Molecular marker, detection primer and PCR reagent closely linked with apple fruit firmness and application thereof

Abstract

The application belongs to the technical field of breeding, and particularly relates to a molecular marker closely linked with apple fruit hardness, detection primers, PCR reagents and application. The molecular marker is located at the 31719866-31719957 locus of the 3rd chromosome of an apple genome, and is an insertion / deletion of a 92 bp sequence; wherein the nucleotide sequence of the 92 bp sequence is shown as SEQ ID NO. 1. The identified molecular marker can accurately locate a fruit hardness related genetic locus, and provides double technical advantages for apple hybrid breeding: the application can predict mature fruit hardness phenotype characteristics at the seedling stage, and can reduce subsequent cultivation investment of invalid hybrid combinations, and application of the technical system will promote apple genetic improvement to be more accurate and efficient.

Description

Technical Field

[0001] This invention belongs to the field of breeding technology, specifically involving molecular markers, detection primers, and PCR reagents closely linked to apple fruit firmness, and their applications. Background Technology

[0002] apple( Malus ×domestica Apples are an important component of temperate fruit trees, and their fruit quality evaluation system mainly includes key indicators such as firmness, crispness index, and juiciness. It is noteworthy that fruit firmness, a physical characteristic, is not only closely related to post-harvest shelf life but also, by influencing sensory quality, has become a crucial screening indicator in modern apple breeding programs, playing a decisive role in the commercial promotion of varieties. As one of the five most critical traits in apple breeding, firmness is closely linked to the fruit's ripening period and the decline in firmness during post-harvest storage, and is a complex hereditary trait controlled by multiple genes. Studying its genetic regulatory mechanisms has significant theoretical guiding significance for assisting in the breeding of hybrid offspring.

[0003] During apple ripening, changes in fruit firmness are closely related to the ethylene synthesis pathway. Therefore, breeders often select genes associated with ethylene synthesis, such as... MdACS1 , MdACO1 and MdPG1 Ethylene is used as a molecular marker for selecting apple fruit firmness. However, ethylene controls many quality traits of the fruit. Using traditional molecular markers may affect the overall fruit characteristics.

[0004] Currently, molecular markers highly correlated with fruit firmness at ripening remain a key research focus. Breeders commonly use firmness-related molecular markers including... MdACS1 , MdPG1 and MdNAC5 The aforementioned traditional molecular markers have the limitation of explaining phenotypic variation. Summary of the Invention

[0005] To address the limitation of traditional molecular markers in interpreting phenotypic variations, this invention provides molecular markers, detection primers, PCR reagents, and applications closely linked to apple fruit firmness. To achieve the above objectives, this invention employs the following technical solution.

[0006] The high heterozygosity of the apple genome and the late fruiting of young trees result in low efficiency in traditional hybridization breeding. Furthermore, many quality traits of apples are easily regulated by various genetic mechanisms and environmental influences. Therefore, studying the genetic mechanisms of key fruit traits and developing molecular markers closely linked to fruit quality traits can help accelerate apple breeding and enhance the core competitiveness of the fruit.

[0007] This invention provides a molecular marker closely linked to apple fruit firmness, the molecular marker being located at positions 31719866 to 31719957 on chromosome 3 of the apple genome, and is a 92bp sequence insertion / deletion.

[0008] The nucleotide sequence of the 92bp sequence is shown in SEQ ID NO. 1:

[0009] CCAAACCACCGTTCGTCGAGATGAATTTTGATGGCTCTGTTAAAAATTCGACCTTGTATGCTTAATATTTATGTAATTAATGATGAATGTTC.

[0010] This invention targets the genetic regulation mechanism of apple fruit firmness, and innovatively develops a molecular marker closely linked to apple fruit firmness. This molecular marker breaks through the limitations of traditional phenotypic selection, allowing for genotypic prediction of texture traits in hybrid offspring during the seedling stage. It provides key technical support for establishing an efficient molecular marker-assisted breeding system and offers a highly efficient technical tool for apple quality breeding. The molecular marker provided by this invention overcomes the limitations of traditional ethylene molecular markers, exhibiting a high correlation with fruit firmness at maturity, thus addressing the problem of insufficient explanation of phenotypic variation in existing traditional molecular markers.

[0011] The molecular markers developed in this invention in ERF transcription factors will greatly improve the efficiency of texture improvement while maintaining overall quality, providing a new tool for precision-directed breeding of apples.

