Ciliate-specific primers, ciliate-specific long primers suitable for amplicon sequencing technology, kits and applications thereof

Abstract

The application provides ciliate-specific primers, ciliate-specific long primers and kits suitable for amplicon sequencing technology and applications, and specifically belongs to the field of molecular biology detection and high-throughput gene sequencing technology.The ciliate-specific primers include a forward primer CS322F and a reverse primer CS819R;the ciliate-specific long primers suitable for amplicon sequencing include a forward long primer LCS322F and a reverse long primer LCS819R.The ciliate-specific primers have broad-spectrum generality for ciliophora, are suitable for a short read length high-throughput sequencing method, and can be used for comprehensively analyzing the diversity and ecological functions of a ciliate community.The application can realize accurate detection and efficient analysis of the ciliate community, and provides technical support for environmental monitoring, germplasm resource development and ecological assessment.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology detection and high-throughput gene sequencing technology, and specifically relates to ciliate-specific primers, ciliate-specific long primers suitable for amplicon sequencing technology, a kit and application. BACKGROUND

[0002] As an important group of eukaryotic microorganisms, ciliates are widely distributed in water, soil and the inside and outside of animals, and are the key drivers of material cycling and energy flow in ecological systems. The study of their diversity is of great significance for assessing environmental health, guiding ecological restoration and developing germplasm resources. However, the traditional identification methods of ciliates (such as morphological observation, silver staining, Sanger sequencing, etc.) have problems such as low efficiency, long time consumption, high cost, etc., which are difficult to meet the high-throughput analysis needs of complex environmental samples.

[0003] Morphological identification method: based on microscope observation and silver staining technology, relying on the morphological characteristics of ciliates (such as living morphology, ciliary pattern, nuclear structure, etc.) for classification. Although this method is intuitive, it is low in efficiency, time-consuming, high in threshold, and cannot distinguish closely related species with similar morphology, so its accuracy is limited;

[0004] Sanger sequencing technology: by PCR amplification of specific genes (such as 18S rRNA gene, cox1) and single template sequencing, for species identification and phylogenetic analysis. Although it has high accuracy, it has low throughput and high cost, which is difficult to meet the large-scale detection needs of complex environmental samples. For example, the existing ciliate-specific primers (amplification length > 800bp) need to rely on high-cost first-generation or third-generation sequencing technologies (such as Sanger sequencing, nanopore sequencing, PacBio sequencing technology, etc.), which cannot adapt to high-throughput short sequence sequencing platforms such as Illumina and Huada short read sequencing mode. The cost of long fragment sequencing is too high, and large-scale detection is difficult to afford;

[0005] Universal primer amplicon sequencing and analysis: using eukaryotic universal primers (such as V4 region or V8-V9 region primers of 18S rRNA gene) to amplify 18S rRNA gene fragments, combined with high-throughput sequencing to analyze ciliate diversity. However, non-specific amplification of universal primers leads to a large amount of sequencing data wasted on non-target organisms (such as algae, fungi, other protist phyla, etc.), significantly reducing the specificity, potency ratio, sensitivity and accuracy of ciliate detection;

[0006] The existing ciliate-specific amplification primers are only for specific functional groups (such as the subclass of Colpodellida and the subclass of Oligohymenida) or disease-related species (such as the species of Ichthyophthirius multifiliis, Cryptocaryon irritans and the genus of Phoridium), which lack broad-spectrum universality and are difficult to comprehensively analyze the diversity and ecological function of ciliate communities in environmental samples.

[0007] With the popularization of next-generation sequencing (NGS) technology, amplicon sequencing and analysis technology has gradually become the mainstream method for studying microbial communities. However, there is an urgent need to develop a primer pair that is specific to a wide range of ciliates and suitable for short-read high-throughput sequencing to achieve accurate detection and efficient analysis of ciliate communities, providing technical support for environmental monitoring, germplasm resource development, and ecological assessment. SUMMARY

[0008] The purpose of the present application is to provide ciliate-specific primers, ciliate-specific long primers suitable for amplicon sequencing technology, kits and applications. The ciliate-specific primers of the present application have broad-spectrum versatility for ciliophora, are suitable for short-read high-throughput sequencing methods, and can be used to comprehensively analyze the diversity and ecological function of ciliate communities. It can achieve accurate detection and efficient analysis of ciliate communities, providing technical support for environmental monitoring, germplasm resource development, and ecological assessment.

[0009] The present application provides ciliate-specific primers, including forward primer CS322F and reverse primer CS819R; the nucleotide sequence of the forward primer CS322F is shown in SEQ ID NO. 1, and the nucleotide sequence of the reverse primer CS819R is shown in SEQ ID NO. 2.

