Passiflora edulis penCBP gene for improving abiotic stress resistance of plants and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a Passiflora edulis for improving non-biological stress resistance of plants PenCBP gene and application thereof, the gene nucleotide sequence is shown as SEQ ID NO. 1 PenCBP gene, and the gene is first cloned from the Passiflora edulis PenCBP The gene can increase seed weight, increase the number of fibrous roots, increase leaf area, thicken the peduncle stem, increase and thicken fruit pods, improve drought resistance, high-temperature resistance and cold resistance of Arabidopsis thaliana by genetic transformation. The application provides a new reference gene for improving non-biological stress resistance of plants, changing plant phenotypes and the like, and provides a technical scheme for cross-species genetic improvement.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for improving the abiotic resistance of passion fruit. PenCBP Genes and their applications. Background Technology

[0002] Eukaryotic translation initiation factors (eIFs) play a crucial role in the regulation of plant gene expression, among which the novel cap-binding protein (nCBP) belongs to the eIF4E protein family. eIF4E and its isoform eIFiso4E, as typical cap-binding proteins, participate in the regulation of translation initiation in plant cells. Similar to other eIF4E family proteins, nCBP possesses a conserved IF4E domain, enabling it to specifically recognize the m7G cap structure at the 5' end of mRNA. This recognition activates mRNA, and through interactions with other initiation factors such as eIF4E and eIF4G, ultimately leads to mRNA translation. In Arabidopsis thaliana (… Arabidopsis thaliana In this study, nCBP is involved in male gametophyte development, root growth, and responses to biotic stress.

[0003] Abiotic stress severely affects the normal growth of passion fruit and is a critical issue that urgently needs to be addressed in the passion fruit industry. Currently, existing technologies have identified genes that enhance plant abiotic resistance under single or multiple stresses such as high temperature, low temperature, drought, and high salinity. However, genes that simultaneously confer resistance to multiple abiotic stresses and significantly increase seed weight are still insufficient. Therefore, it is essential to discover novel passion fruit genes with abiotic resistance capabilities. This will provide a solid foundation for studying the resistance mechanisms of passion fruit and utilizing them for genetic improvement, offer new insights into the regulatory functions of plant vegetative growth under abiotic stress, and provide new reference genes for research on improving plant abiotic resistance. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a passion fruit that improves the plant's abiotic resistance. PenCBP Genes and their applications.

[0005] The first aspect of the present invention is to provide a passion fruit that enhances the plant's abiotic resistance. PenCBP The gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0006] The second aspect of the present invention is to provide the passion fruit described in the first aspect of the present invention. PenCBP A gene-encoded protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] A third aspect of the present invention is to provide a passion fruit containing the passion fruit described in the first aspect of the present invention.PenCBP The recombinant vector of the gene coding region. Wherein, the original vector of the recombinant vector can adopt the vectors commonly used in the field of gene recombination, such as viruses, plasmids, etc. The present application does not make any limitation on this. In a specific embodiment of the present application, the original vector adopts pCAMBIA1304 expression vector, etc., but it should be understood that the present application can also adopt other plasmids, or viruses, etc. Preferably, the original vector of the recombinant vector is pCAMBIA1304 expression vector, Passiflora edulis PenCBP The gene coding region is located between the BglII and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

[0008] The fourth aspect of the present application is to provide a host bacterium containing the Passiflora edulis PenCBP gene coding region of the first aspect of the present application.

[0009] The fifth aspect of the present application is to provide an expression cassette containing the Passiflora edulis PenCBP gene of the first aspect of the present application, the expression cassette comprising a natural promoter sequence of the Passiflora edulis PenCBP gene, the natural promoter sequence being shown as SEQ ID NO. 3, the natural promoter sequence containing drought response element ABRE and cold stress response element LTR.

[0010] In some specific embodiments, the natural promoter sequence can drive the induced expression of the exogenous gene in drought and / or low temperature and / or high temperature.

[0011] The sixth aspect of the present application is to provide the use of the Passiflora edulis PenCBP gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in improving the drought tolerance, high temperature tolerance and cold tolerance of plants; the plants are cruciferous plants (such as Arabidopsis thaliana, Brassica), Solanaceae plants (such as tomato), Poaceae plants (such as rice, corn) or any angiosperms (such as soybean).

