Application of brain hemorrhage related marker hmmr gene

By using the third-generation RUSH confocal microscope and two-photon synthetic aperture microscope (2pSAM) for in vivo imaging, the Hmmr gene was found to be associated with cerebral hemorrhage. The Hmmr gene was developed as a biomarker, which solved the problem of diagnosis and treatment assessment of cerebral hemorrhage, provided a new molecular diagnostic tool and therapeutic target, and supported drug development.

CN120719014BActive Publication Date: 2025-12-16TSINGHUA UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511206609.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-27
Publication Date
2025-12-16
Estimated Expiration
2045-08-27

AI Technical Summary

Technical Problem

Current technologies lack effective animal models and imaging platforms, making it difficult to observe the natural evolution of cerebral hemorrhage in the subarachnoid space or inside and outside the dura mater. This limits the development of treatment options for cerebral hemorrhage and also lacks effective biomarkers for the diagnosis, monitoring, and treatment assessment of cerebral hemorrhage.

Method used

In vivo imaging was performed using a third-generation RUSH confocal microscope and a two-photon synthetic aperture microscope (2pSAM). Combined with a backlight imaging strategy, the Hmmr gene and its positive cells were found to be associated with the absorption and repair process of hematoma in cerebral hemorrhage. The Hmmr gene or its positive cells were developed as biomarkers for the diagnosis, monitoring and treatment assessment of cerebral hemorrhage.

Benefits of technology

It enables efficient diagnosis, monitoring, and treatment response assessment of cerebral hemorrhage, provides new molecular diagnostic tools, and supports the development and screening of drugs for the treatment of cerebral hemorrhage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120719014B_ABST
    Figure CN120719014B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of marker, especially relates to the application of a cerebral hemorrhage related marker Hmmr gene.The present application screens and finds a new cerebral hemorrhage related marker Hmmr, and the marker can realize the diagnosis, monitoring, treatment reaction evaluation and prognosis judgment of cerebral hemorrhage, and the marker can also be used as a target point of cerebral hemorrhage treatment chemical drugs and biological drugs, and is used for screening and development of cerebral hemorrhage treatment drugs.The present application provides a new molecular diagnostic tool for cerebral hemorrhage, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomarker technology, and in particular to the application of the Hmmr gene, a biomarker related to cerebral hemorrhage. Background Technology

[0002] With the acceleration of industrialization, cerebral hemorrhage caused by traffic accidents and trauma has become a global public health focus: high incidence, high mortality and disability rates, heavy long-term care burden for survivors, and the lack of clear hematoma clearance mechanisms seriously restricts the development of efficient and low-cost treatment options.

[0003] The brain is covered by three layers of meninges—the dura mater, arachnoid mater, and pia mater. The pia mater, together with blood vessels, forms the choroid plexus and secretes cerebrospinal fluid. The meninges act as the brain's "exoskeleton" and are rich in immune cells and fibroblasts, constantly maintaining central immune homeostasis. Although the brain only accounts for 2-3% of body weight, it consumes more than 20% of the body's energy and is extremely dependent on blood supply. Once trauma or disease causes a rupture of intracranial blood vessels, blood rushes into the meningeal spaces, immediately threatening neurological function and life. Types of brain hemorrhage include subarachnoid hemorrhage (SAH) and dural-associated hemorrhage.