[0010] The present application also provides ciliate-specific long primers suitable for amplicon sequencing, including forward long primer LCS322F and reverse long primer LCS819R; the forward long primer LCS322F includes a first adapter sequence and the forward primer CS322F in the above technical solution in order from 5' end to 3' end, the nucleotide sequence of the forward long primer LCS322F is shown in SEQ ID NO. 3, and the reverse long primer LCS819R includes a second adapter sequence and the reverse primer CS819R in the above technical solution in order from 5' end to 3' end, the nucleotide sequence of the reverse long primer LCS819R is shown in SEQ ID NO. 4.

[0011] Preferably, the first adapter sequence includes a P5 sequence, a tag sequence, and a first sequencing reaction primer sequence in order from 5' end to 3' end, and the second adapter sequence includes a P7 sequence, a tag sequence, and a second sequencing reaction primer sequence in order from 5' end to 3' end.

[0012] Preferably, the nucleotide sequence of the P5 sequence is shown as SEQ ID NO. 5; the nucleotide sequence of the P7 sequence is shown as SEQ ID NO. 6; the tag sequence is a sequence formed by 8 bases in different permutations and combinations; the nucleotide sequence of the first sequencing reaction primer sequence is shown as SEQ ID NO. 7; and the nucleotide sequence of the second sequencing reaction primer sequence is shown as SEQ ID NO. 8.

[0013] Preferably, the nucleotide sequence of the forward long primer LCS322F is shown as SEQ ID NO. 9 or SEQ ID NO. 10, and the nucleotide sequence of the reverse long primer LCS819R is shown as SEQ ID NO. 11 or SEQ ID NO. 12.

[0014] The present application also provides a kit for ciliate-specific amplification or resolving ciliate diversity, which comprises the ciliate-specific primer of the technical solution or the ciliate-specific long primer suitable for amplicon sequencing of the technical solution and a reaction solution.

[0015] The present application also provides the use of the ciliate-specific primer of the technical solution or the ciliate-specific long primer suitable for amplicon sequencing of the technical solution or the kit of the technical solution in the functions of any one of ①-④:

[0016] ① accurately detecting and efficiently resolving the community structure and biological diversity of ciliate groups;

[0017] ② performing short-read high-throughput amplicon sequencing;

[0018] ③ reducing sequencing costs;

[0019] ④ specifically amplifying a wide range of ciliate groups.

[0020] The application provides ciliate-specific primers. The ciliate-specific primers of the application are primers for specifically amplifying the V2-V4 variable region of the 18S rRNA gene of ciliates. The ciliate-specific primers described in the application have high specificity, and the primers only amplify the target sequence of ciliates in artificial and natural communities, excluding the interference of non-target organisms such as fungi and other protozoan groups, and ensuring efficient use of sequencing data. The ciliate-specific primers of the application have broad spectrum universality of ciliophora, are suitable for short read high-throughput sequencing methods, and can be used for comprehensive analysis of the diversity and ecological function of ciliate communities. The ciliate-specific primers can realize accurate detection and efficient analysis of ciliate communities, and provide technical support for environmental monitoring, germplasm resource development and ecological assessment. The test results show that the ciliate-specific primers CS322F and CS819R have high specificity for ciliates in the test, and the amplification specificity of the primers for ciliates is greatly improved compared with that of the eukaryote universal primers (82F / EUKB).

[0021] On this basis, the ciliate-specific long primer (specific amplicon long primer) suitable for amplicon sequencing is designed by adding a high-throughput sequencing adapter sequence. The ciliate-specific long primer suitable for amplicon sequencing has high specificity and high sensitivity, can accurately amplify all target ciliate sequences in an artificial community, and comprehensively analyze the ciliate biodiversity in an artificial community and an environmental sample. The ciliate-specific long primer suitable for amplicon sequencing can be directly applied to short-read high-throughput amplicon sequencing and analysis technology, rapidly and efficiently analyzing the community structure and biodiversity of the entire ciliate group in an environmental sample and inferring ecological functions. Moreover, the application of the ciliate-specific long primer suitable for amplicon sequencing can greatly reduce the library construction and sequencing cost. The test results show that, through the verification of the artificial community mixed by 13 kinds of ciliates and 4 other eukaryotic microbial DNAs and the community in the environmental sample, it is confirmed that the primer specifically amplifies only the target ciliate sequences in the artificial community, and can completely cover all target ciliate sequences, and the specificity is greatly improved compared with the universal long primer (L1889F / L1889R) and the sensitivity is not reduced; at the same time, through the real repeated environmental sample, it is further confirmed that compared with the universal long primer (L18V4F / L18V4R), the primer has high specificity and high sensitivity (the proportion of ciliate characteristic sequences is greatly improved); from the amplicon analysis results of the artificial community and the environmental sample, it is known that the proportion of ciliate characteristic sequences amplified by the specific long primer is greatly improved compared with the proportion of eukaryotic universal primer (the proportion of ciliate characteristic sequences in the artificial community verification is 100%, while the proportion of ciliate characteristic sequences obtained by eukaryotic universal primer amplicon sequencing is 12.91%; the proportion of ciliate characteristic sequences in the environmental sample verification is 99.7%, while the proportion of ciliate characteristic sequences obtained by eukaryotic universal primer amplicon sequencing is 29.46%), which means that the sequencing amount using the universal primer needs to be increased by several times to obtain the same amount of target ciliate sequences. The present application reduces reagent consumption, operation time and sequencing data waste, significantly reduces the cost, and can more comprehensively analyze the ciliate diversity and ecological function in the environmental sample. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present application, and other embodiments can be obtained by those skilled in the art without creative labor based on these drawings.

