Application of cerebral hemorrhage related marker pclaf gene

Abstract

The application relates to the technical field of markers, in particular to application of a cerebral hemorrhage related marker pclaf gene. A new cerebral hemorrhage related marker pclaf is screened, the marker can be used for realizing diagnosis, monitoring, treatment reaction evaluation and prognosis judgment of cerebral hemorrhage, the marker can also be used as a target point of cerebral hemorrhage treatment chemical drugs and biological drugs, and is used for screening and development of cerebral hemorrhage treatment drugs. The application provides a new molecular diagnosis tool for cerebral hemorrhage, and has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of markers, in particular to application of a cerebral hemorrhage related marker pclaf gene. BACKGROUND

[0002] With the development of industrialization, the brain membrane related hemorrhage caused by traffic accidents and trauma has attracted more and more attention from the whole society due to its high incidence, high mortality, high disability rate and heavy social burden of survivors. However, the unclear hemorrhage repair mechanism seriously restricts the discovery of efficient and low-cost disease treatment programs.

[0003] The brain, as the central organ of life activities, is wrapped with multiple meningeal structures from the skull inward, namely the dura mater, arachnoid membrane and pia mater. The pia mater and the rich blood vessels located thereon form the choroid plexus, which produces cerebrospinal fluid. The meningeal structure not only provides a relatively independent and stable external environment for the brain, but also contains a large number of immune cells and fibroblasts in the meningeal space, which can provide immune protection and monitoring for the brain immune microenvironment. The brain weight accounts for only 2-3% of the body, but consumes more than 20% of the total energy of the body. The rich blood supply provides the material basis for the brain which has high oxygen consumption and almost no energy storage. When trauma and pathological changes cause the rupture of intracranial blood vessels in the brain, a large amount of blood will impact the meningeal space, causing brain blood supply and nerve function damage, which seriously threatens the life safety of the body. The hemorrhage in the meningeal space includes subarachnoid hemorrhage and epidural and intradural hemorrhage related to the dura mater. The blood clot in the meningeal space can be called meningeal hematoma. Subarachnoid hemorrhage is caused by the rupture of subdural and intracerebral blood vessels or intraventricular hemorrhage, resulting in the coagulation of a large amount of blood in the subarachnoid space. Subarachnoid hemorrhage is a brain vascular disease with complex mechanism and serious destructive consequences, which seriously threatens the perfusion and function of the brain and is one of the most common emergencies in neurology. In addition to causing severe pain and a large number of deaths in patients, the high disability rate and serious sequelae of survivors also lead to heavy family and social burden. The hemorrhage related to the dura mater is mainly caused by the tearing of the bridging vein between the cortex and the venous sinus or the rupture of the cortical blood vessels caused by cortical contusion and laceration, resulting in the accumulation of blood in the epidural space (epidural hemorrhage) and intradural subarachnoid space (intradural hemorrhage). In today's increasingly industrialized society, the hemorrhage related to the dura mater caused by trauma and traffic accidents has attracted more and more attention. The huge number of patients, the unclear hematoma absorption mechanism and the limited treatment options have led to a very high mortality and disability rate after hemorrhage, high treatment and survival costs for patients, and high randomness of the occurrence of the disease, which makes the hemorrhage in the meningeal space a public safety disease that has attracted much attention from the public.

[0004] Although previous studies have reported that red blood cells in subarachnoid hemorrhage (SAH) can be phagocytosed by innate immune cells or transported to the deep cervical lymph nodes, more recent studies have focused on clinical and pharmacological research aimed at improving patient survival, reducing recurrence rates, and reducing the incidence of sequelae. However, in vivo imaging studies of hematoma absorption are more rare, mainly because the hematoma itself poses a huge challenge. These hematoma often involve extensive trauma and require a long recovery period, making it difficult for traditional detection equipment, such as computed tomography (CT) and magnetic resonance imaging (MRI), to simultaneously achieve full-field, long-term, single-cell resolution monitoring.

