Yellow morel strain zjhydj001 with high iron content and application thereof

By optimizing cultivation conditions and harvesting timing, the yield and quality of the yellow morel strain ZJHYDJ001 were improved, solving the problems of mutation, low yield, low iron content and high temperature resistance in existing varieties in artificial cultivation, and achieving cultivation results with high iron content, high yield and high quality.

CN120737982BActive Publication Date: 2026-05-29KUNMING INST OF EDIBLE FUNGI CHINA NAT SUPPLY & MARKETING GENERAL COOP

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
KUNMING INST OF EDIBLE FUNGI CHINA NAT SUPPLY & MARKETING GENERAL COOP
Filing Date
2025-09-01
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing yellow morel mushroom varieties exhibit high mutation rates, low yields, high contamination rates, small fruiting body size, lack of high-temperature resistance during fruiting, and insufficient iron content when cultivated in artificial fields, all of which affect yield and quality.

Method used

By using the yellow morel strain ZJHYDJ001 with high iron content, adjusting the harvesting time and cultivation conditions, and optimizing the cultivation substrate formula, we ensured that the strain grew in a high-temperature environment, thereby improving yield and quality.

Benefits of technology

High-yield and high-quality cultivation of the yellow morel strain ZJHYDJ001 with high iron content has been achieved, with an average yield of 0.552 kg per square meter and 276 kg per mu. The fruiting body cap length reaches 71.86 mm, the stipe length is 90.66 mm, and the iron content is 659 mg/kg. It has the ability to resist high temperature during fruiting and reduces disease and deformity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120737982B_ABST
    Figure CN120737982B_ABST
Patent Text Reader

Abstract

The application discloses a yellow morel strain ZJHYDJ001 with high iron content and an application thereof, relates to the technical field of microorganisms, and has a preservation number of CGMCC No.41871 and a classification name of morel Morchella sp. The average yield of the strain per square meter is 0.552 kg, and the average yield per mu can reach 276 kg; by adjusting the picking time, fruit bodies suitable for dry products with larger sizes of stipes and caps can be obtained, the length of the cap of the obtained fruit body can reach 71.86 mm, the length of the stipe can reach 90.66 mm, and the overall weight of a single fruit body can reach 34.6 g.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of microbial technology, and in particular to a yellow morel strain ZJHYDJ001 with high iron content and its applications. Background Technology

[0002] Morel mushrooms ( Morel Its biological taxonomy belongs to the phylum Ascomycota ( Ascomycota ), class Discomycetes ( Pezizomycetes Morelaceae ( Morchellaceae Morel ( ) Morchella It is a rare edible and medicinal fungus with a worldwide distribution. It has the effects of benefiting the stomach and intestines, aiding digestion, resolving phlegm and regulating qi, tonifying the kidneys and promoting qi absorption, and nourishing the brain and refreshing the mind. It also has functions such as anti-oxidation, antibacterial, antiviral, immune regulation and liver protection.

[0003] Morel mushrooms were first successfully cultivated indoors in the late 20th century, using the red morel variety. Since 2012, my country has achieved commercial cultivation of black morel species, covering most parts of the country. Currently, *Morchella importuna*, *Morchella sextelata*, and *Morchella eximia* are the main species cultivated in the field in China.

[0004] Commercially cultivated morel varieties all belong to the black morel lineage and are ecologically typical of burnt-land species. In addition, Mel-9, Mel-13, *M. owneri*, and Mes-21 have also been reported to produce fruiting mushrooms. However, yellow morels ( Morchella sp. Although there have been attempts at biomimetic domestication cultivation in open fields, under forests, and indoors, the proportion of aberrations in the fruiting bodies of existing yellow morel varieties during artificial field cultivation can reach 80%, resulting in the inability to stably inherit the desirable traits of the mycelium. Furthermore, existing yellow morel varieties also suffer from low yields, high contamination rates, small fruiting body size, short cap lengths, and low-grade dried fruiting bodies with short overall lengths during artificial field cultivation.

[0005] Wild yellow morel mushrooms can be found in various habitats including ditches, embankments, orchards, tea gardens, field edges, roadsides, grasslands, and woodlands, but are rarely found in burned areas. Currently, neither the cultivable yellow varieties nor the traditional black varieties possess the ability to withstand high temperatures for fruiting. During artificial cultivation, temperature and humidity control within the greenhouse is necessary to meet the required levels. However, localized areas often experience poor temperature and humidity regulation, resulting in frequent crop failures in these areas and impacting the yield of artificially cultivated yellow morels.