[0023] Figure 1 The technical roadmap of the ciliate-specific primer suitable for amplicon sequencing technology and the application thereof provided by the present application;

[0024] Figure 2 A schematic diagram of the 18S rRNA gene variable region division (V1-V5, V7-V9 region) and amplicon long primer structure of ciliate 18S rRNA gene using Saccharomyces cerevisiae 18S rRNA gene variable region as reference provided by the present application;

[0025] Figure 3 The morphological photos of artificial community ciliate species provided by the present application; wherein, (A): Colpoda aspera; (B): Colpoda elliotti; (C): Colpoda steinii; (D): Metanophrys cf. sinensis; (E): Glaucoma trihymene; (F): Euplotes rariseta; (G): Tetrahymena pyriformis; (H): Paramecium biaurelia; (I): Uronema apomarinum; (J): Apourosomoida sp.; (K): Chaenea vorax; (L): Euplotes vannus; (M): Blepharisma sinuosum;

[0026] Figure 4Gel electrophoresis result diagram of ciliate specific primers (CS322F & CS819R) and eukaryote universal primers (82F & EUKB) provided by the present application; wherein, a) electrophoresis diagram of target fragments of different species amplified by PCR using ciliate specific primers (CS322F / CS819R); b) electrophoresis diagram of 18S rRNA genes of different species amplified by PCR using eukaryote universal primers (82F / EUKB); M: DNA relative molecular standard (DL2000); 1: Colpoda steinii; 2: Colpoda elliotti; 3: Colpoda aspera; 4: Blepharisma sinuosum; 5: Chaenea vorax; 6: Paramecium biaurelia; 7: Tetrahymena pyriformis; 8: Uronema apomarinum; 9: Glauconema trihymene; 10: Metanophrys cf. sinensis; 11: Euplotes rariseta; 12: Euplotes vannus; 13: Apourosomoida sp.; 14: Rhodotorula mucilaginosa; 15: Saccharomyces cerevisiae; 16: Schizosaccharomyces pombe; 17: Poterioochromonas sp.

[0027] Figure 5 The relative abundance classification column chart of artificial community species provided by the present application is shown in the following figure:

[0028] Figure 6 The relative abundance classification column chart of each group in the soil environment sample provided by the present application is shown in the following figure. DETAILED DESCRIPTION

[0029] The application provides ciliate-specific primers, including forward primer CS322F and reverse primer CS819R; the nucleotide sequence of the forward primer CS322F is shown in SEQ ID NO. 1: 5' GATGGTAGTGTATTGGAC 3', and the nucleotide sequence of the reverse primer CS819R is shown in SEQ ID NO. 2: 5' CTATTCCATTATTCCATGCT 3'. Based on the complete sequence analysis of 18S rRNA genes of 102 ciliates (including all 13 classes of Ciliophora) and 19 other protozoan groups, the application determines that the V2-V4 region is a high-variation region, and screens out a primer pair that is conserved in Ciliophora and takes the V2-V4 region as an amplification target. The ciliate-specific primers of the application are primers for target amplification of a high-variation region, can optimize species detection, and are suitable for amplicon sequencing. The V2-V4 variable region has high variability in the 18S rRNA gene of ciliates, can effectively distinguish closely related species, and significantly improves the accuracy of species identification; the V2-V4 region (450-550 bp) is suitable for short-read sequencing adapters, short-read amplicon sequencing can be performed, can be used for constructing an amplicon library, is suitable for various brands of high-throughput sequencing platforms at home and abroad, and can be directly subjected to high-throughput sequencing.