[0012] The seventh aspect of the present application is a method for improving the drought tolerance, high temperature tolerance and cold tolerance of target plants, the specific steps comprising:

[0013] inserting the Passiflora edulis PenCBP gene into an expression vector by cloning method, introducing the expression vector into target plants by transformation method, realizing the overexpression of the Passiflora edulis PenCBP gene, and finally improving the drought tolerance, high temperature tolerance and cold tolerance of target plants.

[0014] In some embodiments, the transformation method is Agrobacterium-mediated method, gene gun method or protoplast transfection method.

[0015] In some embodiments, the cloning method is BglII / SpeI directional cloning or homing endonuclease / seamless cloning.

[0016] In some embodiments, the plant is Cruciferae (such as Arabidopsis thaliana, Brassica napus), Solanaceae (such as tomato), Poaceae (such as rice, corn) or any angiosperm (such as soybean).

[0017] Compared with the prior art, the present application has the following beneficial effects:

[0018] The present application provides a Passiflora edulis gene which is cloned from Passiflora edulis for the first time. PenCBP The expression level of the Passiflora edulis gene is up-regulated under drought, low temperature and high temperature stresses, which indicates that the gene can improve the ability of plants to resist abiotic stresses. PenCBP The research results show that the gene can significantly improve the survival ability of plants under abiotic stresses such as drought, low temperature and high temperature, and can also increase the seed weight of plants, increase the number of fibrous roots of plants, increase the leaf area of plants, thicken the peduncle stem of plants, and increase and thicken the fruit pod of plants.The present application provides a new candidate gene for improving the abiotic stress resistance (drought resistance, high temperature resistance and cold resistance) of plants and changing the phenotype of plants. PenCBP Highly homologous genes exist in crops such as rice and tomato through comparison of public transcriptome and bioinformatics data, and the expression patterns of the genes are highly conserved with the Passiflora edulis gene. PenCBP Therefore, it is inferred that the functions of the genes are conserved across species, which provides a technical scheme for genetic improvement across species. PenCBP BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 The present application provides a Passiflora edulis gene which is cloned from Passiflora edulis for the first time. PenCBP Full-length gene cloning and PCR agarose gel electrophoresis of connected overexpression vector.

[0020] Figure 2 The present application provides a Passiflora edulis gene which is cloned from Passiflora edulis for the first time. PenCBP Relative expression amount of the Passiflora edulis gene under different abiotic stresses.

[0021] Figure 3 The present application provides a Passiflora edulis gene which is cloned from Passiflora edulis for the first time. PenCBP Relative expression amount of the Passiflora edulis gene in different tissue parts.

[0022] Figure 4 The present application provides a Passiflora edulis gene which is cloned from Passiflora edulis for the first time. PenCBP Phenotype of Arabidopsis thaliana with the Passiflora edulis gene and wild-type Arabidopsis thaliana; A: overall plant; B: fruit pod; C: seed; D: leaf.

[0023] Figure 5 For the purposes of this invention PenCBP Bar chart of thousand-seed weight of Arabidopsis thaliana and wild-type Arabidopsis thaliana.

[0024] Figure 6 For the purposes of this invention PenCBP The growth of Arabidopsis thaliana with genetic modification and wild-type Arabidopsis thaliana under abiotic stress; A: normal conditions; B: drought; C: high temperature; D: low temperature; E: high salinity. Detailed Implementation

[0025] The present invention will be further described below with reference to the accompanying drawings to provide a better understanding of it. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. The overexpression material is the Columbia ecotype (Col-0) Arabidopsis thaliana variety.

[0026] Example 1: PenCBP Gene cloning and vector construction

[0027] 1. Gene cloning

[0028] Previous studies analyzed the eukaryotic translation initiation factor eIF4E gene of passion fruit, which contains four members: PeeIF4E.a , PeeIF4E.b , PeeIFiso4E , PenCBP By comparing transcriptome data from *Passiflora purpurea* leaves treated with low temperature, high temperature, drought, and high salinity stress, *Passiflora purpurea* was screened. PenCBP The gene was expressed at a significantly higher level than the control.