[0006] The information disclosed in the background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art. Summary of the Invention

[0007] This application addresses the aforementioned technical problems by providing a high-iron-content yellow morel strain ZJHYDJ001 and its application. The strain has an average yield of 0.552 kg per square meter and an average yield of 276 kg per mu. By adjusting the harvesting time, larger fruiting bodies suitable for dried products with larger stipes and caps can be obtained. The length of the cap of the obtained fruiting bodies can reach 71.86 mm, the length of the stipe can reach 90.66 mm, and the total weight of a single fruiting body can reach 34.6 g.

[0008] This application provides a high-iron-content yellow morel strain ZJHYDJ001 and its application, accession number: CGMCC No. 41871; classification: morel. Morchella sp. .

[0009] Preferably, the fruiting body of the yellow morel strain ZJHYDJ001 has an iron content of 659 mg / kg and an average yield of 276 kg per mu.

[0010] Preferably, the fruiting bodies of the yellow morel strain ZJHYDJ001 have a cap length of 50.46~71.86mm, a stipe length of 47.09~90.66mm, and a total weight of 17.74~34.6g per fruiting body.

[0011] Another aspect of this application provides the application of the high-iron-content yellow morel strain ZJHYDJ001 in artificial field cultivation.

[0012] Preferably, in artificial field cultivation, when the fruiting bodies reach maturity, the fresh fruiting bodies have a stipe diameter of 11.13 mm, a stipe length of 47.09 mm, a weight of 17.74 g, a cap length of 50.46 mm, and a cap width of 38.17 mm.

[0013] Preferably, in artificial field cultivation, the fruiting bodies are harvested 3-7 days after reaching maturity. The resulting fruiting bodies have a stipe diameter of 24.39 mm, a stipe length of 90.66 mm, a weight of 34.6 g, a cap length of 71.86 mm, and a cap diameter at its widest point of 44.54 mm.

[0014] Preferably, in artificial field cultivation, after the primordia have grown, the strain can tolerate the greenhouse environment temperature of 24~29.5℃ for one month. At harvest time, there are no dead mushrooms, mushrooms that die from disease infection, deformed mushrooms, or mushrooms infected with white mold.

[0015] Preferably, artificial field cultivation includes the following steps: breaking up the spawn covered with mycelium and spreading it evenly on the pretreated, deeply tilled, and fumigated surface of the greenhouse bed, and covering it with soil to complete the sowing; 10 days after sowing, placing nutrient bags in a triangular pattern on the surface of the bed, covering it with film, watering to promote fruiting, and managing fruiting at 15~25℃ and 85% humidity for 15~25 days until the fruiting bodies enter the maturity stage and are harvested.

[0016] Preferably, the preparation of the cultivar includes the following steps:

[0017] The mother culture is inoculated into a cultivation bottle filled with cultivation material at a rate of 1 piece / bag, and then incubated in the dark at 19°C until the mycelium grows fully on the material to obtain the original culture.

[0018] The original spawn is inoculated at 10-30 grams per bag into cultivation bags filled with cultivation substrate and incubated in the dark at 19°C until the mycelium completely covers the cultivation bags to obtain the cultivation spawn. Preferably, the cultivation substrate consists of 51.5g wheat, 45g sawdust, 1.5g lime, 1g gypsum, and 1g potassium dihydrogen phosphate, with a moisture content of 60%.

[0019] All percentages used in this invention are mass percentages.

[0020] The beneficial effects that this application can produce include:

[0021] 1) This application provides the high-iron-content yellow morel strain ZJHYDJ001 and its application. The iron content of the yellow morel strain Mes-15, ZJHYDJ001, can reach 659 mg / kg, which is much higher than the iron content of existing morel varieties (the highest being only 168.2 mg / kg). This indicates that the strain has a significantly high iron content, which is beneficial for the human body to obtain the iron required by food. It effectively makes up for the problem of low iron content in existing morel varieties. The average yield of this strain is 0.552 kg per square meter, and the average yield per mu (667 square meters) can reach 276 kg. By adjusting the harvesting time, larger fruiting bodies suitable for dried products can be obtained with larger stipes and caps. The length of the cap of the obtained fruiting bodies can reach 71.86 mm, the length of the stipe can reach 90.66 mm, and the total weight of a single fruiting body can reach 34.6 g. The yield increase effect is obvious. The length of the mature fruiting bodies after drying can reach 19.3 cm, and the quality of the obtained fruiting bodies is good, belonging to the superior grade.

[0022] 2) The high-iron-content yellow morel strain ZJHYDJ001 provided in this application has the characteristics of pale yellow caps after maturity, thin and short stipes, strong aroma, and strong resistance of mycelium to contaminating bacteria. Yellow morel strain ZJHYDJ001 also has the advantages of early fruiting time, high temperature tolerance during fruiting, and high yield. During the high-temperature fruiting period with an average temperature of 26.4℃ and a maximum temperature of 29.5℃, yellow morel strain ZJHYDJ001 did not exhibit any dead mushrooms, diseases, white mold, or deformities.