[0030] The application further provides ciliate-specific long primers suitable for amplicon sequencing, including a forward long primer LCS322F and a reverse long primer LCS819R; the forward long primer LCS322F comprises a first adaptor sequence and the forward primer CS322F in the technical solution in the order from the 5' end to the 3' end, and the nucleotide sequence of the forward long primer LCS322F is shown as SEQ ID NO. 3: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGT CAGATGTGTATAAGAGACAGGATGGTAGTGTATTGGAC, in the sequence of the application, the letter N represents any one of A, T, C and G, the reverse long primer LCS819R comprises a second adaptor sequence and the reverse primer CS819R in the technical solution in the order from the 5' end to the 3' end, and the nucleotide sequence of the reverse long primer LCS819R is shown as SEQ ID NO. 4: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAG ATGTGTATAAGAGACAGCTATTCCATTATTCCATGCT. The application is verified by artificial community verification experiments, and it is proved that the ciliate-specific long primers suitable for amplicon sequencing have high sensitivity, high specificity and high amplification efficiency; can be directly applied to short read high-throughput amplicon sequencing and analysis technology, and can quickly and efficiently analyze the community structure, biological diversity and ecological function of the entire ciliate group in the environmental sample. Moreover, the application of the ciliate-specific long primers suitable for amplicon sequencing can greatly reduce the cost of library construction and sequencing.

[0031] In specific embodiments, the first adaptor sequence comprises, in order from 5' end to 3' end, a P5 sequence, a tag sequence, and a first sequencing reaction primer sequence, and the second adaptor sequence comprises, in order from 5' end to 3' end, a P7 sequence, a tag sequence, and a second sequencing reaction primer sequence. In specific embodiments, the nucleotide sequence of the P5 sequence is set forth in SEQ ID NO. 5: AATGATACGGCGACCACCGAGATCTACAC; the nucleotide sequence of the P7 sequence is set forth in SEQ ID NO. 6: CAAGCAGAAGACGGCATACGAGAT; the sample barcode tag sequence (Index, or Barcode) refers to a short nucleotide sequence of fixed length (8 bp is used in the present application) that is artificially synthesized and added to both ends of a sequencing library (DNA or cDNA fragment) for distinguishing different samples; the nucleotide sequence of the first sequencing reaction primer sequence is set forth in SEQ ID NO. 7: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG; and the nucleotide sequence of the second sequencing reaction primer sequence is set forth in SEQ ID NO. 8: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG. In specific embodiments, the nucleotide sequence of the forward long primer LCS322F is set forth in SEQ ID NO. 9 (AATGATACGGCGACCACCGAGATCTACACAGCACCTCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGATGGTAGTGTATTGGAC) or SEQ ID NO. 10 (AATGATACGGCGACCACCGAGATCTACACCCGAAGTATCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGATGGTAGTGTATTGGAC), and the nucleotide sequence of the reverse long primer LCS819R is set forth in SEQ ID NO. 11 (CAAGCAGAAGACGGCATACGAGATACGCTCGAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTATTCCATTATTCCATGCT) or SEQ ID NO. 12 (CAAGCAGAAGACGGCATACGAGATAAGGTGCGGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTATTCCATTATTCCATGCT).

[0032] The ciliate-specific long primer suitable for amplicon sequencing provided by the application can be used for construction of an amplicon sequencing library, and the method for construction comprises using the ciliate-specific long primer suitable for amplicon sequencing provided in the technical solution to perform amplicon sequencing library construction by one-step amplification. In specific embodiments, the reaction system of the one-step amplification comprises 2xKeyPo MasterMix 12.5 μl, 10 μM forward long primer LCS322F and 10 μM reverse long primer LCS819R each 1 μl, DNA 2 μl, and ultrapure water 8.5 μl per 25 μl. In specific embodiments, the reaction procedure of the one-step amplification comprises 98℃ for 30 s; 98℃ for 30 s, 46℃ for 5 s, 72℃ for 5 s, 32 cycles; and 72℃ for 1 min. The one-step PCR amplification library construction is adopted in the application, and the primer provided in the application has the advantages of high-specificity amplification, so that the cost can be reduced in a double effect. Specifically, compared with the traditional two-step amplification method (first amplifying the target fragment, purifying, then connecting the adapter and the tag to realize library construction), the one-step PCR amplification method can realize rapid and low-cost (the price is reduced by several times compared with the sequencing company) amplicon library construction by integrating the primer adapter and the amplification step; compared with the eukaryote universal amplicon primer, the primer provided in the application excludes most non-target biological interference, avoids wasting sequencing data on non-ciliate groups, can significantly reduce the library construction and sequencing cost while ensuring the amount of target sequence acquisition.