[0005] Specifically, the difficulties in studying the repair mechanism of meningeal space hemorrhage are 1) lack of suitable animal models. Traditional animal models for studying subarachnoid hemorrhage use autologous blood injection into the brain ventricle and collagenase digestion of the blood vessel wall to induce hemorrhage. However, neither of these two existing animal models can fully reflect the disease situation. Autologous blood injection into the brain ventricle is difficult to simulate the accumulation of a large amount of blood in the subarachnoid space, and collagen will also digest other tissues in the brain. Animal models for studying dura-related hemorrhage are almost blank. 2) Lack of suitable observation instruments: Meningeal space hemorrhage can cause a large amount of blood to accumulate, with a trauma area close to centimeter level. Traditional optical microscopes are difficult to perform high-resolution long-term high-frequency imaging on such a large field of view. In order to study the mechanism of the repair process of meningeal space hemorrhage, the inventors and the team of the cooperative supervisor, Academician Dai Qionghai, have concentrated on research and development in the past. The latest third-generation RUSH imaging system RUSHconfocal (which can achieve 6 4.2mm 2 imaging area, single-cell resolution, 4 HZ imaging frequency) and two-photon synthetic aperture microscope 2pSAM, a cleverly designed back-light imaging strategy for in vivo imaging of a mouse model of spontaneous meningeal space hemorrhage caused by mechanical injury. This technology combines the world's most advanced large-field and two-photon in vivo imaging technology to develop a mouse model that more closely simulates meningeal space hemorrhage in real-life situations. It performs long-term in vivo imaging of the entire wound surface at single-cell resolution for three weeks to successfully solve the problem of difficulty in observing the entire repair process of meningeal space hemorrhage in vivo.

[0006] Existing experimental data show that after hemorrhage in the meningeal space, a tissue covering the entire hemorrhagic area appears, which maintains a 1-3 HZ tissue contraction movement for a long time, and through continuous changes in tissue shape and movement direction, the blood clot is pulled apart, and the huge blood clot is quickly broken down into small pieces with a diameter of about 10 microns, so that the huge blood clot is quickly degraded in the meningeal space. The inventors named this newly discovered tissue as Mesher (Meningeal space hemorrhage repairer), and the Chinese name is grid tissue.

[0007] In the prior art, for example, CN110066871A discloses an early diagnosis marker for hypertensive cerebral hemorrhage, which finds that there is a significant difference in the transcription level of the SETD6 gene in the blood of a hypertensive cerebral hemorrhage patient and that of a normal person; and for another example, CN114705848A discloses the application of CTRP3 and CTRP15 as biomarkers in the preparation of an early diagnosis product for spontaneous cerebral hemorrhage. Developing new biomarkers related to cerebral hemorrhage is still a technical problem to be solved in the medical field. SUMMARY

[0008] To solve the above technical problems, the present application carries out single-cell sequencing on a mechanically injured mouse cerebral hemorrhage model, and makes a Pclaf-tdTomato transgenic mouse, which is subjected to mechanical injury and hemorrhage model making and in vivo animal imaging verification. It is found that the PCNA Clamp Associated Factor (Pclaf) gene and its positive cells are closely related to the absorption and repair process of cerebral hemorrhage hematoma, that is, after cerebral hemorrhage, the expression amount of the pclaf gene and the number of positive cells significantly increase, and after the hematoma absorption is completed, the pclaf positive cells disappear. In the samples taken from the human subdural hemorrhage operation, the time distribution curve of the number of pcalf positive cells is consistent with that in mice, that is, the number of cells in normal meningeal tissue is extremely low, the number of positive cells reaches a peak after fourteen days of hemorrhage, gradually decreases after thirty days, and the level of positive cells approaches the normal meningeal pcalf positive cell level after sixty days.

[0009] Based on this, the pclaf gene or its positive cells can be used as markers for the diagnosis, monitoring, treatment response evaluation and prognosis of cerebral hemorrhage, and can also be used as a target for cerebral hemorrhage treatment chemical drugs and biological drugs. Therefore, the following technical solutions are proposed.

[0010] In a first aspect, the present application provides the use of a reagent for detecting the pclaf gene or its positive cells in the preparation of a product; the product is used for diagnosing cerebral hemorrhage.

[0011] In a second aspect, the present application provides use of a reagent for detecting the pclaf gene or positive cells thereof in the preparation of a product for monitoring cerebral hemorrhage.

[0012] In a third aspect, the present application provides use of a reagent for detecting the pclaf gene or positive cells thereof in the preparation of a product for evaluating therapeutic response of a drug for treating cerebral hemorrhage.

[0013] In a fourth aspect, the present application provides use of a reagent for detecting the pclaf gene or positive cells thereof in the preparation of a product for prognosis of cerebral hemorrhage.

[0014] In some embodiments, the product comprises a chip, a test paper, a drug, a preparation, a reagent, a kit, or a high-throughput screening platform.

[0015] In some embodiments, the expression level of the pclaf gene or the number of positive cells of the pclaf gene increases with the amount of cerebral hemorrhage.

[0016] In some embodiments, the expression level of the pclaf gene or the number of positive cells of the pclaf gene increases in a cerebral hemorrhage organism compared to a healthy organism, and decreases to the level of a healthy organism as the hematoma is absorbed.