[0023] Yellow morel strain ( Morchella sp. (Mes-15) ZJHYDJ001, depositary institution: China General Microbiological Culture Collection Center (CGMCC), address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, deposit date: March 31, 2025, accession number: CGMCC No. 41871; suggested classification and nomenclature: morel. Morchella sp. . Attached Figure Description

[0024] Figure 1 A schematic diagram of the growth tree of the yellow morel strain ZJHYDJ001 obtained in Example 1 of this application;

[0025] Figure 2 The mycelium and cultivation bag photographs of the *Morchella esculenta* strain ZJHYDJ001 cultivated in Examples 7 and 4 provided in this application are shown in the following images. Figure 2 a is a photograph of the hyphae and sclerotia obtained from culture in the petri dish in Example 7; Figure 2 b is a photo of the actual cultivation bag;

[0026] Figure 3 This application provides photographs of mature fruiting bodies of the artificially cultivated morel strain ZJHYDJ001 in Example 4 of this application. Figure 3 a~d are photos of mature fruiting bodies taken from different angles in the field before harvesting;

[0027] Figure 4 The images show actual photos of fruiting bodies of the artificially cultivated yellow morel strain ZJHYDJ001 at different stages in Example 4 of this application; the fruiting bodies in the images are taken every 3 days from the time of fruiting to the maturity stage; the mature fruiting bodies can reach a length of 19.3 cm after being dried. Detailed Implementation

[0028] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0029] Unless otherwise specified, all materials and instruments used in the following embodiments were obtained through commercial channels; and all detection methods used are existing methods unless otherwise specified.

[0030] The enriched culture medium used in the following examples is: glucose 20 g / L, potato juice 150 g / L, peptone 1.5 g / L, beef extract 2.5 g / L, potassium dihydrogen phosphate 1.5 g / L, magnesium sulfate 0.7 g / L, agar 17 g / L (agar is selected according to whether a solid culture medium is required), natural pH value.

[0031] Example 1: Acquisition and identification of morel strain ZJHYDJ001

[0032] 1. Collection: On May 18, 2023, Zhang Junbo collected wild-growing yellow morel fruiting bodies from the sewers in Kunming City, Yunnan Province.

[0033] (1) Tissue isolation and screening: Tissue blocks of fruiting bodies were inoculated into slant test tubes with enriched culture medium in the super-microbial platform. After 7 days of dark culture at 19℃, the tissues were purified and cultured for another 7 days. Test tubes with good growth were selected, and the strains in the test tubes were picked to prepare culture spawn. The culture spawn was inoculated into a 185g culture bag at an inoculation rate of 20-30g. The culture spawn consisted of 51.5g wheat, 45g sawdust, 1.5g lime, 1g gypsum, and 1g potassium dihydrogen phosphate. “Good growth” means that the mycelium is thick and vigorous and the sclerotia are abundant.

[0034] (2) Cultivate at 19℃ until the mycelium fully grows in the bag, transplant it into the field and cultivate until fruiting, select the fruiting bodies with better characteristics of yellow morel mushrooms, harvest them and repeat the above tissue separation process to obtain the spawn, prepare the inoculum solution according to the existing method, and inoculate it into the cultivation bag again, manage and cultivate normally until fruiting, and harvest the fruiting bodies; better characteristics of the fruiting bodies mean that the fruiting bodies have the best shape, the largest weight, and the most uniform color.

[0035] By repeatedly performing steps (1) to (2) to select and breed mushrooms, a yellow morel strain ZJHYDJ001 with high cultivation yield and good disease resistance was finally obtained.

[0036] Morel strain ZJHYDJ001 was inoculated into slant test tubes on enriched medium and cultured in the dark at 19°C for 7 days. When the mycelium had grown to two-thirds of the test tube, ... Figure 2 As shown, mycelial blocks were cut and placed in sterile distilled water cryovials and stored in a 4°C freezer.

[0037] 2. Identification of the yellow morel strain ZJHYDJ001

[0038] DNA was extracted from ZJHYDJ001 mycelia and cultivated mushroom fruiting bodies using the CTAB method, and detected by 1% agarose gel electrophoresis and GelRed staining. Using the extracted total DNA as a template, the ITS and LSU sequences were amplified using a Mix reagent (Hunan Qingke Biotechnology Co., Ltd.) with primers ITS4 (5'—TCCTCCGCTTATTGATATGC—3'), ITS5 (5'—GGAAGTAAAAGTCGTAACAAGG—3'), LR0R (5'—ACCCGCTGAACTTAAGC—3'), and LR5 (5'—TCCTGAGGGAAACTTCG—3').