[0033] The application further provides a kit for ciliate-specific amplification or resolving ciliate diversity, which comprises the ciliate-specific primer provided in the technical solution or the ciliate-specific long primer suitable for amplicon sequencing provided in the technical solution and a reaction solution. In specific embodiments, the reaction solution comprises 2xKeyPo MasterMix.

[0034] The application further provides application of the ciliate-specific primer provided in the technical solution or the ciliate-specific long primer suitable for amplicon sequencing provided in the technical solution or the kit provided in the technical solution in the roles of any one of ① to ④:

[0035] ① accurately detecting and efficiently resolving the community structure and biological diversity of ciliate groups;

[0036] ② performing short-read high-throughput amplicon sequencing;

[0037] ③ reducing sequencing cost;

[0038] ④ specifically amplifying a wide range of ciliate groups.

[0039] The ciliate-specific primer provided by the present application can specifically amplify the variable regions V2-V4 of the ciliate gene sequence, is suitable for short-read high-throughput amplicon sequencing and analysis technology, and can quickly and efficiently analyze the community structure and biodiversity of the entire ciliate group in the environmental sample and deduce the ecological function, such as biodiversity investigation. The ciliate-specific primer has high specificity, and can solve the problems of serious sequencing throughput waste, low proportion of target group sequence and incomplete community diversity analysis caused by the use of non-specific primer; at the same time, the primer provided by the present application can be used for amplicon sequencing of a wide range of ciliate groups, realize more accurate detection and more efficient analysis of the ciliate community, and provide technical support for environmental monitoring, germplasm resource development and ecological assessment.

[0040] In order to further illustrate the present application, the ciliate-specific primer, the ciliate-specific long primer suitable for amplicon sequencing technology and the kit and application provided by the present application are described in detail in combination with Example 1 (verification of specificity of ciliate amplicon long primer based on artificial community) and Example 2 (verification of specificity of ciliate amplicon long primer based on soil community), but they cannot be understood as limiting the protection scope of the present application.

[0041] Example 1

[0042] 1. Experimental materials

[0043] 1.1 Experimental supplies:

[0044] Table 1 Main reagents and instruments

[0045]

[0046] 1.2 Experimental samples:

[0047] From the soil sample, the seawater sample and the germplasm resource library of the Evolutionary Genomics Laboratory of China Ocean University, a total of 17 species (including 13 species of ciliates and 4 species of non-ciliate eukaryotes) for constructing artificial communities were isolated and identified (see Table 2 for details).

[0048] Table 2 Each species for constructing artificial community and related information thereof

[0049]

[0050]

[0051] 2. Experimental methods

[0052] 2.1 Primer design and synthesis: Based on the 18S rRNA gene sequences downloaded from NCBI nucleotide database, covering all 13 classes under the subclass Ciliophora and 19 other common non-ciliate protozoan animals. The present application designed a new primer combination of specific ciliate forward primer CS322F and reverse primer CS819R. The present application used MEGA v11.0.13 to perform multiple sequence alignment and screen conserved regions. The design strategy is as follows: (1) Forward primer CS322F targets the hypervariable region V2; (2) Reverse primer CS819R targets the conserved region V4, with an amplified fragment length of 450-550 bp (V2-V4 region), suitable for amplicon sequencing. Further, the primer specificity (only matching ciliate sequences) was verified by Primer-BLAST v2.5.0, and the primer dimer (ΔG <-5 kcal / mol), hairpin structure and Tm value (forward 46°C, reverse 51°C) were evaluated by Oligo v7.56. At the same time, by adding Illumina high-throughput sequencing adapters, the present application newly designed specific amplicon long primer sets (forward primer LCS322F and reverse primer LCS819R) and control primer eukaryotic V8-V9 region amplicon long primer (forward primer L1889F and reverse primer L1889R).