[0017] In some embodiments, the reagent is a reagent for detecting the pclaf gene or positive cells thereof in a subject or a sample from a subject.

[0018] In specific implementations, the reagent includes, but is not limited to, a reagent for detecting the expression level of the pclaf gene or the number of positive cells of the pclaf gene by RT-PCR, real-time quantitative PCR, immunoassay (e.g., ELISA, RIA, multiplex immunoassay, immunofluorescence assay, Western blot, or dot blot assay), flow cytometry, in situ hybridization, or chip technology.

[0019] In some embodiments, the sample is a blood sample.

[0020] In a fifth aspect, the present application provides use of the pclaf gene or positive cells thereof in the diagnosis, monitoring, therapeutic response evaluation, or prognosis of cerebral hemorrhage.

[0021] In some embodiments, the present application provides a method for diagnosing, monitoring, evaluating therapeutic response, or prognosis of cerebral hemorrhage, comprising detecting the expression level or activity of the pclaf gene or the pclaf protein in a subject or a sample from a subject.

[0022] In some embodiments, when the expression level or activity of the pclaf gene or pclaf protein in a subject or a sample from the subject is higher than the expression level or activity of the pclaf gene or pclaf protein in a healthy organism, it indicates that the subject has a brain hemorrhage or an increased risk of brain hemorrhage or a poor treatment response or a poor prognosis.

[0023] In some embodiments, when the expression level or activity of the pclaf gene or pclaf protein in a subject or a sample from the subject is equivalent to the expression level or activity of the pclaf gene or pclaf protein in a healthy organism, it indicates that the subject does not have a brain hemorrhage or has a lower risk of brain hemorrhage or a good treatment response or a good prognosis.

[0024] In a sixth aspect, the present application provides a modulator of the expression or activity of the pclaf gene or pclaf protein for use in the treatment of brain hemorrhage.

[0025] Since the pclaf gene or protein of the present application can be used as a target for brain hemorrhage treatment chemicals and biological drugs, the related modulators can be used as a target for the pclaf gene or protein to treat brain hemorrhage.

[0026] In a seventh aspect, the present application provides a modulator of the expression or activity of the pclaf gene or pclaf protein for use in the manufacture of a medicament for the treatment of brain hemorrhage.

[0027] In some embodiments, the modulator of the expression or activity of the pclaf gene or pclaf protein includes an inhibitor or an antagonist.

[0028] In specific implementations, the inhibitor and / or antagonist refers to any substance that can reduce the expression of the nucleic acid encoding pclaf, reduce the level of pclaf protein, or inhibit the activity of pclaf. For example, a substance that reduces the activity of pclaf protein, reduces the stability of pclaf gene or protein, down-regulates the expression of pclaf, reduces the effective action time of pclaf protein, or inhibits the transcription and translation of pclaf.

[0029] Preferably, the inhibitor or antagonist includes but is not limited to: nucleic acid inhibitors, protein inhibitors, proteolytic enzymes, protein binding molecules; and combinations thereof.

[0030] Among them, the nucleic acid inhibitor is selected from: an interfering molecule that targets pclaf or its transcript as a target sequence and can inhibit the expression or gene transcription of the pclaf gene, including: shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, or a construct that can express or form the shRNA, small interfering RNA, dsRNA, microRNA.

[0031] wherein the protein-binding molecule is selected from the group consisting of: a substance that specifically binds to the pclaf protein, such as an antibody or a ligand capable of inhibiting the activity of the pclaf protein; a competitor of the pclaf ligand binding site, including a pclaf receptor and a fragment thereof that binds to the ligand, a soluble truncated pclaf receptor, a soluble pclaf receptor fusion protein, such as a pclaf fusion protein comprising an Fc portion of an IgG immunoglobulin, a ligand fusion protein; a peptidomimetic; a peptide inhibitor; a small molecule compound; and combinations thereof.

[0032] In an eighth aspect, the present application provides a composition, a medicament, a preparation or a therapeutic kit, which comprises a modulator of the expression or activity of the pclaf gene or the pclaf protein.

[0033] In some embodiments, the composition, medicament, preparation or therapeutic kit further comprises other drugs for treating cerebral hemorrhage.

[0034] In some embodiments, the composition, medicament, preparation or therapeutic kit further comprises one or more pharmaceutically acceptable adjuvants, excipients, carriers and / or vehicles.

[0035] In a ninth aspect, the present application provides a kit for diagnosing, monitoring, evaluating the therapeutic response or prognosis of cerebral hemorrhage, which comprises a reagent for detecting the expression or activity of the pclaf gene or the pclaf protein.