[0029] Design using Primer6 tools PenCBP Full-length gene primers and PCR reaction system are shown in Table 1. Passion fruit cDNA was used as a template for amplification. PenCBP The full-length sequence of the gene was obtained. The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min, 95℃ for 40 s, 54℃ for 45 s, 72℃ for 1 min, 35 cycles, followed by inactivation at 72℃ for 10 min. Primers for each gene are shown in Table 2. After the amplification reaction, 10 µl of PCR product was taken. Electrophoresis was performed on a 1% agar gel at 120V to check whether the length of the amplified product matched the length of the target fragment CDS sequence.

[0030] Table 1 PenCBP PCR reaction system for genes

[0031] Name of each component Amount used cDNA 1µl Primer-F 1µl Primer-R 1µl 2x FastTaq Premix 12.5µl H2O 9.5µl Total volume 25µl

[0032] Table 2 PenCBPFull-length primers and PCR amplification procedure

[0033]

[0034] PenCBP The gene CDS length is 702 bp, the protein length is 232 amino acids, and the predicted subcellular location is in the cytoplasm. The full-length gene was amplified using cDNA from *Passiflora purpurea* leaves as a template. PenCBP The gene fragment was 702 bp in length. A single band was recovered using a DNA product recovery kit and then sequenced. Sequencing results showed that the cloned sequence was consistent with the transcriptome sequence. PenCBP Full-length gene cloning and ligation of overexpression vector PCR agarose gel electrophoresis image are shown below. Figure 1 As shown.

[0035] right PenCBP Gene cloning, PenCBPThe nucleotide sequence of the gene is shown in SEQ ID NO: 1 : ATGGAGATCACAGACAAGAAGGAAGCCGGAAACAACGACAACGCAGTAACGGTGGCGGACTCGGTAACTTCACTTGATAGCGAAAGCAATAACAAACATAACAACAGCGTCGATAAAGAAGCCGAAGAACGCTATGCGCGTGATCTAAAACTTGGATTGCACCCTCTCAAGAACAAATTTGTATTTTGGTACACTCGCCGAACACCAGGAGTGCGAACTCAAGGATCTTATGAGGATAATATAAAGAAAATTGCTGAGTTCAGTACGGTTGAAGCCTTTTGGGTCTGCTATTGTCACTTGGCTCGGCCTTCCTCTTTGCCCAGTCCAACAGATTTGCATCTTTTCAAGGAGGGAATCCGCCCTTTATGGGAGGACTCTGCTAACTGCAATGGTGGTAAATGGATAATTCGGTTCAAAAAGGTTGTCTCAGGTCGCTTTTGGGAGGATTTGGTCCTTGCTCTGGTAGGAGACCAACTAGAGTATGGTGATAACATTTGTGGTGCAGTGCTAAGCATTCGTTTCAATGAGGATATATTGAGTGTGTGGAATCGGAATGCATCAGATCATCAAGCTGTGATGGCCCTGAGAGATTCCATTAAAAGGCACTTAAAGCTTCCCCATGCGTATGTTATGGAATACAAGGCTCATGACGCCTCTTTGCGCGACAATTCTTCATACAGGAATACATGGTTGAGAGGCTAG (SEQ ID NO: 1)

[0036] 2. Bglll / Spe I directional cloning

[0037] (1) Vector preparation

[0038] Take pCAMBIA1304 or other binary vector containing 35S promoter, and cut with Bglll and Spel at 37 °C for 30 min, and recover the linearized large fragment.

[0039] (2) Preparation of target fragment

[0040] PCR amplification with SEQ ID NO. 1 as template, and primers of SEQ ID NO. 6 (containing BglII terminal) and SEQ ID NO. 7 (containing SpeI terminal), and the product was purified after double enzyme digestion.

[0041] (3) Ligation and transformation

[0042] The vector and the fragment were ligated with T4 DNA ligase at 22°C for 30 min at a molar ratio of 1:3, and then transformed into DH5a and coated on a kanamycin LB plate.

[0043] (4) Positive clone identification

[0044] Colony PCR, plasmid digestion / sequencing verification.

[0045] (5) Universality declaration

[0046] If the target vector lacks BglII / SpeI sites, equivalent insertion can be achieved by using the same enzyme (BamHI / AvrII) or seamless cloning (Gibson, Golden Gate), which all fall within the scope of the present application.