[0004] Previous studies have confirmed that erythrocytes in SAH can be phagocytosed by microglia or drained to the deep cervical lymph nodes. However, in vivo, single-cell resolution, and full-process observation has long been lacking due to: 1. The lack of animal models that realistically simulate the disease. Traditional models (autologous blood intraventricular injection, collagenase induction) cannot reproduce the natural evolution of hematomas in the subarachnoid space or within / outside the dura mater. 2. The lack of a large field-of-view, high-resolution, long-term imaging platform covering centimeter-level trauma. Existing CT / MRI is insufficient to cover the spatial-temporal-cellular triple scale. To address these issues, the inventors, in collaboration with Academician Dai Qionghai's team, focused on developing the third-generation RUSH confocal (6 × 4.2 mm² imaging area, single-cell resolution, 4 Hz imaging frequency) and the 2pSAM two-photon synthetic aperture microscope. They also innovated a backlight imaging strategy, achieving, for the first time, continuous, full-wound, single-cell-level in vivo tracking over three weeks in a mouse model of spontaneous meningeal hemorrhage induced by mechanical injury. Experiments revealed that within 24 hours of hemorrhage, the wound was enveloped by a previously unseen tissue. This tissue continuously contracted at a rhythmic 1-3 Hz, constantly deforming and stretching to cut centimeter-sized blood clots into microemboli of approximately 10 µm, significantly accelerating hematoma disintegration and clearance. The inventors named it Mesher (Meningeal space hemorrhage repairer). This discovery provides a novel entry point for elucidating the physiological clearance mechanism of meningeal space hematomas and developing therapies that promote endogenous repair.

[0005] The Hmmr gene (Hyaluronan-mediated motility receptor, also known as RHAMM, Receptor for Hyaluronan-Mediated Motility) is a key gene encoding a hyaluronic acid (HA)-mediated cell motility receptor. Existing technology CN 115851952 A discloses that this gene can be used as a biomarker for the prognostic diagnosis of head and neck squamous cell carcinoma, and CN 106119405 A discloses that this gene, in combination with other genes, can be used as a prognostic marker for lung cancer. Summary of the Invention

[0006] This invention utilizes single-cell sequencing of a mouse model of mechanically induced cerebral hemorrhage and creates Hmmr-EGFP transgenic mice. Through in vivo animal imaging verification, it was discovered that the Hmmr gene and its positive cells are highly correlated with the absorption and repair process of cerebral hemorrhage hematoma. Specifically, after cerebral hemorrhage, the expression level of the Hmmr gene and the number of positive cells significantly increase; after hematoma absorption, the Hmmr positive cells disappear. Furthermore, Hmmr positive cells were detected in samples extracted from human subdural hemorrhage surgery, showing a significant increase in the number of Hmmr positive cells compared to the normal control group.

[0007] Based on this, the Hmmr gene or its positive cells can be used as biomarkers for the diagnosis, monitoring, treatment response assessment, and prognosis of cerebral hemorrhage, and can also serve as targets for chemical and biological drugs used in the treatment of cerebral hemorrhage. Therefore, the following technical solution is proposed.

[0008] In a first aspect, the present invention provides the application of a reagent for detecting the Hmmr gene or its positive cells in the preparation of a product; said product is used for the diagnosis of cerebral hemorrhage.

[0009] Secondly, the present invention provides the application of reagents for detecting the Hmmr gene or its positive cells in the preparation of products; said products are used to monitor cerebral hemorrhage.

[0010] Thirdly, the present invention provides the application of a reagent for detecting the Hmmr gene or its positive cells in the preparation of a product; said product is used to evaluate the therapeutic response to drugs for treating cerebral hemorrhage.

[0011] Fourthly, the present invention provides the application of reagents for detecting the Hmmr gene or its positive cells in the preparation of products; said products are used for prognostic assessment of cerebral hemorrhage.

[0012] In some implementations, the product includes: a chip, a test strip, a drug, a formulation, a reagent, a kit, or a high-throughput screening platform.

[0013] In some implementations, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells increases with the amount of cerebral hemorrhage.

[0014] In some implementations, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells increases in organisms with cerebral hemorrhage compared to healthy organisms; as the hematoma is absorbed, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells decreases to the level of healthy organisms.

[0015] In some embodiments, the reagent is used to detect the Hmmr gene or its positive cells in a subject or a sample from a subject.

[0016] In the specific implementation process, the reagents include, but are not limited to, reagents used for RT-PCR, real-time quantitative PCR, immunoassay (e.g., ELISA, RIA, multiplex immunoassay, immunofluorescence assay, protein blotting, or dot blot assay), flow cytometry, in situ hybridization, or microarray technology to detect the expression level of the Hmmr gene or the number of Hmmr gene-positive cells.