[0036] In a tenth aspect, the present application provides a method for screening a candidate drug for treating cerebral hemorrhage, which comprises: treating a system expressing or comprising the pclaf gene or the pclaf protein with a substance to be screened, and detecting the expression level or activity of the pclaf gene or the pclaf protein in the system before and after the treatment.

[0037] Preferably, the expression level or activity of the pclaf gene or the pclaf protein in the system after the treatment is lower than that in the system before the treatment, indicating that the substance to be screened is a candidate drug for treating cerebral hemorrhage.

[0038] Preferably, the system comprises (but is not limited to): a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0039] Preferably, the candidate drug comprises (but is not limited to): an interfering molecule, a nucleic acid inhibitor or a small molecule compound designed for the pclaf gene or its upstream or downstream genes.

[0040] Preferably, the pclaf gene-positive cells of the present application comprise fibroblasts, myofibroblasts and macrophages.

[0041] Compared with the prior art, the application has the beneficial effects that:

[0042] The application screens a new marker pclaf related to cerebral hemorrhage, and the marker can be used for diagnosis, monitoring, treatment reaction evaluation and prognosis judgment of cerebral hemorrhage, and can also be used as a target of chemical drugs and biological drugs for cerebral hemorrhage treatment, and is used for screening and development of drugs for cerebral hemorrhage treatment. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 is the screening result of single cell sequencing and immunofluorescence experiment; wherein, A is a single cell RNA sequencing workflow schematic diagram; B is a multi-sample T-SNE clustering diagram, which shows the cell types of the T-SNE clustering result; the control group (NT) contains 15 mice, 3895 cells; the model group (MSH) contains 12 mice, 4430 cells; C is the distribution of the Pclaf gene in the NT and MSH cell groups; D is the differential expression of the Pclaf gene in the fibroblasts of the MSH compared with the NT; E is the immunofluorescence staining verification of Pclaf and the distribution of Pclaf in the NT and MSH samples, DAPI (blue), Pclaf (green).

[0044] Figure 2 is the result of in vivo imaging; A is the distribution of the Pclaf-tdTomato mouse signal in the control group (Ctrl, NT) and the model group (MSH) samples at different time points under a large field high-resolution microscope; the scale: 500 μm; B is a fluorescence signal intensity statistical line chart, P<0.0001.

[0045] Figure 3 is the ROC analysis curve of the Pclaf expression amount.

[0046] Figure 4 is the verification result of the Pclaf distribution in the human brain subdural hematoma samples; A is a U-MAP clustering diagram showing the clustering of the normal healthy group HC (n=2), 14 dph (n=2), 30 dph (n=2) and 60 dph (n=2) groups; B is the distribution of Pclaf in all sample clusters (n=8); C is the proportion of Pclaf positive cells in each sample; D is the distribution of Pclaf (green) and DAPI (blue) in the 14 dph-P1 sample verified by immunofluorescence; HC represents the healthy control group, and dph represents the number of days after hemorrhage. DETAILED DESCRIPTION

[0047] For the purposes of the present application, the technical solutions and advantages will be clearer, the technical solutions in the present application will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application. In the examples provided in the present specification, the specific techniques or conditions are not specified, which are according to the techniques or conditions described in the literature in the art, or according to the product manual. The reagents or instruments used are not specified by the manufacturer, which are conventional products that can be purchased through regular channels.

[0048] Example 1 Screening of cerebral hemorrhage-related markers

[0049] This example uses a mouse cerebral hemorrhage model to screen cerebral hemorrhage-related markers, and the steps are as follows:

[0050] 1. Common B6 mice are implanted in the cranial window at 6-8 weeks, and their cerebral blood vessels are slightly damaged with a syringe to make them hemorrhage after cranial window implantation, simulating the process of hemorrhage after brain injury in clinic. When the amount of hemorrhage covers more than 30% of the cranial window area, it is determined to be successful. The mice are divided into groups: 15 mice in the control group (also known as the untreated group or the normal group or the NT group), and 12 mice in the model group (also known as the hematoma group or the MSH group).

[0051] 2. The successfully modeled mice are subjected to single-cell sequencing, and the genes highly expressed in the model group are screened by comparing the normal group and the model group. The candidate genes are verified by immunofluorescence.

[0052] 3. The verified candidate genes are used to make Pclaf-tdTomato transgenic mice to make them carry fluorescent labels. The method for making Pclaf-tdTomato transgenic mice is as follows:

[0053] Through CRISPR / Cas-mediated gene knock-in technology, (1) the stop codon TAG of the pclaf gene is replaced with a "3xEAAAK-tdTomato-P2A-CreERT2" expression cassette. (2) When constructing the donor vector, use BAC clone RP23-177B17 as the template to generate homologous arms by PCR technology. (3) To prepare genetically engineered mice, Cas9 protein, gRNA, and donor vector are injected into fertilized eggs. (4) The newborn pups will be preliminarily genotyped by PCR, and then confirmed by sequencing analysis.

