Multiplex PCR nucleic acid composition for central nervous system infection pathogens, detection product and application of multiplex PCR nucleic acid composition
Through multiplex PCR detection technology, using primers and probe combinations with fluorescent excitation groups, efficient, rapid and accurate detection of pathogens that infect the central nervous system is achieved, solving the problem of difficulty in early diagnosis in existing technologies, simplifying the operating procedures and improving detection efficiency.
Patent Information
- Application Number
- CN202511016914.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-22
- Publication Date
- 2025-10-03
AI Technical Summary
Existing diagnostic methods for central nervous system infections lack rapid and accurate means of detecting multiple pathogens, which makes early diagnosis difficult and delays treatment.
By adopting multiplex PCR detection technology and using a combination of primers and probes with fluorescent excitation groups, the system can simultaneously detect 12 central nervous system infection pathogens through real-time melting curve analysis, simplifying the process into one round of PCR reaction and avoiding the contamination risk of two rounds of reactions.
It has achieved accurate, rapid, high-resolution and high-sensitivity detection of 12 pathogens, simplified the operating process and improved detection efficiency and accuracy.
Smart Images

Figure CN120738342A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of multiplex PCR nucleic acid detection, and in particular to a multiplex PCR nucleic acid composition, a detection product and applications thereof for central nervous system infection pathogens. Background Art
[0002] Central nervous system infections (CNS) are a serious disease encompassing a wide range of conditions, including encephalitis, myelitis, encephalomyelitis, meningitis, and meningitis. These diseases carry high morbidity and mortality rates, and are particularly common in immunocompromised individuals. According to relevant statistics, CNS infections affect millions of people worldwide each year, causing significant suffering and financial burden to patients and their families.
[0003] At present, the commonly used methods for diagnosing central nervous system infections in clinical practice include routine cerebrospinal fluid examination, biochemical examination, smear, culture, and serological testing. However, these methods have many limitations: routine cerebrospinal fluid examination and biochemical examination can only provide some non-specific indicator changes and cannot accurately identify the type of pathogen. Although smear and culture methods can detect some pathogens, their sensitivity and specificity are low, especially for some pathogens that are difficult to culture (such as viruses, some fungi and parasites). The detection effect is poor, which can easily lead to missed diagnosis or misdiagnosis. Serological testing relies on the body to produce antibodies, and the detection window period is long, which cannot meet the needs of early diagnosis. Therefore, traditional diagnostic methods are difficult to quickly and accurately identify pathogens in the early stages of the disease, thereby delaying the best treatment time and seriously affecting the patient's prognosis.
[0004] With the rapid development of molecular biology technology, nucleic acid detection technology has gradually been applied to the field of clinical diagnosis. Nucleic acid detection kits have the following significant advantages: 1) High sensitivity and specificity: They can detect extremely low concentrations of pathogen nucleic acids, effectively avoiding false negative results; at the same time, by detecting pathogen-specific gene targets, non-specific interference is reduced, and the accuracy of diagnosis is improved. 2) Rapid detection: Compared with traditional methods such as culture, nucleic acid detection kits can complete detection in a few hours or even less, greatly shortening the diagnosis cycle and gaining valuable time for early treatment. 3) Multi-pathogen detection capability: The ability to detect multiple pathogens at the same time helps to fully understand the infection situation, and is especially suitable for complex diseases such as central nervous system infections that may be caused by multiple pathogens.
[0005] While some nucleic acid detection kits are currently available on the market, there are relatively few specialized kits for central nervous system infections. These kits also face challenges such as limited pathogen coverage and poorly optimized detection performance. Therefore, developing a nucleic acid detection kit specifically for the detection of central nervous system pathogens holds broad market potential and significant clinical application value.
[0006] In view of this, the present invention is proposed. Summary of the Invention
[0007] The purpose of the present invention is to provide a multiplex PCR nucleic acid composition, a detection product and its application for central nervous system infection pathogens to solve the above technical problems.
[0008] The present invention is achieved in that:
[0009] In a first aspect, the present invention provides a nucleic acid composition for multiplex PCR detection of central nervous system infection pathogens, comprising: primers with fluorescent excitation groups and first to twelfth primer probe sets corresponding to enterovirus, Haemophilus influenzae, human herpes virus type 6, Streptococcus pneumoniae, cytomegalovirus, Streptococcus agalactiae, herpes simplex virus type 1, Escherichia coli K1, herpes simplex virus type II, Neisseria meningitidis, varicella-zoster virus, and double echovirus;
[0010] Each primer probe set comprises a first forward primer, a second forward primer, a first reverse primer, a second reverse primer, and a probe sequence; the nucleotide sequences of the first forward primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 1-12, respectively; the nucleotide sequences of the second forward primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 13-24, respectively; the nucleotide sequences of the first reverse primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 25-36, respectively; the nucleotide sequences of the second reverse primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 37-48, respectively; and the probe sequences of the first to twelfth primer probe sets are shown in SEQ ID NOs: 49-60, respectively.
[0011] The nucleotide sequence of the primer with a fluorescent excitation group is shown in SEQ ID NO: 61;
[0012] The 3' end of each probe of the first to twelfth primer probe groups carries a fluorescent reporter group, and the absorption and emission wavelengths of the fluorescent excitation group are correspondingly shorter than the absorption and emission wavelengths of the fluorescent reporter group.