[0047] Example 2: Passiflora edulis PenCBP Expression analysis of the gene under different abiotic stresses

[0048] Healthy plants were selected for sampling after growing about 1 meter and having 8-10 functional leaves, and were prepared for determining the Passiflora edulis transcriptome data generated under different stresses. The growth conditions of the Passiflora edulis plants were 200 μmol / (m 2 ·s) light intensity at 30°C; 12h light / 12h dark cycle; 70% relative humidity. Healthy Passiflora edulis of purple fruit variety were selected at the same period and sampled after the following stress treatments, and the growth conditions of the plants were ensured to be consistent before sampling. Healthy virus-free Passiflora edulis seedlings of yellow fruit variety were subjected to the following stress treatments:

[0049] High-temperature stress treatment: the Passiflora edulis plants were placed at 42°C for 2, 4 and 24h.

[0050] Low-temperature stress treatment: the Passiflora edulis plants were incubated at 4°C for 20 and 48h.

[0051] Salt stress treatment: the Passiflora edulis plants were irrigated with 300mM NaCL liquid for 3 days and 10 days.

[0052] Drought stress: the relative water content of the soil was 50% and 10%.

[0053] At least three leaves were extracted from each treated plant (three biological replicates), and the obtained passion fruit leaves were rapidly frozen in liquid nitrogen. RNA was extracted for subsequent qRT-PCR detection.

[0054] Primers for real-time quantitative PCR (qPCR) of the PenCBP gene were designed using the online website (https: / / qprimerdb.biodb.org / analysis). The primers are shown in Table 3. The MonAmp™ ChemoHS qPCR Mix kit was used. PenCBP Genes were validated by qRT-PCR using EF1α as an internal reference. PenCBP Gene expression patterns under different stresses.

[0055] Extract using TBtools software PenCBP The sequence of the natural promoter of the gene (SEQ ID NO: 3), which is 2000 characters in length, was obtained using the PlantCARE online website (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). PenCBP The natural promoter sequence of the gene (SEQ ID NO: 3) was analyzed.

[0056] The promoter sequence at position 935(+) is ACGTG, belonging to ABRE (abscisic acid response element), which participates in plant responses to abiotic stresses such as drought through the ABA signaling pathway. The promoter sequence at position 1953(-) is CCGAAA, belonging to LTR (low temperature response element). LTR cis elements are key regulatory sequences in plant cold stress response genes and are typically recognized by CBF / DREB1 transcription factors. Besides ABRE and LTR, PenCBP Natural promoters of genes also contain other cis elements (such as MYB / MYC, G-box) associated with abiotic stress responses, and the presence of these elements indicates... PenCBP Gene expression can be regulated through multiple stress signaling pathways such as ABA, low temperature, and drought, thereby playing a role in plant stress resistance.

[0057] Table 3 qPCR Primer Table

[0058]

[0059] Using qRT-PCR to PenCBP Gene expression was detected under drought, high salinity, low temperature, and high temperature abiotic stresses. PenCBP The relative expression levels of genes under different abiotic stresses, such as PenCBP As shown. The results indicate that,Figure 2 All of the genes can be induced to express by the above drought, high salt, low temperature and high temperature abiotic stresses.

[0060] Example 3: Passiflora edulis PenCBP Expression analysis of the genes in different tissues

[0061] PenCBP The relative expression of the genes in different tissue parts is shown in PenCBP The expression of the genes in different tissues of Passiflora edulis was detected by qRT-PCR, Figure 3 The expression of the genes in callus was the highest, followed by roots and fruit juice. The results show that the genes not only participate in plant abiotic stress but also may be related to the growth and development of roots and fruits. PenCBP PenCBP Example 4: Phenotype of the genes in transgenic Arabidopsis