[0039] The PCR amplification system was (25 μL): 12.5 μL 2×Mix, 0.5 μL each of 10 μM primers, 11 μL ddH2O (double-distilled water), and 0.5 μL DNA template. The reaction program was: 95℃ pre-denaturation for 5 min, followed by 35 amplification cycles: 95℃ denaturation for 40 sec, 50℃ annealing for 40 sec, 72℃ extension for 1 min, then 72℃ extension for 10 min, and storage at 4℃. After 1% agarose gel electrophoresis, the samples were analyzed and sent to Qingke Biotechnology for sequencing.

[0040] The sequencing results of ZJHYDJ001 mycelium and cultivated mushroom fruiting bodies were bidirectionally spliced ​​to obtain the following sequences: ZJHYDJ001 mycelium ITS sequence length 1080bp (e.g., SEQ ID: No.1) and LSU sequence length 894bp (e.g., SEQ ID: No.2); cultivated mushroom fruiting bodies ITS sequence length 1026bp (e.g., SEQ ID: No.3) and LSU sequence length 848bp (e.g., SEQ ID: No.4).

[0041] SEQ ID: No.1 (ZJHYDJ001-mycelial ITS sequence)

[0042] taacggtgga agacgccgtc atataggcgg gttccataac cggcacaaga tgttggaagg 60

[0043] gcccagggcg ggccggccgg gtcaacctca tccgcgtaat cctgctgccc actgcgctcc 120

[0044] ctccccacgc tttagggcag caaccccccg cattgggggg tggagccgga tctaagcaat 180

[0045] caatgcttcg catccatcca caacacagtt gggtgccggt gcggagtaga ctattgcggc 240

[0046] taaggaggt tcaccccggat ggaggctgac tgcgcatgca ggaccatcat ggatggattc 300

[0047] caaccatgcg ttccttcccc tggggcctga ggggtgtaaa aacccctcag cgacctgctc 360

[0048] cgacggcgtg aagagccc ccaccgtttg gcaccctctc gccattgtcc caaccaaaac 420

[0049] cctctgtgta cccttccctg ttgcttcccc cgggcaactg gctccggcca gccgggggggg 480

[0050] agaaaccaag caaaaaccct tttcgcaaaa cagacgtctg aatgtaaaaa aacaaaaaac 540

[0051] aaaagttaaa actttcaaca acggatctct tggttcccac atcgatgaag aacgcagcga 600

[0052] aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt gaacgcacat 660

[0053] tgcgccctct ggtattccgg agggcatgcc tgttcgagcg tcataaatac cgctccccct 720

[0054] cggattgctt gcggtccctg gggggttctg gcaatgtgga ttccccccgt gctttgaggg 780

[0055] catgcgaacg ggctcccagt gctgaaagac ataatgttcc cagccgaaac cggtgattta 840

[0056] tttcatcggc aggattcgtg gcaggcagac tgagggcgtc aaccgtggag tcatgaggat 900

[0057] agaaacctcc ccctttgcaa gtaacattgc tctggcagtt agatctgcag gcccgccggt 960

[0058] ctggggatgg accctcccac tcgtaggcgt cacggccacg atagcgggcg ttaaatggaa1020

[0059] tccgatccgc ccctccccgg gtggttgaag atccttgtgg gctagcaacc cctaaacaca1080

[0060] SEQ ID:No.2 (ZJHYDJ001 - Hyphal LSU sequence)

[0061] cagaaccagc tactagatgg ttcgattagt ctttcgcccc tatacccaaa tttgacgatc 60

[0062] gatttgcacg tcagaaccgc tgcgagcctc caccagagtt tcctctggct tcaccctatt 120

[0063] caggcatagt tcaccatctt tcgggtccca acagctatgc tcctactcag atccttcaga 180

[0064] agacttcggg accggtcgat ggtgcaccct tgcgggttcc cacctccgtt cactttcatt 240

[0065] tcgcgtaagg gtttgacacc caaacactcg catagatgtt agactccttg gtccgtgttt 300

[0066] caagacgggt cgctgaagac cattatgcca agcatcctag cccgaaggcg cggtcctcgg 360

[0067] tcggggctgg cggcattcac ccgggctata acactccccg aaaggagcca cattcccggg 420

[0068] acctttatcc cgccgtccca accgatgctg gcccggaggg gagcaagtgc accgcccaga 480

[0069] aggacgactg atcactcccc accgaagtct ggtctcaagc gcttcccttt caacaatttc 540

[0070] acgtactttt taactctatt ttcaaagtgc ttttcatctt tcgatcactc tacttgtgcg 600

[0071] ctatcggtct cccaccaata tttagcttta gatgaaattt accacccatt ttgagctgca 660

[0072] ttcccaaaca actcgactcg tcgaagacac ctcacatgga cggggacagc cagccaagca 720

[0073] cgggattctc accctctatg acgtcctgtt ccaaggaact taggccggcg ccctacccgg 780

[0074] agatgcctca caaaattaca acgcggacac cgggggtgcc agctttaaaa tttgagcttt 840

[0075] tgccgcttca ctcgccgtta ctgaggcaat ccctgttggt ttcttttcct ccgc 894

[0076] SEQ ID: No.3 (ZJHYDJ001 - Fruiting Body ITS Sequence)