[0013] In a second aspect, the present invention also provides a multiplex PCR detection product for central nervous system infection pathogens, which includes the above-mentioned multiplex PCR detection nucleic acid composition. The multiplex PCR detection product is a reagent, a kit, a chip or a detector.
[0014] In a preferred embodiment of the present invention, the multiplex PCR detection product further comprises at least one of the following components: an amplification buffer, a nucleic acid polymerase, a positive quality control product, and a negative quality control product;
[0015] In a preferred embodiment of the present invention, the nucleic acid polymerase is a DNA polymerase.
[0016] In a third aspect, the present invention also provides the use of a multiplex PCR detection nucleic acid composition in the preparation of a multiplex PCR detection product for central nervous system infection pathogens, wherein the multiplex PCR detection product is a reagent, a kit, a chip or a detector.
[0017] In a fourth aspect, the present invention also provides a multiplex PCR detection nucleic acid composition or the use of the above-mentioned multiplex PCR detection product for central nervous system infection pathogens in multiplex PCR detection of central nervous system infection pathogens. When the sample to be tested is taken from a human or an animal, the multiplex PCR detection is not for the purpose of disease diagnosis. In the multiplex PCR detection system, the final concentration of the first forward primer in each of the first to twelfth primer probe groups is 0-800 nM, the final concentration of the second forward primer in each of the first to twelfth primer probe groups is 0-800 nM, and the final concentration of the first forward primer and the second forward primer corresponding to the pathogen is different and is 0; the final concentration of the first reverse primer in each of the first to twelfth primer probe groups is 0-800 nM, the final concentration of the second reverse primer in each of the first to twelfth primer probe groups is 0-400 nM, and the final concentration of each probe in each of the first to twelfth primer probe groups is 100-2000 nM;
[0018] The final concentration of the primer with a fluorescent excitation group is 100-2000 nM.
[0019] In a fifth aspect, the present invention also provides a multiplex PCR detection method for central nervous system infection pathogens, wherein the multiplex PCR detection nucleic acid composition is added to the reaction system, and after the amplification reaction, the product is subjected to real-time melting curve analysis.
[0020] The present invention has the following beneficial effects:
[0021] The nucleic acid composition for multiplex PCR detection of central nervous system pathogens provided by this invention can accurately, rapidly, with high resolution, and with high sensitivity detect 12 pathogens. It can be specifically used for nucleic acid detection of central nervous system pathogens and has broad market prospects and significant clinical application value.
[0022] Compared with the scheme of patent CN202110620634.7, the primer design and operation provided by the present invention are greatly simplified. The two-step PCR reaction of the scheme of patent CN202110620634.7 is reduced to one-round PCR reaction. The reaction can be completed in a single system, avoiding the need for two rounds of PCR reactions in the scheme of patent CN202110620634.7 and avoiding possible contamination caused by the transfer of the first round of reaction products.
[0023] Compared with other schemes that use fluorescent groups to distinguish different targets to achieve multiple detection, the present invention greatly expands the number of targets or pathogens that can be detected in the same reaction through the use of melting curves. For example: for a commonly used 4-channel fluorescent PCR instrument, fluorescent groups are used to distinguish different targets. Each channel can only detect one target, so the 4 channels can detect a maximum of 4 different targets. Using the scheme of the present invention, more than 4 different targets can be distinguished by different temperatures in each channel, which can be 7 or even more targets. Thus, the 4 channels can detect more than 30 different targets at the same time.
[0024] Compared to existing methods that use Taqman probes to generate melting curves, the present invention utilizes artificially designed probes that are unrelated to the sequence of the target amplification region, resulting in improved specificity. Furthermore, by utilizing the principle of fluorescence resonance energy transfer, the resulting melting curves are clearer, with more stable Tm values and better resolution. This allows for the inclusion of more melting curve peaks in the same channel with less mutual interference, thus improving identification accuracy. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.
[0026] Figure 1 is a schematic structural diagram of the second reverse primer;
[0027] Figure 2 Schematic diagram of the combination of probe and final product;
[0028] Figure 3 The melting curves are for nucleic acid templates of enterovirus, Haemophilus influenzae, human herpes virus type 6, and Streptococcus pneumoniae pathogens;
[0029] Figure 4 The melting curves are for nucleic acid templates of cytomegalovirus, Streptococcus agalactiae, herpes simplex virus type 1, and Escherichia coli K1 pathogens;
[0030] Figure 5 It is a melting curve diagram of nucleic acid templates for herpes simplex virus type II and Neisseria meningitidis pathogens;
[0031] Figure 6 The melting curves of nucleic acid templates for varicella-zoster virus, double echovirus pathogens and blank control group. DETAILED DESCRIPTION
[0032] Reference will now be made in detail to embodiments of the present invention, one or more examples of which are described below. Each example is provided to illustrate, not to limit, the present invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment may be used in another embodiment to produce further embodiments.
[0033] In the present invention, the second reverse primer structure diagram refers to Figure 1 As shown, from the 5' end to the 3' end are the (stimulation) primer binding region ( Figure 1 As shown in the number 3), the tag sequence region ( Figure 1 2 in the figure) and the template binding region ( Figure 1 (shown as 1 in the figure); the primer binding region is identical to the primer with the fluorescent excitation group; and the primer binding region does not have a fluorescent excitation group. The primer binding region is the binding region of the primer with the fluorescent excitation group. The primer with the fluorescent excitation group does not specifically bind to the target DNA template and / or target RNA template. Different target DNA templates and / or target RNA templates use different tag sequences. The template binding region is the region that is used to complement the test template.