[0053] 2.2 Artificial community species collection, identification and DNA extraction: Single cells were separated by mouth pipette (0.5 mm diameter capillary glass tube stretched to 50-100 pm diameter), washed with double distilled water gradient and inoculated into 96-well plates for culture. After 2 days of culture, PCR amplification was performed with 4 pl of insect fluid and 4 pl of lysis liquid supernatant as DNA template, and a 25 pl PCR system was constructed: 2 pl of DNA, 2x KeyPo MasterMix 12.5 pl, primers 82F and EUKB (82F: GAAACTGCGAATGGCTC, SEQ ID NO. 13; EUKB: TGATCCTTCTGCAGGTTCACCTAC, SEQ ID NO. 14, see Table 3 for details), each 1 pl, 8.5 pl ultrapure water, PCR program was set as: 98°C pre-denaturation for 30 s, gradient cycle (98°C for 30 s, 69-51°C (AT = -1°C) for 5 s, 72°C for 5 s; 18 cycles), regular cycle (98°C for 30 s, 51°C for 5 s, 72°C for 5 s; 18 cycles), 72°C final extension for 1 min. After Sanger sequencing, the products were compared by BLAST (similarity > 99% was determined as the same species). Morphological observation used Nikon Eclipse Ni-u microscope with DS-RI2 camera for live shooting. Sample enrichment was processed according to size difference: <50 pm organisms were centrifuged (14°C, 5 min) at 2500 rpm combined with CytoFLEX SRT flow sorting; >50 pm organisms were enriched by single cell separation after expansion DNA extraction used MasterPure TM kit, and after detecting the concentration by Qubit 3.0, it was stored at -20°C for long-term preservation.

[0054] 2.3 Specific primer evaluation: The specificity of the CS322F and CS819R primers for ciliates was confirmed by bioinformatics methods, and 13 species of ciliates and 4 species of non-ciliate eukaryotes were collected. For each species, specific primers were used for PCR amplification of the target region, and the results were evaluated. The evaluation effect was verified by PCR, and the reaction system was 25 pl: 12.5 pl 2x KeyPo MasterMix, 1 pl of primers CS322F and CS819R (10 pM) each, 2 pl of DNA, 8.5 pl of ultrapure water. The PCR program was set as: 98°C pre-denaturation for 30 s, (98°C for 30 s, 46°C for 5 s, 72°C for 5 s, 32 cycles), 72°C final extension for 1 min. Electrophoresis verification used 1.5% agarose gel (Biowest ), running at 220V for 20 min, stained with YeaRed nucleic acid dye (Cat: 10202ES76). The results were determined by comparing the DL2000Plus Marker to determine that the target band was within the range of 450-550 bp.

[0055] 2.4 Amplicon long primer library construction and sequencing: The DNA of artificial community species was mixed equally, and the one-step amplification method was used for amplicon library construction. The reaction system and PCR program of specific amplicon long primer (using primer combination: LCS322F_1F (SEQ ID NO. 9) + LCS322F_1R (SEQ ID NO. 11) and LCS322F_2F (SEQ ID NO. 10) + LCS322F_2R (SEQ ID NO. 12), see Table 5 for details) were consistent with the steps of verification by PCR in the "Specific primer evaluation" section; the reaction system and PCR program of eukaryotic universal long primer (using primer combination: L1889F_1F (SEQ ID NO. 15) + L1889R_1R (SEQ ID NO. 17) and L1889F_2F (SEQ ID NO. 16) + L1889R_2R (SEQ ID NO. 18), see Table 5 for details) were consistent with the steps in the "Artificial community species collection, identification and DNA extraction" section. The library was sent to Beijing Nuowozhuyuan Technology Co., Ltd. for PE300 sequencing using Huada DNBSEQ-G99 instrument.

[0056] 2.5 Specific amplicon long primer evaluation: The data obtained were analyzed for community composition based on amplification for evaluation. Amplicon analysis was based on QIIME2 v2023.7. Raw reads were denoised and assembled using qiime dada2, and chimeric filtering was performed by qiime vsearch uchime-denovo. Classification bar charts were plotted using ggplot2.

[0057] 3. Results

[0058] 3.1 Primer design and synthesis results: In the present application, based on the ciliate-specific forward primer CS322F, a reverse short primer CS819R located in the conserved region of the V4 region was designed (Table 3), and the target gene amplified by this pair of primers spanned the V2-V4 region (see Table 3 for details). Figure 2 The specific amplicon long primer set (forward LCS322F and reverse LCS819R) for one-step PCR amplicon library construction was developed (Table 4).

[0059] Table 3 Ciliate-specific primer sequences and eukaryotic universal primer sequences

[0060]

[0061]

[0062] Table 4 Ciliate-specific amplicon long primer and internal structure sequence

[0063]

[0064] Note: The bold part in the forward primer is P5 sequence, the bold part in the reverse primer is P7 sequence, the wavy "NNNNNNNN" part is sample barcode tag sequence(index), the italic part is sequencing primer sequence, and the single underlined part is primer of the target genomic region.

[0065] Table 5 Specific sequences of ciliate-specific amplicon long primers and eukaryote universal long primer

[0066]

[0067] Note: S, Y and R are degenerate bases, R is A or G; Y is C or T; S is G or C.