[0012] ERF is an important member of the AP2 / ERF transcription factor family, participating in the regulation of fruit growth and development and hormone signaling pathways (such as ethylene) during fruit ripening. ERF can regulate the expression of downstream genes by binding to the ethylene response element ERE, thereby regulating cell wall degrading enzymes; ERF transcription factors can significantly affect fruit softening by regulating the expression of cell wall degrading enzyme genes. ERF transcription factors contain many structural variations, including insertions, deletions, inversions, and duplications. Most structural variations do not affect plant phenotypic changes, especially in non-coding or non-functional regions. However, some structural variations may increase or inhibit gene expression, thereby altering plant phenotypic changes. For example, Zhang Caiying's team discovered that DEL1815 on chromosome 11 of soybean 'Nongdouzi 2' affects soybean 100-seed weight by influencing GmLANCL expression; DEL238 on chromosome 6 affects seed protein content and 100-seed weight by influencing Glyma.NDD2.06G308200 expression.

[0013] The present invention also provides detection primers for the molecular marker, including upstream primers and downstream primers.

[0014] The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2: 5'-TCCGCCCCCTCTGAGCCTAA-3'.

[0015] The nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3: 5'GAACCAACCATCTCCCAATCC-3'.

[0016] The (specific) detection primers and molecular markers provided by this invention exhibit strong correlation with apple firmness and high selection efficiency. This invention also provides a PCR reagent for identifying apple fruit firmness, wherein the PCR reagent includes the aforementioned detection primers.

[0017] The present invention also provides the application of the molecular marker, the detection primer, or the PCR reagent in the assisted breeding of high-firm apples.

[0018] The present invention also provides the application of the molecular marker, the detection primer, or the PCR reagent in identifying apple fruit firmness.

[0019] Preferably, the molecular marker, the detection primer, or the PCR reagent is used to detect single nucleotide polymorphisms or genotypes related to apple fruit firmness.

[0020] Preferably, the method for detecting single nucleotide polymorphisms or genotypes related to apple fruit firmness includes the following steps:

[0021] Genomic DNA is extracted from the sample to be tested.

[0022] Using the genomic DNA as template DNA, PCR amplification was performed using the detection primers.

[0023] The PCR amplification products were subjected to agarose gel electrophoresis, and the polymorphism and genotype of the molecular marker were determined based on the results of the agarose gel electrophoresis.

[0024] When the PCR amplification product shows a specific band at 504 bp, it is a homozygous insertion genotype; when the PCR amplification product shows specific bands at both 504 bp and 412 bp, it is a heterozygous genotype.

[0025] This invention also provides a method for identifying the firmness of apple hybrid offspring using the aforementioned detection primers, comprising the following steps:

[0026] Using the genomic DNA of the sample to be tested as template DNA, PCR amplification was performed using the detection primers.

[0027] The PCR amplification products were subjected to agarose gel electrophoresis. When the hybrid offspring exhibited a homozygous insertion genotype at 504 bp, it was determined to be of low firmness (fruit firmness after peeling less than 6.9 kg / cm²). 2 Plants; when the hybrid offspring exhibit a heterozygous genotype at 504bp and 412bp, they are classified as having high firmness (fruit firmness after peeling greater than 11.58 kg / cm²). 2 ) plant.

[0028] Preferably, the PCR amplification system includes 1 μL of 50 ng / μL template DNA, 5 μL of 10× PCR mixed enzyme solution, 0.5 μL each of upstream and downstream primers, and sterile ddH2O to a final volume of 10 μL.

[0029] Preferably, the PCR amplification program is as follows: 94℃ pre-denaturation for 3 minutes; 94℃ denaturation for 30 seconds; 58℃ annealing for 30 seconds; 72℃ extension for 2.5 minutes, repeated 35 times, and 72℃ final extension for 10 minutes.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] This invention provides a molecular marker closely linked to apple fruit firmness. This molecular marker exhibits a stronger phenotypic correlation with firmness and offers advantages such as ease of operation, low cost, strong correlation with firmness, and high selection efficiency. It is of great significance for quality-assisted breeding of apple hybrids. The molecular marker provided by this invention overcomes the limitations of traditional ethylene molecular markers, solving the problem of limited explanatory power for phenotypic variation inherent in existing molecular markers.

[0032] This invention, combining multiple biological sequencing technologies, discovered a key structural variation closely linked to fruit quality traits. This structural variation is a 92 bp site located on chromosome 3 of the apple genome. This structural variation is associated with an extremely high firmness phenotype (fruit firmness after peeling greater than 11.58 kg / cm²). 2 In plants of this type, the genotype is mostly heterozygous, and in the extreme soft group progeny (fruit firmness after peeling is less than 6.9 kg / cm²), the genotype is more pronounced. 2 It often manifests as a homozygous insertion genotype.