[0034] The tag sequence region in the second reverse primer is complementary to the probe sequence and, in other embodiments, may contain 1-3 mismatched nucleotides. The probe sequence of the present invention does not hybridize to the template DNA and / or template RNA sequence and specifically binds only to the tag sequence region in the second reverse primer. The tag sequence region can be obtained from an artificial sequence.
[0035] In the present invention, a primer having a fluorescent excitation group is synonymous with an "excitation primer".
[0036] In a first aspect, the present invention provides a multiplex PCR nucleic acid composition for detecting pathogens of central nervous system infection, comprising: primers with fluorescent excitation groups and first to twelfth primer probe groups corresponding to enterovirus, Haemophilus influenzae, human herpes virus type 6, Streptococcus pneumoniae, cytomegalovirus, Streptococcus agalactiae, herpes simplex virus type 1, Escherichia coli K1, herpes simplex virus type II, Neisseria meningitidis, varicella-zoster virus, and double echovirus;
[0037] Each primer probe set comprises a first forward primer, a second forward primer, a first reverse primer, a second reverse primer, and a probe sequence; the nucleotide sequences of the first forward primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 1-12, respectively; the nucleotide sequences of the second forward primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 13-24, respectively; the nucleotide sequences of the first reverse primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 25-36, respectively; the nucleotide sequences of the second reverse primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 37-48, respectively; and the probe sequences of the first to twelfth primer probe sets are shown in SEQ ID NOs: 49-60, respectively.
[0038] The nucleotide sequence of the primer with a fluorescent excitation group is shown in SEQ ID NO: 61;
[0039] The 3' end of each probe in the first to twelfth primer probe sets carries a fluorescent reporter group, and the absorption and emission wavelengths of the fluorescent excitation group are correspondingly shorter than the absorption and emission wavelengths of the fluorescent reporter group. Specifically, the absorption wavelength of the fluorescent excitation group is correspondingly shorter than the absorption wavelength of the fluorescent reporter group; and the emission wavelength of the fluorescent excitation group is correspondingly shorter than the emission wavelength of the fluorescent reporter group.
[0040] The above-mentioned "absorption and emission wavelengths of the fluorescent excitation group are relatively short", and the fluorescent group refers to the fluorescent reporter group on the probe. The "fluorescent excitation group" on the primer with a fluorescent excitation group acts as a donor, and the fluorescent reporter group on the probe acts as an acceptor. When the excitation group on the primer with a fluorescent excitation group and the reporter group on the probe sequence are close to each other, a fluorescence resonance energy transfer (FRET) phenomenon can occur. Specifically, light of a specific wavelength (usually laser or monochromatic light) irradiates the sample to excite the donor fluorescent molecules. By utilizing the dipole-dipole interaction between the donor and the acceptor, the energy of the excited donor is directly transferred to the acceptor, causing the acceptor to emit emission light characteristic of the reporter group, while the donor itself does not emit fluorescence. When the two are far away from each other, the fluorescence resonance energy transfer phenomenon disappears, and the characteristic emission light signal of the reporter group disappears or weakens.
[0041] The detection principle is as follows: if the template is an RNA template, the first forward primer or the first reverse primer acts as a reverse transcription primer, and reverse transcribes the RNA into DNA under the action of reverse transcriptase.
[0042] If the template is a DNA template, or after reverse transcription of the RNA template is completed, the target region of the template is amplified and enriched under the action of the first forward primer and the first reverse primer.
[0043] Under the action of the second forward primer and the second reverse primer, the template, or the product formed by the first forward primer and the first reverse primer, is directly amplified to obtain a product with the sequence of the second reverse primer. That is, a tag sequence and a primer binding region are added to the product.
[0044] Subsequently, under the action of the second forward primer and the primer with a fluorescent excitation group (ie, the excitation primer), a DNA chain with a tag sequence extended from the primer with a fluorescent excitation group is amplified.
[0045] These two phases occur sequentially in the early stages of the PCR reaction. In the middle and late stages, after a certain amount of products with the tag sequence have been produced, the two phases of the reaction occur simultaneously. By controlling the concentration of each primer and following the PCR reaction schedule, a large number of DNA chains with the tag sequence are ultimately generated, derived from the extension of the excitation primer.
[0046] After the PCR reaction is completed, the melting curve program is started. The product is first heated to above 90 degrees Celsius to fully denature the product, and then lowered to 40 degrees or below to allow the probe to fully bind to the product DNA chain with the label sequence. Subsequently, the temperature is slowly raised, and the probe gradually dissociates from the product DNA chain with the label sequence. When the probe binds to the DNA chain, the reporter group on the probe and the excitation group introduced into the DNA chain by the excitation primer are physically close, resulting in fluorescence resonance energy transfer. This phenomenon can be observed and recorded by using a light source that can excite the fluorescent excitation group on the excitation primer as the incident light and recording the emission light of the reporter group. As the temperature rises, the probe gradually dissociates from the DNA chain, the signal decreases, and a melting curve is formed by recording the fluorescence signal. Near the melting temperature, the fluorescence signal drops sharply. The point with the largest temperature change rate is obtained by signal analysis, which is the melting temperature (Tm).
[0047] During this process, the fluorescence signal is recorded to form a melting curve, which determines the probe's melting temperature. Twelve CNS pathogens use 12 different tag sequences and corresponding probes, resulting in different melting temperatures. Finally, analysis of the melting temperatures can be used to correlate the target or pathogen being detected in the reaction system.