[0077] gaagacgccg tcatataggc gggttccata accggcacaa gatgttggaa gggcccaggg 60

[0078] cgggccggcc gggtcaacct catccgcgta atcctgctgc ccactgcgct ccctccccac 120

[0079] gctttagggc agcaaccccc cgcattgggg ggtggagccg gatctaagca atcaatgctt 180

[0080] cgcatccatc cacaacacag ttgggtgccg gtgcggagta gactattgcg gctaaaggag 240

[0081] gttcacccgg atggaggctg actgcgcatg caggaccatc atggatggat tccaaccatg 300

[0082] cgttccttcc cctggggcct gaggggtgta aaaacccctc agcgacctgc tccgacggcg 360

[0083] tgaagaggac ccccaccgtt tggcaccctc tcgccattgt cccaaccaaa accctctgtg 420

[0084] tacccttccc tgttgcttcc cccgggcaac tggctccggc cagccggggg ggagaaacca 480

[0085] agcaaaaacc cttttcgcaa aacagacgtc tgaatgtaaa aaaacaaaaa acaaaagtta 540

[0086] aaactttcaa caacggatct cttggttccc acatcgatga agaacgcagc gaaatgcgat 600

[0087] aagtaatgtg aattgcagaa ttcagtgaat catcgaatct ttgaacgcac attgcgccct 660

[0088] ctggtattcc ggagggcatg cctgttcgag cgtcataaat accgctcccc ctcggattgc 720

[0089] ttgcggtccc tggggggttc tggcaatgtg gattcccccc gtgctttgag ggcatgcgaa 780

[0090] cgggctccca gtgctgaaag acataatgtt cccagccgaa accggtgatt tatttcatcg 840

[0091] gcaggattcg tggcaggcag actgagggcg tcaaccgtgg agtcatgagg atagaaacct 900

[0092] ccccctttgc aagtaacatt gctctggcag ttagatctgc aggcccgccg gtctggggat 960

[0093] ggaccctccc actcgtaggc gtcacggcca cgatagcggg cgttaaatgg aatccgatcc1020

[0094] gcccct 1026

[0095] SEQ ID: No.4

[0096] gaggttcgat tagtctttcg cccctatacc caaatttgac gatcgatttg cacgtcagaa 60

[0097] ccgctgcgag cctccaccag agtttcctct ggcttcaccc tattcaggca tagttcacca 120

[0098] tctttcgggt cccaacagct atgctcctac tcagatcctt cagaagactt cgggaccggt 180

[0099] cgatggtgca cccttgcggg ttcccacctc cgttcacttt catttcgcgt aagggtttga 240

[0100] cacccaaaca ctcgcataga tgttagactc cttggtccgt gtttcaagac gggtcgctga 300

[0101] agaccattat gccaagcatc ctagcccgaa ggcgcggtcc tcggtcgggg ctggcggcat 360

[0102] tcacccgggc tataacactc cccgaaagga gccacattcc cgggaccttt atcccgccgt 420

[0103] cccaaccgat gctggcccgg aggggagcaa gtgcaccgcc cagaaggacg actgatcact 480

[0104] ccccaccgaa gtctggtctc aagcgcttcc ctttcaacaa tttcacgtac tttttaactc 540

[0105] tattttcaaa gtgcttttca tctttcgatc actctacttg tgcgctatcg gtctcccacc 600

[0106] aatatttagc tttagatgaa atttaccacc cattttgagc tgcattccca aacaactcga 660

[0107] ctcgtcgaag acacctcaca tggacgggga cagccagcca agcacgggat tctcaccctc 720

[0108] tatgacgtcc tgttccaagg aacttaggcc ggcgccctac ccggagatgc ctcacaaaat 780

[0109] tacaacgcgg acaccggggg tgccagcttt aaaatttgag cttttgccgc ttcactcgcc 840

[0110] gttactga 848

[0111] The sequences were submitted to GeneBank, and BLAST (www.ncbi.nlm.nih.gov / BLAST) was used for homology searching. Similarity analysis was performed with sequences from various strains in the database. Sequences were downloaded from GeneBank, and species were identified using the Inter-Genetic Synthesis-LSU (ITS-LSU) matrix sequence analysis method. The ITS-LSU gene sequences of the species with the highest homology were aligned using the Clustal W function in MEGA 6.0 software. A phylogenetic tree was then constructed using neighbor-joining (NJ). Default parameters were used, with 1000 bootstrap tests.