[0017] In some implementations, the sample is a blood sample.

[0018] Fifthly, this invention provides the application of the Hmmr gene or its positive cells in the diagnosis, monitoring, treatment response assessment, or prognosis of cerebral hemorrhage.

[0019] In some embodiments, the present invention provides a method for diagnosing, monitoring, evaluating treatment response, or predicting prognosis of cerebral hemorrhage, comprising: detecting the expression level or activity of the Hmmr gene or Hmmr protein in a subject or a sample from a subject.

[0020] In some implementations, when the expression level or activity of the Hmmr gene or Hmmr protein in a subject or a sample from a subject is higher than that in a healthy organism, it indicates that the subject has experienced cerebral hemorrhage or has an increased risk of cerebral hemorrhage, or has a poor treatment response or poor prognosis.

[0021] In some implementations, when the expression level or activity of the Hmmr gene or Hmmr protein in a subject or a sample from a subject is comparable to the expression level or activity of the Hmmr gene or Hmmr protein in a healthy organism, it indicates that the subject has not experienced cerebral hemorrhage or has a low risk of cerebral hemorrhage, or has a good treatment response or a good prognosis.

[0022] In a sixth aspect, the present invention provides the application of regulators of Hmmr gene or Hmmr protein expression or activity in the treatment of cerebral hemorrhage.

[0023] Since the Hmmr gene or protein of the present invention can serve as a target for chemical and biological drugs for the treatment of cerebral hemorrhage, its related modulators can target the Hmmr gene or protein to treat cerebral hemorrhage.

[0024] In a seventh aspect, the present invention provides the use of regulators of Hmmr gene or Hmmr protein expression or activity in the preparation of medicaments for the treatment of cerebral hemorrhage.

[0025] In some embodiments, the regulators of Hmmr gene or Hmmr protein expression or activity include inhibitors or antagonists.

[0026] In practical implementation, inhibitors and / or antagonists refer to any substance that can reduce the expression of nucleic acids encoding Hmmr, reduce Hmmr protein levels, or inhibit Hmmr activity. For example, substances that reduce Hmmr protein activity, reduce the stability of the Hmmr gene or protein, downregulate Hmmr expression, reduce the effective duration of Hmmr protein action, or inhibit Hmmr transcription and translation.

[0027] Preferably, the inhibitors or antagonists include, but are not limited to: nucleic acid inhibitors, protein inhibitors, proteolytic enzymes, protein-binding molecules; and combinations thereof.

[0028] The nucleic acid inhibitors are selected from: interfering molecules that target Hmmr or its transcripts and can inhibit Hmmr gene expression or gene transcription, including: shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, or constructs that can express or form said shRNA, small interfering RNA, dsRNA, or microRNA.

[0029] Among them, the protein-binding molecules are selected from: substances that specifically bind to Hmmr proteins, such as antibodies or ligands that can inhibit the activity of Hmmr proteins; competitive agents for Hmmr ligand binding sites, including Hmmr receptor-ligand binding fragments, soluble truncated Hmmr receptors, soluble Hmmr receptor fusion proteins, such as Hmmr fusion proteins containing the Fc portion of IgG immunoglobulins, ligand fusion proteins; peptides; peptide inhibitors; small molecule compounds; and combinations thereof.

[0030] In an eighth aspect, the present invention provides a composition, drug, formulation or therapeutic kit containing a regulator of Hmmr gene or Hmmr protein expression or activity.

[0031] In some embodiments, the composition, drug, formulation, or therapeutic kit may also include other drugs for treating cerebral hemorrhage.

[0032] In some embodiments, the composition, drug, formulation, or therapeutic kit further includes one or more pharmaceutically acceptable excipients, carriers, and / or solvents.

[0033] In a ninth aspect, the present invention provides a kit for the diagnosis, monitoring, treatment response assessment or prognosis of cerebral hemorrhage, comprising reagents for detecting the expression or activity of the Hmmr gene or Hmmr protein.