[0048] The schematic diagram of the combination of probe and final product is shown in Figure 2. Figure 2 As shown, Figure 2 In the sequences shown, the arrow indicates the 3' end, and the end without an arrow indicates the 5' end. Figure 2The number 1 in the figure refers to the probe sequence, the number 2 is the fluorescent reporter group at the 3' end of the probe, the number 3 is the template sequence part of the amplified product, the number 4 is the label sequence part of the amplified product, the number 5 is the fluorescent group on the amplified product (from the excitation primer), and the number 6 is the excitation primer on the amplified product.
[0049] In a preferred embodiment of the present invention, the fluorescent excitation group of the primer with the fluorescent excitation group is located at the 3' end of the primer. In an optional embodiment, the fluorescent excitation group is modified on the T base.
[0050] The fluorescent excitation group is located at the 3' end of the primer, allowing for physical proximity to the fluorescent reporter group of the probe (which is complementary to the tag sequence), thereby enabling fluorescence resonance energy transfer. The probe sequence can be matched to the tag sequence, forming a characteristic melting curve and generating a specific melting temperature (Tm).
[0051] In a preferred embodiment of the present invention, the fluorescent excitation group of the primer with a fluorescent excitation group is located at any nucleotide position from the 1st to the 10th nucleotide from the 3' end of the primer;
[0052] In a preferred embodiment of the present invention, the fluorescent excitation group of the primer with a fluorescent excitation group is located at any nucleotide position from the second to the fifth nucleotide from the 3' end of the primer;
[0053] In a preferred embodiment of the present invention, the fluorescent excitation group of the primer carrying the fluorescent excitation group is located at the fifth nucleotide position from the 3' end of the primer.
[0054] In a preferred embodiment of the present invention, the fluorescent excitation group includes but is not limited to ATTO 425, ATTO 488, ATTO 532, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor 532 or 6-FAM.
[0055] Primers with fluorescent excitation groups are designed from the genome of the model plant Arabidopsis thaliana and the M13 phage genome. Through theoretical screening and experimental verification, primer sequences with high amplification efficiency and good specificity are screened as potential primers with fluorescent excitation groups.
[0056] In a preferred embodiment of the present invention, the fluorescent reporter group includes but is not limited to ROX, Cy5, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, Texas Red, Cy5.5, ATTO Rho101, ATTO 590, ATTO 633, ATTO 647N, ATTO 700 or Quasar670;
[0057] In a preferred embodiment of the present invention, the fluorescent reporter group is selected from ROX, Texas Red, ATTO 647N or Cy5;
[0058] In a preferred embodiment of the present invention, each probe of the first to sixth primer probe sets is modified with ROX, and each probe of the seventh to twelfth primer probe sets is modified with Cy5.
[0059] In a second aspect, the present invention also provides a multiplex PCR detection product for central nervous system infection pathogens, which includes the above-mentioned multiplex PCR detection nucleic acid composition. The multiplex PCR detection product is a reagent, a kit, a chip or a detector.
[0060] In a preferred embodiment of the present invention, the multiplex PCR detection product further comprises at least one of the following components: an amplification buffer, a nucleic acid polymerase, a reverse transcriptase, a positive quality control product, and a negative quality control product.
[0061] Amplification buffer reagents include but are not limited to PB series, Tris series, etc. qPCR Mix includes lyophilization protectants, such as but not limited to at least one of mannitol, trehalose, dextran, gelatin, hydrogenated maltose, and sucrose.
[0062] In one embodiment, an anti-PCR inhibitor factor, such as spermidine, trehalose, or betaine, is added to the amplification buffer reagent, making the method provided by the present invention more suitable for detecting complex animal clinical samples. The final concentration of spermidine added to the multiplex PCR detection system is 0.1mM to 5mM, for example, 0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 1mM, 1.5mM, 2mM, 3mM, or 5mM.
[0063] In a preferred embodiment of the present invention, the nucleic acid polymerase is a DNA polymerase, preferably a hot start DNA polymerase, such as Tth DNA polymerase, Taq DNA polymerase, etc.
[0064] The detection product (such as a kit) provided by the present invention may also optionally include any reagents and / or consumables acceptable in the art for PCR reaction or for preparing a PCR reaction system. Specific examples may include, but are not limited to, one or more of dNTPs, salts or salt solutions, blank controls, calibrators, and PCR reaction vessels.
[0065] In a third aspect, the present invention also provides the use of a multiplex PCR detection nucleic acid composition in the preparation of a multiplex PCR detection product for central nervous system infection pathogens, wherein the multiplex PCR detection product is a reagent, a kit, a chip or a detector.
[0066] Preferably, the sample tested is a human or animal respiratory tract sample, a human or animal cerebrospinal fluid sample, a human or animal reproductive tract sample, a human or animal body fluid, a human or animal feces, a dairy product or an environmental sample.
[0067] In a fourth aspect, the present invention also provides a multiplex PCR detection nucleic acid composition or the use of the above-mentioned multiplex PCR detection product for central nervous system infection pathogens in multiplex PCR detection of central nervous system infection pathogens. When the sample to be tested is taken from a human or an animal, the multiplex PCR detection is not for the purpose of disease diagnosis; when the sample to be tested is a dairy product or an environmental sample, it is not limited to the purpose of disease diagnosis and non-disease diagnosis; in the multiplex PCR detection system, the final concentration of the first forward primer in the first to twelfth primer probe groups is 0-800nM, the final concentration of the second forward primer in the first to twelfth primer probe groups is 0-800nM, and the final concentration of the first forward primer and the second forward primer of the corresponding pathogen is 0 when they are different; the final concentration of the first reverse primer in the first to twelfth primer probe groups is 0-800nM, the final concentration of the second reverse primer in the first to twelfth primer probe groups is 0-400nM, and the final concentration of the probe in the first to twelfth primer probe groups is 100-2000nM;
[0068] The final concentration of the primer with a fluorescent excitation group is 100-2000 nM.