[0112] From the obtained multi-gene phylogenetic tree ( Figure 1 As can be seen from the data, the hyphae and fruiting bodies of ZJHYDJ001 cluster together with the morel species Mes-15 (Morchella sp.) in the GeneBank database, indicating the phenotypic stability of this strain. Since the morel species Mes-15 (Morchella sp.) in the GeneBank database cluster together, based on the results of BLAST and phylogenetic tree comparison, it can be concluded that the sequenced ZJHYDJ001 is a yellow morel strain (Morchella sp. (Mes-15)).

[0113] The obtained strain ZJHYDJ001 was biopreserved on March 31, 2025, with accession number CGMCCNo.41871; the suggested classification and nomenclature is Morchella esculenta. Morchella sp. .

[0114] Example 2: Nutrient determination of Morchella sp. Mes-15 strain ZJHYDJ001

[0115] Mature yellow morel mushrooms (ZJHYDJ001) were harvested, dried, and sent to the Kunming Edible Fungus Quality Supervision and Testing Center of the All China Federation of Supply and Marketing Cooperatives for partial nutrient testing. The test results are shown in Table 1.

[0116] Table 1: Partial Nutrients of Yellow Morel Mushroom ZJHYDJ001

[0117]

[0118] Jia Hui, Fan Shangyi. Comparison of nutritional components of wild and cultivated morel mushrooms in Gannan [J]. Journal of Gansu Higher Normal University, 2023, 28(02):20-23. The article disclosed the nutritional components of wild and cultivated morel mushrooms. The iron content of all tested strains was low, with the highest being only 168.2 mg / kg. However, the iron content of *Morchella esculenta* ZJHYDJ001 reached 659 mg / kg, far exceeding the content of existing morel mushroom varieties. This indicates that this strain has a significantly high iron content, which is beneficial for the human body to obtain the iron needed from food. This effectively compensates for the problem of low iron content in existing morel mushroom varieties.

[0119] Example 3: Preparation of original and cultivated varieties

[0120] (1) Preparation of mother culture: Take the mycelial block of ZJHYDJ001 strain obtained in Example 1 and store it in a refrigerator at 4℃. Take a piece of mycelial block and inoculate it on the slant of a slant test tube (test tube specification is 18*18mm). The slant is enriched medium. Incubate in the dark at 19℃ until the mycelium covers the inner wall of the slant test tube to obtain the mother culture.

[0121] (2) The formula for the cultivation material used for the original seed and the cultivated seed is as follows: 51.5g wheat, 45g sawdust, 1.5g lime, 1g gypsum, and 1g potassium dihydrogen phosphate. Soak the wheat in water overnight for the required amount. Mix the raw materials according to the formula and stir evenly. Adjust the water content according to the requirement of 60% to obtain the cultivation material. After the obtained cultivation material is bottled, sterilize it at 121℃ for 120~150min and cool it for later use.

[0122] Inoculate the mother culture onto the cooled culture medium in the bottle. Use a square block taker (with an inner cavity size of 1cm*1cm) to take the mycelium blocks, and inoculate at 1 block / bag. Incubate in the dark at 19℃ until the mycelium grows on the culture medium to obtain the original culture.

[0123] After filling the cultivation bag with cultivation material, sterilize and cool it according to the above conditions to obtain the cultivation spawn bag. Inoculate the obtained original seed block into the cultivation spawn bag at an inoculation rate of 10-30 grams / bag. Cultivate in the dark at 19℃ until the mycelium fills the cultivation bag to obtain the cultivation spawn.

[0124] Example 4: Field Cultivation and Yield Statistics

[0125] 1. Field cultivation:

[0126] 1) Before sowing, pre-treat the planting soil, deep plow and fumigate the soil to reduce miscellaneous bacteria and pests in the soil. Start preparing for sowing when the soil temperature is continuously below 20℃ from September to December. After adding quicklime to the soil, plow it evenly and pre-moisten it. Make beds with a width of 1-1.2 m and unlimited length.

[0127] 2) When sowing, break the seed stock (0.5 kg / m²) into pieces and spread it evenly on the bed surface, then cover it with 2-3 cm of soil;

[0128] 3) 5-7 days after sowing, a large number of mycelia and white mycelial blooms will appear on the soil surface. Starting 10 days after sowing, place nutrient bags (8-10 bags / square meter, each bag about 300 g) in a triangular pattern on the bed surface. Make two parallel cuts about 3-5 cm on the side facing the ground and cover the bed surface with black mulch. Cultivate mycelium for 40-60 days. When the mycelial bloom fades and a small number of twisted particles are formed, and after the soil temperature continues to rise, remove the mulch and water to promote mushroom growth.

[0129] 4) During the fruiting management period, maintain the temperature inside the greenhouse at 15~25℃ and the air humidity at 85%. Cultivate for 15~25 days until the fruiting bodies enter the mature stage and then harvest.