[0034] In a tenth aspect, the present invention provides a method for screening candidate drugs for treating cerebral hemorrhage, comprising: treating a system expressing or containing the Hmmr gene or Hmmr protein with a substance to be screened, and detecting the expression level or activity of the Hmmr gene or Hmmr protein in the system before and after treatment.

[0035] Preferably, the expression level or activity of the Hmmr gene or Hmmr protein in the system after treatment is lower than that in the system before treatment, indicating that the substance to be screened is a candidate drug for treating cerebral hemorrhage.

[0036] Preferably, the system includes (but is not limited to): a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

[0037] Preferably, the candidate drug includes (but is not limited to): interfering molecules, nucleic acid inhibitors, and small molecule compounds designed to target the Hmmr gene or its upstream or downstream genes.

[0038] Preferably, the Hmmr gene-positive cells of the present invention include fibroblasts, myofibroblasts, or macrophages.

[0039] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0040] This invention has identified a novel biomarker, Hmmr, associated with cerebral hemorrhage. This biomarker enables the diagnosis, monitoring, treatment response assessment, and prognosis of cerebral hemorrhage. Furthermore, it can serve as a target for chemical and biological drugs used in the treatment of cerebral hemorrhage, facilitating the screening and development of therapeutic agents. This invention provides a novel molecular diagnostic tool for cerebral hemorrhage and has broad application prospects. Attached Figure Description

[0041] Figure 1These are the screening results from single-cell sequencing and immunofluorescence experiments; where A shows the cell types of different populations; B shows the tSNE populations of different cells; C shows the expression of Hmmr; D shows the immunofluorescence staining verification results, demonstrating the increase of Hmmr signal after hemorrhage; and E shows the quantitative analysis results of fluorescence intensity; NT is the control group, n = 3 mice; and MSH is the model group, n = 3 mice. P < 0.05.

[0042] Figure 2 This is the ROC analysis curve of Hmmr expression level.

[0043] Figure 3 This is the validation result of the Hmmr distribution in human subdural hematoma samples; A is the U-MAP cluster diagram showing the clustering of the normal healthy group HC (n=2), 14 dph (n=2), 30 dph (n=2) and 60 dph (n=2); B is the distribution of Hmmr in all sample clusters (n=8); C shows the Hmmr gene expression level in each sample; HC represents the healthy control group, and dph represents the number of days after hemorrhage. Detailed Implementation

[0044] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they are performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0045] Example 1: Screening of biomarkers related to cerebral hemorrhage

[0046] This embodiment uses a mouse model of cerebral hemorrhage to screen for biomarkers related to cerebral hemorrhage. The steps are as follows:

[0047] 1. Ordinary B6 mice underwent craniotomy implantation at 6-8 weeks of age. Cerebral blood vessels were slightly damaged using a syringe to induce spontaneous bleeding after implantation, mimicking the bleeding process following clinical brain injury. Successful modeling was defined as the hemorrhage covering more than 30% of the craniotomy area. Mouse groups: control group (also known as untreated group, normal group, or NT group) 3 mice; model group (also known as hematoma group or MSH group) 3 mice.

[0048] 2. Mice with successful model establishment underwent single-cell sequencing to compare the normal group and the model group, and genes highly expressed in the model group were screened. Candidate genes were then validated using immunofluorescence.

[0049] 3. After validating the candidate gene, Hmmr-EGFP transgenic mice were created and tagged with fluorescent tags. The method for creating Hmmr-EGFP transgenic mice is as follows:

[0050] Using CRISPR / Cas-mediated gene knock-in technology, (1) the stop codon TAG of the pclaf gene was replaced with the expression cassette “3xEAAAK-EGFP-P2A-CreERT2”. (2) When constructing the donor vector, BAC clone RP23-177B17 was used as a template to generate homologous arms by PCR technology. (3) To prepare genetically engineered mice, Cas9 protein, gRNA and donor vector were injected into fertilized eggs. (4) The newborn mice were preliminarily genotyped by PCR and subsequently confirmed by sequencing analysis.