[0069] In a preferred embodiment of the present invention, the multiplex PCR detection procedure includes: 40-55°C, 1-10 min; 95°C, 2 min; 94°C 2-15 s, 58°C 10 s-50 s, 35-45 cycles to obtain amplified products.
[0070] In a preferred embodiment of the present invention, a real-time melting curve analysis is performed on the amplified product, and the conditions for the melting curve analysis include:
[0071] Fluorescence values were collected every 0.5-1°C, and the temperature range for collecting fluorescence signals was 40°C to 90°C;
[0072] Preferably, before the temperature-raising reaction, the steps further include: 95° C. for 2 min; and 40° C. for 90 s.
[0073] In a fifth aspect, the present invention also provides a multiplex PCR detection method for central nervous system pathogens. The multiplex PCR detection nucleic acid composition described above is added to the reaction system. After the amplification reaction, the products are subjected to real-time melting curve analysis. The presence of the corresponding pathogen in the template is further determined based on the melting curve, specifically based on the Tm value of the probes preset for the corresponding pathogen.
[0074] The samples to be tested in the reaction system include but are not limited to: human or animal cerebrospinal fluid samples, human or animal tissue samples, urine samples, environmental samples, etc.
[0075] Environmental samples are selected from soil, air, ward samples, water samples, soil-water mixed samples and the like.
[0076] Animal tissues include but are not limited to: brain, eyes, central nervous system, lymph nodes, liver and heart, and body fluids include but are not limited to: blood, serum, plasma, intracellular fluid, interstitial fluid, such as lymph fluid and cerebrospinal fluid.
[0077] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.
[0078] The features and performance of the present invention are further described in detail below with reference to the embodiments.
[0079] Example 1
[0080] This example provides a multiplex PCR detection nucleic acid composition for central nervous system infection pathogens and the selection of its target gene.
[0081] Central nervous system infections (CNS) are inflammatory diseases caused by pathogens invading the meninges, brain parenchyma, or spinal cord. Common pathogens include bacteria, viruses, fungi, spirochetes, rickettsiae, and parasites. Different pathogens can cause different types of infections, including meningitis, encephalitis, meningoencephalitis, and myelitis. These infections manifest with symptoms such as fever, headache, vomiting, impaired consciousness, and convulsions. In severe cases, they can lead to neurological damage and even be life-threatening.
[0082] There are many pathogens that can cause central nervous system infections, and the disease is acute, so rapid detection and identification of pathogens is very important. This example selects 12 common central nervous system infection pathogens and uses multiple nucleic acid detection and identification of pathogens.
[0083] Information on the 12 pathogens that cause central nervous system infections is as follows:
[0084]
[0085]
[0086] The multiplex PCR detection nucleic acid composition comprises: a primer with a fluorescent excitation group and first to twelfth primer probe groups corresponding to enterovirus, Haemophilus influenzae, human herpes virus type 6, Streptococcus pneumoniae, cytomegalovirus, Streptococcus agalactiae, herpes simplex virus type 1, Escherichia coli K1, herpes simplex virus type II, Neisseria meningitidis, varicella-zoster virus and double echovirus, each primer probe group comprises a first forward primer, a second forward primer, a first reverse primer, a second reverse primer and a probe sequence; the nucleotide sequences of the first forward primers of the first to twelfth primer probe groups are shown in SEQ ID NOs: 1-12, the nucleotide sequences of the second forward primers of the first to twelfth primer probe groups are shown in SEQ ID NOs: 13-24, the nucleotide sequences of the first reverse primers of the first to twelfth primer probe groups are shown in SEQ ID NOs: 25-36, and the nucleotide sequences of the second reverse primers of the first to twelfth primer probe groups are shown in SEQ ID NOs: ID NOs: 37-48, and the probe sequences of the first to twelfth primer probe sets are shown in SEQ ID NOs: 49-60, respectively;
[0087] The nucleotide sequence of the primer with a fluorescent excitation group is shown in SEQ ID NO: 61; specifically, A.th-ole-F7m1-FAM5:ACCTGAAGACGGAACATCATC (the 17th position, i.e., the 5th from the bottom, the base T is modified with a FAM fluorescent group).
[0088] Each probe in the first to twelfth primer probe sets has a fluorescent reporter group at its 3' end, and the absorption spectrum of the fluorescent reporter group overlaps with the emission spectrum of the fluorescent excitation group. Each probe in the first to sixth primer probe sets is modified with ROX, and each probe in the seventh to twelfth primer probe sets is modified with Cy5.
[0089] The first forward primer (i.e., forward primer F1) is as follows:
[0090]
[0091]
[0092] The sequence of the second forward primer (i.e., forward primer F2) is shown in the following table:
[0093]
[0094] The sequence of the first reverse primer (i.e., reverse primer R1) is shown in the following table:
[0095]
[0096]
[0097] The sequence of the second reverse primer (i.e., reverse primer R2) is shown in the following table:
[0098]
[0099]
[0100] The probe sequences are shown in the table below. Modification groups are assigned according to ROX and Cy5 channels:
[0101]
[0102] Example 2
[0103] This example provides a kit and reaction system for detecting the 12 central nervous system infection pathogens shown in Example 1. The kit includes a reaction solution, a detection solution, a positive control, and a negative control.