[0130] The above cultivation methods are only illustrative examples. This strain can also be cultivated in the field using any of the methods disclosed in Zhao Qi, Huang Yunting, Xu Zhongzhi, et al. Current Status of Morel Cultivation Research [J]. Journal of Yunnan Agricultural University, 2009, 24(06):904-907.DOI:10.16211 / j.issn.1004-390x(n).2009.06.022.

[0131] See Figure 3 As can be seen, the fruiting bodies obtained by cultivating the strain provided in this application using this method resemble wild morel mushrooms in shape; the fruiting bodies were sampled every 3 days during the growth period after fruiting, as shown in the following figures. Figure 4 See Figure 4 The fruiting bodies have black caps after germination, turn gray as they grow, and turn yellow as they age. The stipes are white, thinner when young and thinner when mature, and thicker, longer and wrinkled when mature. Mature fruiting bodies can reach 19.3 cm in length when dried.

[0132] 2. Yield Statistics: Using the above cultivation method, 11 square areas of 1m*1m were artificially divided in the field. Morel fruiting bodies were harvested from each area, and the weight of the fruiting bodies obtained in that area was used to calculate the yield. The results are shown in Table 2.

[0133] Table 2: Yield statistics of Yellow Morel Mushroom ZJHYDJ001

[0134]

[0135] The area of ​​a 1m x 1m square region is defined as 1 square meter. Therefore, the yield result is the yield per square meter. The average of the 10 results is calculated, yielding an average yield of 0.552 kg per square meter for the yellow morel mushroom ZJHYDJ001. Based on an effective area of ​​500 square meters per mu... 2 After conversion, the average yield of yellow morel mushroom ZJHYDJ001 can reach 276 kg per mu (approximately 0.16 acres). The table shows a maximum yield of 0.79 kg per square meter, a maximum yield of 395 kg per mu, and a minimum yield of 205 kg per mu, with a total yield exceeding 200 kg per mu. Based on the current price of over 200 yuan per kg for yellow morel mushrooms, the profit per mu could reach 41,000 to 79,000 yuan, making it a considerable economic benefit.

[0136] Example 5: Analysis of fruiting body characteristics of Morchella sp. Mes-15 strain ZJHYDJ001

[0137] Cultivation experiments were conducted at the Kunming Edible Fungi Research Institute Base in Jinning District, Kunming City, Yunnan Province, following the method provided in Example 4. One hundred mature and overripe fruiting bodies were randomly selected, and their cap diameter, cap length, stipe diameter, stipe length, and weight were measured. The average values ​​of each indicator are listed in Table 3. Overripe fruiting bodies refer to fruiting bodies harvested 3-7 days after maturity.

[0138] Table 3: Average values ​​of phenotypic indicators of fruiting bodies of *Morchella asiatica* ZJHYDJ001

[0139]

[0140] The data above shows that mature fruiting bodies have thinner stipes and larger diameters and lengths at the widest point of the cap, which can effectively increase the proportion of the cap portion of the fruiting body and improve the quality of the obtained fruiting bodies.

[0141] While the size of the cap increases in older fruiting bodies, the diameter and length of the stipe also increase significantly, resulting in a decrease in the proportion of the cap to the overall fruiting body. Furthermore, the color of the cap changes noticeably in older fruiting bodies, turning yellow, and each older mushroom is heavier. Mature fruiting bodies are suitable for fresh use, while older fruiting bodies are better suited for drying. The harvesting time of this strain's fruiting bodies can be adjusted according to production needs to obtain products of different qualities.

[0142] Example 6: Test of the heat resistance of morel mushrooms cultivated from strain ZJHYDJ001 of Morchella sp. Mes-15.

[0143] Yellow morel spawn (ZJHYDJ001) and commercially available black morel spawn were inoculated onto the same substrate under the same cultivation conditions and cultivated in the field using the same method as in Example 4. The field cultivation location was the Kunming Edible Fungus Research Institute base in Jinning District, Kunming City, Yunnan Province. Field cultivation was carried out in the same greenhouse, which was divided into two equal sections: one section for planting yellow morel spawn (ZJHYDJ001) and the other section for planting commercially available black morel spawn.

[0144] During the high-temperature fruiting period in April 2025, after primordia had developed, the temperature was measured five times daily between 12:00 and 14:00 at evenly distributed temperature measurement points within the greenhouse. Any two measurement points were more than 4 meters apart. The average temperature inside the greenhouse for that day was calculated. The daily temperature measurements were repeated for 15 consecutive days, and the results are shown in Table 4.

[0145] Table 4: Temperature during the 15-day fruiting period of cultivation

[0146]

[0147] As can be seen from the table above, high-temperature environments are more likely to occur inside the greenhouse during the mushroom production period in the high-temperature season, with the temperature inside the greenhouse reaching 29.5℃.