[0062] Example 4: PenCBP Phenotype of the genes in transgenic Arabidopsis

[0063] Col-0 Arabidopsis (Arabidopsis thaliana) was selected for the experiment and was cultured in a phytotron. The room temperature was 21-23°C, and the relative humidity was 70%-90%. The photoperiod was 8 h light / 16 h dark during the vegetative growth period, and was extended to 16 h light / 8 h dark during the reproductive growth period. The light intensity was kept constant at 2000 lx. PenCBP Agrobacterium-mediated floral dip transformation: Agrobacterium (Agrobacterium tumefaciens) GV3101 strain (carrying the gene) was used for floral dip transformation. The bacterial solution was cultured in YEB medium with shaking to OD600≈0.6-0.8, and the bacterial cells were collected by centrifugation at 5000 rpm for 1 min. After discarding the supernatant, the bacterial cells were resuspended in infiltration solution containing 5% (w / v) sucrose to OD600≈0.5. The primary inflorescences (5-10 cm in height, with lateral bracts pulled out) were immersed in the bacterial solution for 1 min to ensure that the inflorescences were in contact with the bacterial solution. After the dip, the inflorescences were wrapped with plastic wrap and cultured in the dark for 12 h, and then returned to normal light culture. After the fruit pods matured, the T0 generation seeds were collected.

[0064] Arabidopsis thaliana Transgenic plant screening: The T0 generation seeds were sequentially soaked in 75% ethanol (containing 2.5% Tween-100) for 1 min (repeated 3 times), and then washed with sterile water before sowing. The seeds were sown on MS solid medium containing hygromycin (25 μg / mL), and the resistant plants were screened after cold stratification at 4°C for 3 days and transfer to normal culture conditions. Stable genetic lines were obtained: the transformation and screening process was repeated, and the stable transgenic Arabidopsis lines were obtained by continuous screening to the T3 generation. Agrobacterium tumefaciens

[0065] Transgenic plant screening: The T0 generation seeds were sequentially soaked in 75% ethanol (containing 2.5% Tween-100) for 1 min (repeated 3 times), and then washed with sterile water before sowing. The seeds were sown on MS solid medium containing hygromycin (25 μg / mL), and the resistant plants were screened after cold stratification at 4°C for 3 days and transfer to normal culture conditions. Stable genetic lines were obtained: the transformation and screening process was repeated, and the stable transgenic Arabidopsis lines were obtained by continuous screening to the T3 generation.

[0066] ​​The wild type and transgenic Arabidopsis seeds were sowed in MS medium at the same time, and the growth of 8-week-old plants was observed and photographed. The transgenic Arabidopsis plants were compared with the wild type Arabidopsis plants. PenCBP The phenotype of the transgenic Arabidopsis plants and the wild type Arabidopsis plants is shown in (A: whole plant; B: pod; C: seed; D: leaf). PenCBP The transgenic Arabidopsis plants and the wild type Arabidopsis plants showed changes in phenotype, and the transgenic Arabidopsis plants showed changes in phenotype. Figure 4 The transgenic Arabidopsis plants and the wild type Arabidopsis plants showed changes in phenotype, and the transgenic Arabidopsis plants showed changes in phenotype. PenCBP The transgenic Arabidopsis plants and the wild type Arabidopsis plants showed changes in phenotype, and the transgenic Arabidopsis plants showed changes in phenotype. PenCBP The transgenic Arabidopsis plants and the wild type Arabidopsis plants showed changes in phenotype, and the transgenic Arabidopsis plants showed changes in phenotype. PenCBP The transgenic Arabidopsis plants and the wild type Arabidopsis plants showed changes in phenotype, and the transgenic Arabidopsis plants showed changes in phenotype. PenCBP The transgenic Arabidopsis plants and the wild type Arabidopsis plants showed changes in phenotype, and the transgenic Arabidopsis plants showed changes in phenotype.

[0067] Example 5: Growth analysis of transgenic Arabidopsis plants under abiotic stress Figure 5 Example 5: Growth analysis of transgenic Arabidopsis plants under abiotic stress

[0068] The wild type and transgenic Arabidopsis seeds were sowed in MS medium at the same time, and the growth of 8-week-old plants was observed and photographed. The transgenic Arabidopsis plants were compared with the wild type Arabidopsis plants.

[0069] Control condition: 28°C, 8h light / 16h dark.

[0070] Drought treatment: 200mM PEG6000 was added to the medium.

[0071] High temperature treatment: 37°C for 3 days, then returned to 28°C for 7 days.

[0072] Low temperature treatment: 4°C for 3 days, then returned to 28°C for 7 days.

[0073] High salt treatment: 100mM NaCl was added to the medium.