[0051] The gRNA sequence is: AGATGCAACTTCAAGAATCATGG

[0052] 4. The transgenic mice were modeled according to the method in step 1. Two-photon and wide-field microscopy imaging was performed on them using the third-generation RUSH imaging system RUSHconfocal to observe the relationship between the hematoma absorption process and the candidate genes.

[0053] The screening results of single-cell sequencing and immunofluorescence experiments are as follows: Figure 1 As shown, by comparing the single-cell sequencing results of mice in the model group and the control group, it was found that Hmmr signal was specifically concentrated in the increased cell population after hemorrhage. Immunofluorescence experiments showed that the Hmmr signal in the model group was significantly increased compared with the control group (P < 0.05).

[0054] Example 2

[0055] This embodiment performs specificity-sensitivity (ROC) analysis on Hmmr, a marker related to cerebral hemorrhage obtained in Example 1. Specifically, ROC analysis was performed on the Hmmr gene expression levels in 3 control mice (13 immunofluorescence images) and 3 model mice (14 immunofluorescence images). The ROC curves are shown below. Figure 2As shown, the results indicate that the 95% confidence interval of the ROC is between 0.5206 and 0.9410, P < 0.05, and the AUC value is 0.7038. Simultaneously, the highest sensitivity is 92.6%, while the sensitivity at 100% specificity is 64.29%. This result demonstrates that Hmmr protein expression has very strong specificity in mouse samples with cerebral hemorrhage. Using Hmmr to diagnose cerebral hemorrhage has high specificity and sensitivity.

[0056] Example 3

[0057] This embodiment uses human samples to validate the Hmmr marker related to cerebral hemorrhage. The steps are as follows: Meningeal tissue from two healthy individuals (control group, HC) and six patients with subdural hemorrhage were obtained from Yijishan Hospital of Wannan Medical College. The specific hemorrhage times were: 14 days (14 dph), 30 days (30 dph), and 60 days (60 dph) for two patients each. All experiments were conducted with the approval of the Ethics Committee of Yijishan Hospital (Approval No.: 2024-186). Single-cell sequencing was performed on the samples to analyze the expression of the Hmmr gene in different clinical samples and to analyze the temporal changes in different samples.

[0058] Experimental results are as follows Figure 3 As shown, the results indicated that the mean relative expression level of the Hmmr gene was 0.0175 in the healthy control group, while it was 0.1372 in the hemorrhage group. Further analysis revealed that Hmmr gene expression in human samples exhibited a temporal distribution consistent with hematoma absorption. Specifically, Hmmr gene expression was extremely low in normal human meningeal tissue, peaked 14 days after hemorrhage, gradually decreased after 30 days, and approached the level of Hmmr gene expression in normal human meningeal tissue after 60 days. These results demonstrate that the expression level of the Hmmr gene exhibits a consistent temporal variation with the occurrence, development, and absorption of hematoma after cerebral hemorrhage, suggesting that Hmmr can serve as a biomarker for cerebral hemorrhage.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of reagents for detecting the Hmmr gene or its positive cells in the preparation of the product; said product is used for the diagnosis of cerebral hemorrhage.

2. Application of reagents for detecting the Hmmr gene or its positive cells in the preparation of the product; the product is used to monitor cerebral hemorrhage.

3. The application according to claim 1 or 2, characterized in that, The products include: chips, test strips, formulations, reagents, kits, or high-throughput screening platforms.

4. The application according to claim 1 or 2, characterized in that, The expression level of the Hmmr gene or the number of Hmmr gene-positive cells increases with the increase of cerebral hemorrhage.

5. The application according to claim 1 or 2, characterized in that, Compared to healthy organisms, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells increased in organisms with cerebral hemorrhage; as the hematoma was absorbed, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells decreased to the level of healthy organisms.

Citation Information

Patent Citations

  • Prognosis marker for lung cancer, method for anticipating lung cancer prognosis by using marker and application of marker

    CN106119405A

  • Biomarker for prognosis diagnosis of head and neck squamous cell carcinoma as well as screening method and application of biomarker

    CN115851952A