harvesting, sterilized with 0.75% sodium hypochlorite, naturally air-dried, and then packed into 0.03mm polyethylene bags, six broccoli per bag. A 1×10⁻⁶ sodium hypochlorite solution was used. 6 CFU / mL of *Bacterium buchuriae* 33 culture (Bacterium buchuriae* 33 was inoculated onto LB medium and incubated at 28°C for 24 h, with an inoculum size of 1×10⁻⁶). 9 The treatment group was treated with a uniform spray of CFU / mL (after dilution) onto the florets of broccoli. A control group was treated with sterile water. All groups were stored at 20±1℃ and 90% relative humidity for 5 days. Results showed that on day 5 of storage, *Bacillus buchuryensis* 33 significantly inhibited postharvest yellowing of broccoli. Figure 6 ).

[0067] After that, adopt Total RNA was extracted from broccoli using the reagent (Thermo Fisher Scientific, USA) method. The specific procedure was as follows: 0.1 g of frozen tissue powder was weighed, and 1 mL of TRIzol reagent was added for complete lysis. The mixture was centrifuged at 12,000 × g for 10 min at 4°C, and the supernatant was collected. RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). 260 / A 280 The RNA was purified using RQ1 DNase (Promega Corporation, USA). RNA integrity was assessed using 1% agarose gel electrophoresis, and the clarity of the 28S and 18S rRNA bands was observed. Subsequently, [the following was performed / processed]. The IV reverse transcription kit (Thermo Fisher Scientific, USA) was used to synthesize first-strand cDNA strictly according to the instructions. The reaction system contained 1 μg of purified RNA, Oligo(dT)18 primers, and dNTPs.

[0068] The reaction system was prepared using a Touch-CFX96 real-time quantitative PCR instrument. The program was set as follows: pre-denaturation 95℃ for 10 min; amplification phase 40 cycles (95℃ for 15 s, 60℃ for 30 s); melting curve analysis phase (95℃ for 10 s, 60℃ for 1 min). Each sample was set up in three independent biological replicates, using 2... -ΔΔCt The relative expression levels of the target gene were calculated using the method, and the data are expressed as Mean ± SD. The primer sequences used for real-time quantitative reverse transcription PCR are shown in Table 5.

[0069] Table 5 Primer sequences

[0070]

[0071] The expression of genes related to chlorophyll metabolism and antioxidant enzymes was detected by real-time quantitative reverse transcription PCR. The results showed that *Bacterium tumefaciens* 33 significantly upregulated the expression of genes chIG, hemA, and NYC1 in the chlorophyll metabolism pathway and genes related to antioxidant enzymes LOX, POD, APX, and SOD, while significantly downregulating the expression of the chlorophyll a oxidase-encoding gene CAO. In conclusion, *Bacterium tumefaciens* 33 inhibited postharvest yellowing of broccoli and enhanced its antioxidant capacity by activating the expression of genes related to chlorophyll synthesis and antioxidant enzymes. Figure 7 ).

[0072] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A strain of *Buttiauxella agrestis* 33 from rural areas, characterized by: The preservation number of the rural puchub 33 is CGMCC No. 34251.

2. The application of *Bacillus chub* 33 as described in claim 1 in the preparation of a vegetable preservative, characterized in that... The vegetable in question is broccoli.

3. The application according to claim 2, characterized in that, The vegetable preservative achieves the effect of preserving vegetables by inhibiting yellowing and improving their antioxidant capacity.

4. A vegetable preservative, characterized in that, The vegetable preservative includes *Bacillus buchuryus* 33 as described in claim 1; the vegetable is broccoli.

5. The vegetable preservative according to claim 4, characterized in that, The vegetable preservative achieves the effect of preserving vegetables by inhibiting yellowing and improving their antioxidant capacity.

6. The application of the *Bacillus chub* 33 as described in claim 1 or the vegetable preservative as described in claim 4 or 5 in vegetable preservation, characterized in that... The vegetable in question is broccoli.

7. A method for preserving vegetables, characterized in that, The procedure includes applying the *Bacillus chub* 33 of claim 1 or the vegetable preservative of claim 4 or 5 to the vegetable; the vegetable is broccoli.

Citation Information

Patent Citations

  • Thermostable phytase variants

    CN102917600A

  • Prevention and treatment of infections with intracellular bacteria

    WO2023209103A1