[0068] 3.2 Artificial community species collection, identification and DNA extraction results: Thirteen species of ciliates were isolated and identified from soil samples, seawater samples and the germplasm resource library of the Evolutionary Genomics Laboratory of Ocean University of China by using primers 82F and EUKB and Sanger sequencing. Their taxonomic status is shown in Table 2, and morphological photos are shown in Figure 3 , with a scale bar of 10 μm.

[0069] 3.3 Specific primer evaluation: Primer-BLAST v2.5.0 results showed that the lengths of PCR products of ciliate-specific primers CS322F and CS819R in the collected 18S rRNA gene sequences of ciliates were distributed between 475 and 490 bp. According to the results of Oligo v7.56, the Tm value of forward primer CS322F was 48.98 °C, and the GC content was 44.44%; the Tm value of reverse primer CS819R was 50.26 °C, and the GC content was 35%. Neither the forward primer nor the reverse primer formed a hairpin structure, and the mismatch probability of the two was extremely low. The prediction results of the specific primers were as expected. At the same time, the PCR products corresponding to the artificial community species were subjected to gel electrophoresis, and the electrophoresis results are shown in Figure 4 . The results of primers 82F and EUKB amplification were used as a control, and the results showed that the brightness of the electrophoretic bands of eukaryote 18S rRNA gene sequence universal primers 82F and EUKB was obvious, and the sequence length was mostly 1,500-2,000 bp, which was consistent with the target fragment length of universal primers (b) in Figure 4 In the experimental group (CS322F and CS819R), the brightness of each band was relatively obvious, and the bands were distributed between 450 and 550 bp, and there were differences in band distribution among species.Figure 4 a) in FIG. 1. There is a single clear band for each of the species except for the ciliate (hole 5), and no band for the four non-ciliate species (holes 14-17), indicating that the ciliate-specific short primer CS322F & CS819R is highly specific (100%) for ciliates.

[0070] Specific amplicon long primer evaluation: The relative abundance of each species was analyzed, and a classification column chart was drawn (FIG. 2). Figure 5 The non-ciliate sequences were not analyzed using the specific amplicon long primer amplicons, thereby obtaining a high specificity (100%) and high sensitivity (100%) of the specific amplicon long primer for ciliates, which greatly improves the specificity and does not reduce the sensitivity compared to the eukaryote universal long primer. Among them, the analysis results show that the proportion of ciliate characteristic sequences obtained by amplification of the specific amplicon long primer is 100%, while the proportion of ciliate characteristic sequences obtained by amplification of the widely used eukaryote universal long primer is 12.91%, which means that the amount of sequencing needs to be increased by 7.75 times to obtain equal target ciliate sequences. Therefore, the high-specificity ciliate amplicon long primer designed in the present application has high variability across the V2-V4 variable region, and can distinguish more ciliate species. At the same time, based on the one-step amplification self-library construction method, compared with the conventional two-step amplification library construction, the present application reduces the reagent consumption and operation time, avoids the waste of sequencing data, greatly reduces the cost, and can comprehensively analyze the ciliate diversity in environmental samples.

[0071] Example 2

[0072] 1. Experimental materials

[0073] 1.1 Experimental supplies:

[0074] Table 6 Main reagents and instruments

[0075]

[0076] 1.2 Experimental samples:

[0077] Four repeated soil samples (sampling information is shown in Table 7) were collected within 5 meters from the Yushan campus of Ocean University of China.

[0078] Table 7 Soil sample sampling information

[0079]

[0080] 2. Experimental methods

[0081] 2.1 Primer design and synthesis: The experiment followed the newly designed specific amplicon long primer set (forward LCS322F and reverse LCS819R) of the present application, and additionally designed eukaryotic V4 region amplicon long primer (forward primer L18V4F and reverse primer L18V4R) for use as a control.

[0082] 2.2 Soil sample RNA extraction and cDNA reverse transcription: Four soil samples were subjected to RNA extraction using the Soil RNA Kit, and then the RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+cDNA wiper) kit. After the DNA concentration was detected by Qubit3.0, it was stored at -20℃ for a long time.

[0083] 2.3 Amplicon long primer library construction and sequencing: The cDNA obtained by reverse transcription was subjected to amplicon library construction by one-step amplification. The primer combination, reaction system and PCR program of the specific amplicon long primer were consistent with the steps in “2.4 Amplicon long primer library construction and sequencing” of Example 1; the reaction system and PCR program of the eukaryotic universal long primer (using primer combination: L18V4F_1F (SEQ ID NO. 19) + L18V4R_1R (SEQ ID NO. 21) and L18V4F_2F (SEQ ID NO. 20) + L18V4R_2R (SEQ ID NO. 22), see Table 5 for sequence information) were consistent with the steps in “2.2 Artificial community species collection, identification and DNA extraction” of Example 1. The library was sent to Beijing Nuoweziyuan Technology Co., Ltd. for PE300 sequencing using Huada DNBSEQ-G99 instrument.