[0033] This invention, combined with fruit firmness data from two populations of Pink Lady and Fuji apple offspring, reveals that the structural variation sites provided by this invention have excellent applicability and are tightly linked to the firmness phenotype. They can serve as key molecular markers to assist in apple fruit quality breeding, refine the regulatory mechanism of firmness inheritance, and ultimately improve breeding efficiency. Given the advantages of molecular markers in genome-assisted breeding—simplicity, speed, and high throughput—the molecular markers associated with key genetic loci provided in this invention show promising application prospects in quality-assisted breeding of apple hybrids. Attached Figure Description

[0034] Figure 1 This is data on the hardness phenotype of Fuji and Pink Lady and their extreme hybrid offspring.

[0035] Figure 2 This is the result of sequence difference alignment in front of the candidate gene promoter.

[0036] Figure 3 These are the agarose gel electrophoresis results of Fuji and Pink Lady and their extreme hybrid offspring at this site; 1 is Fuji, 25 is Pink Lady, 2 to 24 are extreme hard group samples, and 26 to 48 are extreme soft group samples.

[0037] Figure 4 The pie charts analyze the extremely hard group (a) and the extremely soft group (b). MdERF4 The proportion of different genotypes in the upstream 92bp of the gene; among them, Figure 4 (a) in the diagram represents the extreme hard group; Figure 4 (b) in the table represents the extreme soft group. Detailed Implementation

[0038] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0039] All the experimental (apple) materials used in the embodiments of the present invention were obtained from the Baishui Apple Experimental Station of Northwest A&F University.

[0040] Example 1: Segregation of apple fruit firmness in the offspring of Fuji and Pink Lady hybrids

[0041] This invention used 439 F1 plants from a cross between Fuji and Pink Lady grapes as experimental material. Through systematic data collection of ripening firmness phenotypic data over two consecutive years, it was found that the fruit firmness trait exhibited widespread segregation within the hybrid population. Differences in firmness phenotypes existed among extreme progeny generations, providing an ideal segregating population for QTL mapping studies of fruit firmness. Phenotypic frequency distribution analysis showed that the ripening firmness phenotypic values ​​followed a continuous normal distribution within the population, indicating that this trait is a quantitative trait regulated by multiple genes.

[0042] Among them, the hardness phenotype data of Fuji and Pink Lady and their extreme hybrid offspring are as follows: Figure 1 As shown.

[0043] like Figure 1 As shown, the extreme hard group has a significantly higher hardness than the extreme soft group. p <0.01), using the above two sets of extreme samples as experimental materials, provides a material basis for subsequent verification of the high selection efficiency and strong specificity of this molecular marker.

[0044] Example 2: MdERF4 Acquisition of molecular markers

[0045] Whole-genome resequencing analysis based on pooled analysis of extreme firmness phenotypes identified a 92 bp structural variation on apple chromosome 3 (31719866-31719957) that was significantly associated with fruit firmness. To further verify the functional effect of this fragment, this invention amplified the upstream promoter sequences of candidate genes in individuals with extreme firmness and softness phenotypes. Sanger sequencing verification results showed that some progeny of the extreme softness group had a 92 bp deletion at this variation site. Figure 2 This indicates that the genetic variation site is closely linked to fruit firmness at maturity and may participate in the fruit firmness formation mechanism by regulating the expression of downstream genes.

[0046] The nucleotide sequence of the 92bp fragment (sequence) is shown in SEQ ID NO. 1:

[0047] CCAAACCACCGTTCGTCGAGATGAATTTTGATGGCTCTGTTAAAAATTCGACCTTGTATGCTTAATATTTATGTAATTAATGATGAATGTTC.

[0048] Example 3: Validation of the 92bp structural variation in the offspring of the Fuji and Pink Lady cross.

[0049] Primers were designed to specifically detect a 92bp structural variation in 48 progeny of the Fuji and Pink Lady extreme hardness phenotypes. Genomic DNA was extracted from the hybrid progeny of Pink Lady, Fuji, and extreme hardness, and used as templates for PCR amplification using specific detection primers. Genotypes were verified based on the PCR amplification products.

[0050] The detection primers include upstream primer Del92-F and downstream primer Del92-R.

[0051] The nucleotide sequence of the upstream primer Del92-F is 5'-TCCGCCCCCTCTGAGCCTAA-3', as shown in SEQ ID NO.2.