[0054] The gRNA sequence is:

[0055] gRNA-A1 (SEQ ID No. 1):

[0056] TGGCTCATCCAATCTTAAAG - GGG

[0057] gRNA-A2 (SEQ ID No. 2):

[0058] GTATGATTGCCAAGCCAACT – TGG

[0059] 4. The transgenic mice were modeled according to the method in step 1. Two-photon and wide-field microscopy imaging was performed on them using the third-generation RUSH imaging system RUSHconfocal to observe the relationship between the hematoma absorption process and the candidate genes.

[0060] The screening results of single-cell sequencing and immunofluorescence experiments are as follows: Figure 1 As shown, the in vivo imaging results are as follows: Figure 2 As shown, by comparing the model group and the control group mice, it was found that no pclaf signal was detected in the samples of the control group mice in vivo imaging. However, in the model group, after hematoma hemorrhage into the meningeal space, pclaf-tdTomato positive cells and extracellular matrix increased significantly, reaching their maximum value at around 8 days as the hematoma absorption progressed. After the hematoma absorption was completed, the pclaf-tdTomato positive cells and extracellular matrix gradually disappeared, eventually approaching the initial value. This result indicates that pclaf is highly correlated with the hematoma absorption process. Furthermore, Figure 2 A shows that Pclaf-positive cells can directly engulf blood clots.

[0061] Example 2

[0062] This embodiment performs specificity-sensitivity (ROC) analysis on pclaf, a marker related to cerebral hemorrhage obtained in Example 1. Specifically, 8 control mice (34 immunofluorescence images) and 10 model mice (42 immunofluorescence images) were randomly selected for ROC analysis of pclaf gene expression levels. The ROC curve is shown below. Figure 3 As shown, the results indicate that the 95% confidence interval of the ROC curve is between 0.9694 and 1.000, P < 0.0001, and the AUC value is 0.9867. When the sensitivity is 100%, the specificity threshold is 79.41%; while when the specificity is 100%, the sensitivity threshold is 90.48%. This result demonstrates that Pclaf protein expression has very strong specificity in mouse samples with cerebral hemorrhage. In summary, the AUC value of the ROC curve is 0.9867, indicating that using Pclaf to diagnose cerebral hemorrhage has strong specificity and sensitivity.

[0063] Example 3

[0064] The embodiment adopts human samples to verify the brain hemorrhage related marker pclaf, and the steps are as follows: 2 cases of healthy human meningeal tissue (control group, HC) and 6 cases of subdural hemorrhage patients were obtained in Yijishan Hospital of Wannan Medical College. The specific time of hemorrhage is: 14 days (14 dph), 30 days (30 dph), 60 days (60 dph) patients each two cases. All experiments were carried out under the approval of the ethics committee of Yijishan Hospital (approval number: 2024-186). Through single cell sequencing of the samples, the expression of pclaf gene in different clinical samples was analyzed, and the time sequence change of different samples was analyzed.

[0065] The experimental results are shown in Figure 4 The results show that the average proportion of pclaf positive cells in the normal control group is 0.78%, and the average proportion of pclaf positive cells in the subdural hemorrhage patients is 16.35%. Further analysis, the time distribution curve of the number of pcalf positive cells is consistent with that in mice, that is, the number of pcalf positive cells in normal human meningeal tissue is very low, the number of pcalf positive cells reaches the peak after 14 days of hemorrhage, and gradually decreases after 30 days, and the level of pcalf positive cells after 60 days is close to the level of pcalf positive cells in normal human meningeal tissue. The above results show that the expression of Pclaf produces consistent time sequence changes with the occurrence, development and absorption of hematoma after brain hemorrhage, and Pclaf can be used as a marker for brain hemorrhage.

[0066] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. Use of an agent that detects the pclaf gene or positive cells thereof in the manufacture of a product; said product for monitoring brain hemorrhage; wherein, Compared with healthy organisms, the expression amount of the pclaf gene or the number of pclaf gene positive cells in the meningeal tissue of the organism with cerebral hemorrhage is increased; as the hematoma is absorbed, the expression amount of the pclaf gene or the number of pclaf gene positive cells is reduced to the level in the meningeal tissue of the healthy organism.

2. Use according to claim 1, characterized in that, The products include: chips, test papers, reagents, kits or high-throughput screening platforms.

Images