[0084] 2.4 Evaluation of specific amplicon long primer: The data was subjected to amplicon-based community composition analysis for evaluation. Amplicon analysis was based on QIIME2 v2023.7. Raw reads were subjected to noise reduction and splicing using qiime dada2, and chimeric filtering was performed by qiime vsearch uchime-denovo. Classification bar charts were drawn using ggplot2.

[0085] 3. Results

[0086] ​3.1 Specificity of the amplicon long primer evaluation: In the above embodiment 1, the composition of the detected ciliate group does not reflect its true proportion in nature relative to other eukaryotic microorganisms. Since soil is a hotspot ecosystem rich in various eukaryotic microbial groups, therefore, natural soil samples can be used as a representative test scenario to measure the true proportion of ciliates. To this end, the relative abundance of ciliates in soil samples was analyzed, and a classification histogram was drawn Figure 6 ). The analysis results show that the proportion of ciliate characteristic sequences obtained by specific long primer amplification is 99.7%, and the proportion of ciliate characteristic sequences obtained by eukaryotic universal long primer amplification is 29.59%. Therefore, it is further confirmed by environmental samples that the ciliate amplicon long primer designed by the present application has high specificity and high sensitivity, and is expected to comprehensively analyze the diversity of ciliates in environmental samples.

[0087] Although the above two embodiments have been described in detail, they are only part of the embodiments of the present application, not all embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which are within the scope of protection of the present application.

Claims

1. A ciliate-specific primer characterized in that, comprises forward primer CS322F and reverse primer CS819R; the nucleotide sequence of the forward primer CS322F is shown as SEQ ID NO. 1, and the nucleotide sequence of the reverse primer CS819R is shown as SEQ ID NO.

2.

2. A ciliate-specific long primer suitable for amplicon sequencing, characterized in that, comprises forward long primer LCS322F and reverse long primer LCS819R; the forward long primer LCS322F comprises, in order from 5' end to 3' end, a first adaptor sequence and the forward primer CS322F in claim 1, and the nucleotide sequence of the forward long primer LCS322F is shown as SEQ ID NO. 3; the reverse long primer LCS819R comprises, in order from 5' end to 3' end, a second adaptor sequence and the reverse primer CS819R in claim 1, and the nucleotide sequence of the reverse long primer LCS819R is shown as SEQ ID NO.

4.

3. The ciliate-specific long primer suitable for amplicon sequencing according to claim 2, characterized in that, the first adaptor sequence comprises, in order from 5' end to 3' end, a P5 sequence, a tag sequence and a first sequencing primer sequence, and the second adaptor sequence comprises, in order from 5' end to 3' end, a P7 sequence, a tag sequence and a second sequencing primer sequence.

4. The ciliate-specific long primer suitable for amplicon sequencing according to claim 3, characterized in that, the nucleotide sequence of the P5 sequence is shown as SEQ ID NO. 5; the nucleotide sequence of the P7 sequence is shown as SEQ ID NO. 6; the tag sequence is a sequence formed by 8 bases in different permutations and combinations; the nucleotide sequence of the first sequencing primer sequence is shown as SEQ ID NO. 7; and the nucleotide sequence of the second sequencing primer sequence is shown as SEQ ID NO.

8.

5. The ciliate-specific long primer suitable for amplicon sequencing according to claim 2, wherein, the nucleotide sequence of the forward long primer LCS322F is shown as SEQ ID NO. 9 or SEQ ID NO. 10, and the nucleotide sequence of the reverse long primer LCS819R is shown as SEQ ID NO. 11 or SEQ ID NO.

12.

6. A kit for ciliates-specific amplification or resolving ciliate diversity, characterized in that, the kit comprises the ciliate-specific primer in claim 1 or the ciliate-specific long primer for amplicon sequencing in any one of claims 2-5 and a reaction solution.

7. Use of the ciliate-specific primer in claim 1 or the ciliate-specific long primer for amplicon sequencing in any one of claims 2-5 or the kit in claim 6 in the action as in any one of ①-③: ①accurately detecting and efficiently analyzing the community structure and biodiversity of ciliate groups; ②performing short-read high-throughput amplicon sequencing on ciliate groups; ③specifically amplifying a wide range of ciliate groups.

Images