[0148] The number of primordia, white mold, deformed fruiting bodies, growth status, dead fruiting bodies, and diseases were statistically analyzed within each region. The cultivation situation in each region was also statistically analyzed, and the number of primordia, white mold, deformed fruiting bodies, dead fruiting bodies, and diseases of each fruiting body were checked one by one. The percentage was calculated as A / total number of germinating fruiting bodies in the transplanted area * 100%; A = number of primordia, number of fruiting bodies with white mold, number of deformed fruiting bodies, number of dead fruiting bodies, and number of diseased fruiting bodies. Even if no primordia appeared, normal planting was still carried out, and the results are listed in Table 5.

[0149] Table 5: Statistical Results of Mushroom Harvesting Percentage

[0150]

[0151] Records and observations show that the yellow morel strain Morchella sp. Mes-15, strain ZJHYDJ001, has a higher resistance to high temperatures during fruiting compared to existing black morels. During the fruiting period in a high-temperature season with an average temperature of 26.4℃ and a maximum temperature of 29.5℃, conventional black varieties experience reduced primary populations, white mold growth on the cap, numerous diseases, deformed growth, poor growth, and a large number of dead mushrooms under continuous high temperatures.

[0152] The yellow morel mushroom ZJHYDJ001 provided in this application did not exhibit any dead mushrooms, diseases, white mold, or deformities. Therefore, the yellow morel mushroom ZJHYDJ001 demonstrates stronger resistance to high temperatures and diseases during the fruiting stage and can be considered a high-quality yellow morel mushroom variety. This strain can grow at temperatures ranging from 15 to 28℃ and is tolerant of medium to high temperatures.

[0153] Example 7: Statistical analysis of sclerotia of *Morchella sp. Mes-15* strain ZJHYDJ001

[0154] After obtaining the mother culture according to the method in Example 3, it was inoculated into a culture dish containing enriched culture medium and cultured in the dark at 19°C until it was fully colonized with mycelium. A photograph of the resulting culture dish is shown below. Figure 2 As shown in a, by Figure 2 It is evident that strain ZJHYDJ001 has robust hyphae and abundant sclerotia, with the number of sclerotia reaching over 100, indicating that the strain has strong growth activity.

[0155] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A yellow morel strain ZJHYDJ001 with high iron content, characterized in that, Preservation number: CGMCC No. 41871; Classification: Morel mushroom Morchella sp. .

2. The application of the high-iron-content yellow morel strain ZJHYDJ001 as described in claim 1 in artificial field cultivation.

3. The application according to claim 2, characterized in that, In artificial field cultivation, when the fruiting bodies reach maturity, the fresh fruiting bodies have a stipe diameter of 11.13 mm, a stipe length of 47.09 mm, a weight of 17.74 g, a cap length of 50.46 mm, and a cap width of 38.17 mm.

4. The application according to claim 2, characterized in that, In artificial field cultivation, the fruiting bodies are harvested 3-7 days after reaching maturity. The resulting fruiting bodies have a stipe diameter of 24.39 mm, a stipe length of 90.66 mm, a weight of 34.6 g, a cap length of 71.86 mm, and a cap width of 44.54 mm.

5. The application according to claim 2, characterized in that, In artificial field cultivation, after the primordia have grown, the strain can tolerate the greenhouse temperature of 24~29.5℃ for one month. At harvest time, there are no dead mushrooms, mushrooms that die from disease, mushrooms that are deformed, or mushrooms infected with white mold.

6. The application according to claim 2, characterized in that, Artificial field cultivation includes the following steps: break up the spawn covered with mycelium and spread it evenly on the pre-treated, deeply tilled, and fumigated surface of the greenhouse bed, and cover it with soil to complete the sowing. Ten days after sowing, place nutrient bags in a triangular pattern on the surface of the bed, cover with film, water to promote fruiting, and manage fruiting at 15~25℃ and 85% humidity for 15~25 days. After that, the fruiting bodies enter the maturity stage and can be harvested.

7. The application according to claim 6, characterized in that, The preparation of cultivars includes the following steps: The mother culture is inoculated into a cultivation bottle filled with cultivation material at a rate of 1 piece / bag, and then incubated in the dark at 19°C until the mycelium grows fully on the material to obtain the original culture. The original strain is inoculated into cultivation bags filled with cultivation material at a rate of 10-30 grams per bag and cultured in the dark at 19°C until the mycelium fully grows in the cultivation bag to obtain the cultivation strain.

8. The application according to claim 2, characterized in that, The cultivation substrate consists of 51.5g wheat, 45g sawdust, 1.5g lime, 1g gypsum, and 1g potassium dihydrogen phosphate, with a moisture content of 60%.