[0104] The following is the system composition of a single reaction of the kit (including 12 pathogen targets):
[0105] Components Volume per reaction (μl) 10x PCR Buffer 2.5 dNTP (2.5 mM each) 0.1 Taq DNA Polymerase (5U / μl) 0.125 Reverse transcriptase (200 U / μl) 1 Forward primer F1 (10 μM) 1.2 (0.1 each, 12 in total) Forward primer F2 (10 μM) 1.2 (0.1 each, 12 in total) Reverse primer R1 (10 μM) 1.2 (0.1 each, 12 in total) Reverse primer R2 (10 μM) 0.6 (0.05 each, 12 in total) Probe (10 μM) 3 (0.25 each, 12 in total) Activation primer A.th-ole-F7-FAM3 (10 μM) 1 <![CDATA[ddH2O]]> 8.1 Detection template 5 Total volume 25
[0106] Considering that when used as a kit, if the amplification system needs to be prepared each time, the operation is very complicated, and the small amount of each component will lead to large pipetting errors. Therefore, some components are prepared in advance and then used together at the time of use.
[0107] At the same time, in order to ensure the stability of the enzyme, the enzyme and primers and other components should be stored separately; in order to prevent the enzyme from being frozen when stored at -20 degrees, an appropriate amount of glycerol needs to be added to the enzyme-containing component.
[0108] The specifications of the kit can be any combination of 1 serving, 10 servings, 24 servings, 96 servings, etc. In this embodiment, the common 24-serving specification is used. In order to avoid loss during use, during actual assembly, about 10% more of the required amount is packaged, or the amount is rounded to a convenient packaging amount.
[0109] There are many ways to split these components, and the combination of the present invention is as follows:
[0110] Component 1: Reaction solution
[0111] Components Volume per reaction (μl) Amount for 1000 reactions (μl) 10x PCR Buffer 0.5 500 Taq DNA Polymerase (5U / μl) 0.125 125 Reverse transcriptase (200 U / μl) 1 1000 50% glycerin 4.375 4375 total 5 5000
[0112] When assembling the kit, it is packaged according to the quantity required by the kit specifications.
[0113] Component 2: Detection fluid
[0114] Components Volume per reaction (μl) Amount per 1000 reactions (μl) 10x PCR Buffer 2 2000 dNTP (2.5 mM each) 0.1 100 Forward primer F1 (10 μM) 1.2 (0.1 each, 12 in total) 1200 Forward primer F2 (10 μM) 1.2 (0.1 each, 12 in total) 1200 Reverse primer R1 (10 μM) 1.2 (0.1 each, 12 in total) 1200 Reverse primer R2 (10 μM) 0.6 (0.05 each, 12 in total) 600 Probe (10 μM) 3 (0.25 each, 12 in total) 3000 Activation primer A.th-ole-F7-FAM3 (10 μM) 1 1000 <![CDATA[ddH2O]]> 4.7 4700 total 15 15000
[0115] When assembling the kit, it is packaged according to the quantity required by the kit specifications.
[0116] In actual use, each sample is configured according to the following system:
[0117] The total reaction volume is 25 μl: 5 μl reaction solution, 15 μl test solution, and 5 μl nucleic acid template. The reaction system can be scaled up or down as needed. The negative control in the kit is deionized water, and the positive control is a plasmid synthesized as a template for the amplification of each pathogen.
[0118] The components of the 24-person test kit are as follows:
[0119] Nucleic acid detection kit for 12 central nervous system pathogens
[0120]
[0121]
[0122] The reaction procedure, as shown in the table below, requires simultaneous detection of two channels:
[0123]
[0124] Interpretation of the results: Based on the pathogen corresponding to the probe and the temperature of the probe, the range of each pathogen is determined by statistics to be the probe Tm target value ±1.5°C as the target range of the pathogen (the target value ±1.5°C is used as the target range in this embodiment, which is not intended to limit the application of the present invention. Different optimal values may be obtained in different applications based on different statistics).
[0125] The pathogen corresponding judgment table is as follows:
[0126]
[0127] Example 3
[0128] This example provides detection examples for 12 meningitis-related pathogens.
[0129] The nucleic acids of 12 pathogens, including enterovirus, Haemophilus influenzae, human herpes virus 6, Streptococcus pneumoniae, cytomegalovirus, Streptococcus agalactiae, herpes simplex virus type 1, Escherichia coli K1, herpes simplex virus type 2, Neisseria meningitidis, varicella-zoster virus, and double echovirus, were used as templates, and the blank control was sterile water. The kit components in Example 2 were used and the detection method of the kit in Example 2 was used for detection.
[0130] Figure 3 The results showed that the detection results of the enterovirus template had a characteristic peak at ROX channel Tm54.6, which was consistent with the expected pathogen; the detection results of the Haemophilus influenzae template had a characteristic peak at ROX channel Tm60.3, which was consistent with the expected pathogen; the detection results of the human herpes virus type 6 template had a characteristic peak at ROX channel Tm65.3, which was consistent with the expected pathogen; the detection results of the Streptococcus pneumoniae template had a characteristic peak at ROX channel Tm70.1, which was consistent with the expected pathogen;
[0131] Figure 4 The results showed that the detection results of the cytomegalovirus template had a characteristic peak at ROX channel Tm74.2, which was consistent with the expected pathogen; the detection results of the Streptococcus agalactiae template had a characteristic peak at ROX channel Tm78.6, which was consistent with the expected pathogen; the detection results of the herpes simplex virus type I template had a characteristic peak at Cy5 channel Tm52.6, which was consistent with the expected pathogen; the detection results of the Escherichia coli K1 template had a characteristic peak at Cy5 channel Tm57.5, which was consistent with the expected pathogen.