[0074] The germination and seedling growth of the transgenic Arabidopsis plants and the wild type Arabidopsis plants were compared. PenCBP The growth of the transgenic Arabidopsis plants and the wild type Arabidopsis plants under abiotic stress is shown in (A: normal condition; B: drought; C: high temperature; D: low temperature; E: high salt). PenCBP The results showed that the transgenic Arabidopsis plants grew better than the control (wild type Arabidopsis plants) under drought, high temperature and low temperature stress, indicating that the transgenic Arabidopsis plants could improve the drought tolerance, high temperature tolerance and cold tolerance (abiotic stress resistance) of plants. PenCBP The results showed that the transgenic Arabidopsis plants grew better than the control (wild type Arabidopsis plants) under drought, high temperature and low temperature stress, indicating that the transgenic Arabidopsis plants could improve the drought tolerance, high temperature tolerance and cold tolerance (abiotic stress resistance) of plants. Figure 6 The results showed that the transgenic Arabidopsis plants grew better than the control (wild type Arabidopsis plants) under drought, high temperature and low temperature stress, indicating that the transgenic Arabidopsis plants could improve the drought tolerance, high temperature tolerance and cold tolerance (abiotic stress resistance) of plants. PenCBP The results showed that the transgenic Arabidopsis plants grew better than the control (wild type Arabidopsis plants) under drought, high temperature and low temperature stress, indicating that the transgenic Arabidopsis plants could improve the drought tolerance, high temperature tolerance and cold tolerance (abiotic stress resistance) of plants.

[0075] Example 6:PenCBP Prediction of functional conservation of genes in rice and tomato

[0076] Although no actual conversion experiments were conducted on rice and tomatoes, reasonable inferences can be made based on the following publicly available information. PenCBP Genes have similar functions in rice and tomatoes:

[0077] 1. Publicly available transcriptome data indicate that, compared with PenCBP Genetically homologous rice PenCBP The gene expression level was significantly upregulated under drought and low temperature stress, and it was highly expressed in root tissues, which is consistent with... OsnCBP The gene expression pattern is consistent in passion fruit.

[0078] 2. The tomato genome contains... PenCBP Highly homologous genes PenCBP Genetic and phylogenetic analysis showed that the two clustered together; their promoter regions also contained ABRE and LTR elements.

[0079] 3. The nCBP domain is functionally conserved in angiosperms and participates in the regulation of root development, flowering time, and abiotic stress response.

[0080] Therefore, it is presumed SlnCBP Gene function is conserved across species, expected PenCBP PenCBP The gene can also improve drought resistance, heat resistance, and cold resistance in rice, tomatoes, and other angiosperms, and increase seed weight and the number of fibrous roots.

[0081] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A passionflower variety for enhancing abiotic resistance in plants. PenCBP Genes, characterized by, Passion fruit PenCBP The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The protein encoded by the passionflower PenCBP gene as described in claim 1, which enhances the abiotic resistance of plants, wherein the amino acid sequence of the protein is shown in SEQ ID NO:

2.

3. A recombinant vector, Agrobacterium, or expression cassette containing the Passionflower PenCBP gene as described in claim 1 for enhancing plant abiotic resistance.

4. The recombinant vector according to claim 3, characterized in that, The original vector for the recombinant vector was the pCAMBIA1304 expression vector, and the passionflower was... PenCBP The gene coding region is located between the BglII and SpeI restriction endonuclease sites in the pCAMBIA1304 expression vector.

5. Passionflower as described in claim 1, which enhances the plant's abiotic resistance. PenCBP The application of genes in improving the drought resistance, heat resistance, and cold resistance of plants, wherein the plant is a cruciferous plant, specifically Arabidopsis thaliana; the application is achieved by overexpressing the passionflower described in claim 1 in Arabidopsis thaliana. PenCBP Gene.

6. A method for improving the drought resistance, heat resistance, and cold resistance of a target plant, characterized in that, The specific steps include: using a cloning method to clone the passion fruit described in claim 1. PenCBP Gene insertion into an expression vector, followed by introduction of the expression vector into a target plant via transformation, to achieve the passion fruit described in claim 1. PenCBP Overexpression of the gene ultimately improves the drought resistance, heat resistance, and cold resistance of the target plant; the cloning method is BglII / SpeI directed cloning or isoschizase / seamless cloning; the transformation method is Agrobacterium-mediated transformation, gene gun transformation, or protoplast transfection; the target plant is a cruciferous plant, and the cruciferous plant is Arabidopsis thaliana.

Images