[0052] The nucleotide sequence of the downstream primer Del92-R is 5'-GAACCAACCATCTCCCAATCC-3', as shown in SEQ ID NO.3.

[0053] The PCR amplification system consisted of 1 μL of 50 ng / μL template DNA, 5 μL of 10× PCR mixed enzyme solution, 0.5 μL each of upstream and downstream primers, and sterile ddH2O to a final volume of 10 μL, covered with liquid paraffin.

[0054] The PCR program was as follows: 94℃ pre-denaturation for 3 minutes; 94℃ denaturation for 30 seconds; 58℃ annealing for 30 seconds; 72℃ extension for 2.5 minutes, repeated 35 times, and 72℃ final extension for 10 minutes.

[0055] The agarose gel electrophoresis results of the Fuji and Pink Lady parents and their hybrid offspring at this genetic variation site are as follows: Figure 3 As shown. The results indicate that the Fuji and Pink Lady parents exhibit Ins92:Del92 heterozygous and Del92:Del92 homozygous traits, respectively, at this mutation site. The hybrid offspring should have a theoretical genetic segregation ratio of heterozygous to deletion of 1:1.

[0056] Next, DNA was extracted from more extreme hybrid offspring and validated in 90 hybrid progeny. A similar result was observed: the fruit exhibited extreme softness (fruit firmness after peeling less than 6.9 kg / cm²). 2 The Del92:Del92 homozygous deletion genotype is commonly observed. The extreme hard group (fruit firmness after peeling greater than 11.58 kg / cm²) is also observed. 2 It is closely linked to the Ins92:Del92 heterozygous genotype.

[0057] Pie chart analysis of extreme hard groups and extreme soft groups MdERF4 The proportion of different genotypes in the 92bp upstream of the gene. The results showed that in the extreme hard group ( Figure 4In (a) of the study, the Ins92:Del92 heterozygous progeny genotype accounted for 90%, while the Del92:Del92 homozygous deletion genotype accounted for only 10%. In the extreme soft group ( Figure 4 In (b) of the study, the Del92:Del92 homozygous deletion genotype accounted for 72%, while the Ins92:Del92 heterozygous progeny genotype accounted for only 28%, which again shows that this genetic variation site is closely linked to the firmness of the fruit at maturity and can be applied to molecular marker-assisted breeding of hybrid offspring.

[0058] This invention provides a molecular marker closely linked to apple fruit firmness. This molecular marker exhibits a stronger phenotypic correlation with firmness and offers advantages such as ease of operation, low cost, strong correlation with firmness, and high selection efficiency. It is of great significance for quality-assisted breeding of apple hybrids. The molecular marker provided by this invention overcomes the limitations of traditional ethylene molecular markers, solving the problem of limited explanatory power for phenotypic variation inherent in existing molecular markers.

[0059] It should be noted that when numerical ranges are involved in this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, this invention describes preferred embodiments.

[0060] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments, all of which fall within the scope of the invention.

Claims

1. A reagent for detecting molecular markers closely linked to apple fruit firmness, used in the assisted breeding of high-firm apples or for identifying apple fruit firmness, characterized in that... The reagent for detecting a molecular marker closely linked to apple fruit firmness includes primers for detecting the molecular marker; the primers include an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3; The molecular marker is located at positions 31719866 to 31719957 on chromosome 3 of the apple genome, and is a 92bp insertion or deletion polymorphism site; wherein, the nucleotide sequence of the 92bp sequence is shown in SEQ ID NO. 1; the apple is Fuji, Pink Lady, or a hybrid; Methods for assisting in the breeding of high-firm apples or for assessing apple fruit firmness include the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as template DNA, PCR amplification was performed using the primers; The PCR amplification products were subjected to agarose gel electrophoresis, and the polymorphism and genotype of the molecular marker were determined based on the results of the agarose gel electrophoresis. When the PCR amplification product shows a specific band at 504 bp, it is a homozygous insertion genotype; when the PCR amplification product shows specific bands at both 504 bp and 412 bp, it is a heterozygous genotype. When the hybrid offspring exhibit a homozygous insertion genotype at 504bp, they are classified as low-hardness plants; when the hybrid offspring exhibit a heterozygous genotype at both 504bp and 412bp, they are classified as high-hardness plants.

2. The application according to claim 1, characterized in that, The PCR amplification system includes 1 μL of 50 ng / μL template DNA, 5 μL of 10× PCR mixed enzyme solution, 0.5 μL each of upstream and downstream primers, and sterile ddH2O to a final volume of 10 μL.

Images