[0132] Figure 5 The results showed that the detection results of herpes simplex virus type II template had a characteristic peak at Cy5 channel Tm63.4, which was consistent with the expected pathogen; the detection results of Neisseria meningitidis template had a characteristic peak at Cy5 channel Tm68.9, which was consistent with the expected pathogen.
[0133] Figure 6 The results showed that the varicella-zoster virus template had a characteristic peak at Cy5 channel Tm73.2, consistent with the expected pathogen; the double echovirus template had a characteristic peak at Cy5 channel Tm78.9, consistent with the expected pathogen. The control group had no characteristic peaks in either the ROX or Cy5 channels, consistent with negative expectations and no nonspecific issues.
[0134] In summary, the kit provided by the present invention can correctly detect various pathogen targets.
[0135] Example 4
[0136] The minimum detection limit and other properties of the kit provided in Example 2 above were studied.
[0137] For the 12 pathogens targeted by the kit of this invention, the minimum detection limit (LDL) was determined using simulated samples prepared with commercially available standard strains and a negative matrix. The concentration of each simulated sample was determined using digital PCR. After dilution with the negative matrix to varying concentrations, the kit of this invention was used for detection. The target nucleic acid concentration that consistently detected ≥95% of the samples was considered the LDL.
[0138] Minimum detection limit concentration of a single pathogen for 12 pathogens
[0139] pathogens Minimum detection limit (copy number / mL) Enterovirus 600 Haemophilus influenzae 500 human herpes virus-6 600 Streptococcus pneumoniae 500 Cytomegalovirus 600 Streptococcus agalactiae 600 Herpes simplex virus type 1 600 Escherichia coli K1 600 Herpes simplex virus type 2 600 Neisseria meningitidis 500 Varicella-zoster virus 800 Double echovirus 500
[0140] In order to detect whether there is cross-reaction with non-target pathogens, the kit of the present invention was used to detect the following pathogens: Escherichia coli (non-K1 strain), Haemophilus ducreyi, Haemophilus haemolyticus, Haemophilus parainfluenzae, Neisseria gonorrhoeae, Staphylococcus epidermidis, Bacillus subtilis, Mycobacterium tuberculosis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Treponema pallidum, Acinetobacter baumannii, influenza A H1N1, influenza B virus, parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, respiratory syncytial virus A, Mycoplasma pneumoniae, Candida glabrata, Bordetella pertussis, and human immunodeficiency virus. The results showed that these pathogen samples had no cross-reaction with the detection results of the kit.
[0141] Considering the possible interfering substances in the sample, the following concentrations of interfering substances were added to the target sample using the kit of the present invention: glucose (300 mg / dL), lactic acid (100 mg / dL), protein (albumin) (200 mg / dL), immunoglobulin (IgG) (10 mg / dL), mucin (200 mg / dL), bilirubin (10 μg / mL), human whole blood (10% v / v), hemoglobin (200 mg / mL), human genomic DNA (20 ng / μ L), aspirin (600 μg / mL), dexamethasone (100 μg / mL), blood lipids (triglycerides) (50 mg / dL), sodium chloride (9 g / L), bleach (0.1% v / v), EDTA (5 mg / mL), ethanol (7.5% v / v), levofloxacin (500 μg / mL), oseltamivir (1 μg / mL), amoxicillin (500 μg / mL), and white blood cells (50,000 cells / mL) were not found to have any effect on the detection of the kit of the present invention.
[0142] Example 5
[0143] The kit provided in Example 2 was subjected to clinical testing.
[0144] To validate the effectiveness of the kit of the present invention in detecting clinical samples, cerebrospinal fluid samples were obtained by lumbar puncture from patients with suspected central nervous system infection, such as headache, fever, neck stiffness, and altered mental status. The samples were obtained from Peking Union Medical College Hospital and Sir Run Run Shaw Hospital affiliated with Zhejiang University School of Medicine. Nucleic acid was extracted using the IndiSpin Pathogen Kit. The extracted nucleic acids were detected on a LightCycler 480II instrument using the kit and reaction protocol assembled as in Example 2, and pathogen identification was performed according to the interpretation criteria in Example 2.
[0145] In order to compare the accuracy of the kit of the present invention, the The Meningitis / Encephalitis Panel kit was used as a control.
[0146] 103 samples were tested and the results are as follows:
[0147]
[0148]
[0149]
[0150]
[0151]
[0152] The results show that the kit provided by the present invention has good consistency with the marketed products and can meet the clinical needs for the detection of various pathogens of central nervous system infection.
[0153] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.
Claims
1. A nucleic acid composition for multiplex PCR detection of pathogens infecting the central nervous system, characterized in that: It includes: Primers with fluorescent excitation groups and the first to twelfth primer probe sets corresponding to enterovirus, Haemophilus influenzae, human herpes virus type 6, Streptococcus pneumoniae, cytomegalovirus, Streptococcus agalactiae, herpes simplex virus type Ⅰ, Escherichia coli K1, herpes simplex virus type Ⅱ, Neisseria meningitidis, varicella zoster virus and double echovirus, Each primer probe set comprises a first forward primer, a second forward primer, a first reverse primer, a second reverse primer, and a probe sequence; the nucleotide sequences of the first forward primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 1-12, the nucleotide sequences of the second forward primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 13-24, the nucleotide sequences of the first reverse primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 25-36, the nucleotide sequences of the second reverse primers of the first to twelfth primer probe sets are shown in SEQ ID NOs: 37-48, and the probe sequences of the first to twelfth primer probe sets are shown in SEQ ID NOs: 49-60. The nucleotide sequence of the primer with a fluorescent excitation group is shown in SEQ ID NO: 61; The 3' end of each probe of the first to twelfth primer probe groups carries a fluorescent reporter group, and the absorption and emission wavelengths of the fluorescent excitation group are correspondingly shorter than the absorption and emission wavelengths of the fluorescent reporter group.
2. The nucleic acid composition for multiplex PCR detection of central nervous system infection pathogens according to claim 1, characterized in that: The fluorescent excitation group of the primer with the fluorescent excitation group is located at the 3' end of the primer; Preferably, the fluorescent excitation group of the primer with a fluorescent excitation group is located at any nucleotide position from the 1st to the 10th nucleotide from the 3' end of the primer; Preferably, the fluorescent excitation group of the primer with a fluorescent excitation group is located at any nucleotide position from the 2nd to the 5th nucleotide from the 3' end of the primer; Preferably, the fluorescent excitation group of the primer with a fluorescent excitation group is located at the fifth nucleotide position from the 3' end of the primer; Preferably, the fluorescent excitation group is selected from ATTO 425, ATTO 488, ATTO 532, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor 532 or 6-FAM.
3. The nucleic acid composition for multiplex PCR detection of central nervous system infection pathogens according to claim 1, characterized in that: The fluorescent reporter group is selected from ROX, Cy5, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, TexasRed, Cy5.5, ATTO Rho101, ATTO 590, ATTO 633, ATTO 647N, ATTO 700 or Quasar670; Preferably, the fluorescent reporter group is selected from ROX, Texas Red, ATTO 647N or Cy5; Preferably, each of the probes in the first to sixth primer probe sets is modified with ROX, and each of the probes in the seventh to twelfth primer probe sets is modified with Cy5.
4. A multiplex PCR detection product for central nervous system infection pathogens, characterized in that: It comprises the nucleic acid composition for multiplex PCR detection according to any one of claims 1 to 3, and the multiplex PCR detection product is a reagent, a kit, a chip or a detector.
5. The multiplex PCR detection product for central nervous system infection pathogens according to claim 4, characterized in that: The multiplex PCR detection product further comprises at least one of the following components: an amplification buffer, a nucleic acid polymerase, a reverse transcriptase, a positive quality control product, and a negative quality control product; Preferably, the nucleic acid polymerase is a DNA polymerase.
6. Use of the nucleic acid composition for multiplex PCR detection according to any one of claims 1 to 3 in preparing a multiplex PCR detection product for central nervous system infection pathogens, characterized in that: The multiplex PCR detection product is a reagent, a kit, a chip or a detector; Preferably, the sample tested is a human or animal respiratory tract sample, a human or animal cerebrospinal fluid sample, a human or animal reproductive tract sample, a human or animal body fluid, a human or animal feces, a dairy product or an environmental sample.
7. Use of the nucleic acid composition for multiplex PCR detection according to any one of claims 1 to 3 or the multiplex PCR detection product for central nervous system infection pathogens according to any one of claims 4 to 5 in multiplex PCR detection of central nervous system infection pathogens, characterized in that: When the sample to be tested is taken from a human or an animal, the multiplex PCR test is not for the purpose of diagnosing a disease. In the multiplex PCR test system, the final concentration of the first forward primer independently of each other in the first to twelfth primer probe groups is 0-800 nM, the final concentration of the second forward primer independently of each other in the first to twelfth primer probe groups is 0-800 nM, and the final concentrations of the first forward primer and the second forward primer corresponding to the pathogen are different and are 0; the final concentration of the first reverse primer independently of each other in the first to twelfth primer probe groups is 0-800 nM, the final concentration of the second reverse primer independently of each other in the first to twelfth primer probe groups is 0-400 nM, and the final concentration of the probe independently of each other in the first to twelfth primer probe groups is 100-2000 nM; The final concentration of the primer with a fluorescent excitation group is 100-2000 nM.
8. The use according to claim 7, characterized in that The multiplex PCR detection procedure includes: 40-55° C., 1-10 min; 95° C., 2 min; 94° C. 2-15 s, 58° C. 10 s-50 s, 35-45 cycles to obtain amplified products.
9. The use according to claim 8, characterized in that By performing real-time melting curve analysis on the amplified product, the conditions of the melting curve analysis include: collecting a fluorescence value once every 0.5-1°C, and the temperature range of collecting the fluorescence signal is 40°C to 90°C; Preferably, before the temperature-raising reaction, the steps further include: 95° C. for 2 min; and 40° C. for 90 s.
10. A multiplex PCR detection method for central nervous system infection pathogens, characterized in that: The nucleic acid composition for multiplex PCR detection according to any one of claims 1 to 3 is added to the reaction system. After the amplification reaction, the product is subjected to real-time melting curve analysis.
Citation Information
Patent Citations
Central nervous system infection pathogen detection kit and its application
CN113151610B