A molecular marker related to the texture of jackfruit pulp, primer combination and application

Abstract

The present application relates to the field of molecular breeding, and discloses a molecular marker related to the texture of jackfruit pulp, a primer combination and application. The molecular marker is located on the CM046350.1 chromosome of the jackfruit genome GCA_025403435.1; the molecular marker is an SNP marker and / or an InDel marker; the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1; the SNP marker is located at the 1379th position of the nucleotide sequence shown in SEQ ID NO. 1, and the polymorphism is G / A; the InDel marker is located at the 412th to 466th positions of the nucleotide sequence shown in SEQ ID NO. 1, and is a 55 bp deletion. The present application uses the above-mentioned molecular marker related to the texture of jackfruit pulp, primer combination and application. The molecular marker can be used for early identification in jackfruit hybrid breeding, shortens the breeding time, and lays a foundation for the genetic breeding of jackfruit.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular breeding, and in particular to a molecular marker related to the texture of jackfruit pulp, a primer combination and application. BACKGROUND

[0002] Jackfruit, also known as tree pineapple and jackfruit, is an important tropical rare fruit tree in China, widely distributed in Guangdong, Guangxi, Yunnan and Hainan, and mostly planted in the front and back of courtyards. Long-term seedling propagation has resulted in a wealth of genetic variation in the existing jackfruit germplasm in China. Fruit texture is an important quality attribute of fruit. Jackfruit can be divided into dry bract type and wet bract type according to its fruit texture. Dry bract type is the current main type of cultivated varieties. In dry bract type, the fruit texture varies, with completely dry bract type fruit having hard pulp and low water content, resulting in low economic value. Wet soft type dry bract type fruit has soft pulp and high pulp content, and is an ideal pulp texture type.

[0003] Traditional jackfruit breeding techniques in China are mostly natural population seedling selection, and hybrid breeding techniques are gradually gaining attention and application in jackfruit breeding. Due to the large size of jackfruit plants (large area occupied), long time to flower for seedling trees, and special main stem fruiting habit, it is not convenient to use high grafting and variety replacement to speed up the breeding process as with other fruit trees, and using molecular markers associated with important traits for seedling selection is an important technique for accelerating jackfruit breeding. SUMMARY

[0004] The purpose of the present application is to provide a molecular marker related to the texture of jackfruit pulp, a primer combination and application, which can be used for early identification in jackfruit hybrid breeding. By detecting jackfruit using the molecular marker provided by the present application, analyzing the texture of the pulp, and further breeding ideal jackfruit varieties, the breeding time is shortened, and a foundation is laid for the genetic breeding of jackfruit.

[0005] To achieve the above-mentioned purpose, the present application provides a molecular marker related to the texture of jackfruit pulp, which is located on the CM046350.1 chromosome of the jackfruit genome GCA_025403435.1; the molecular marker is an SNP marker and / or an InDel marker; the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1;

[0006] The SNP marker is located at position 1379 of the nucleotide sequence shown in SEQ ID NO. 1, and the polymorphism is G / A;

[0007] The InDel marker is located at positions 412 to 466 of the nucleotide sequence shown in SEQ ID NO. 1, and is a 55 bp deletion.

[0008] Further, the application further provides application of the molecular marker related to the texture of jackfruit flesh in identifying the texture of jackfruit flesh, which is used for identifying the hardness of the flesh of dry jackfruit.

[0009] Further, the application further provides a primer combination of the molecular marker related to the texture of jackfruit flesh, wherein the molecular marker is located on the CM046350.1 chromosome of the jackfruit genome GCA_025403435.1; the molecular marker is an SNP marker and / or an InDel marker; the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1.

[0010] The SNP marker is located at position 1379 of the nucleotide sequence shown in SEQ ID NO. 1, and the polymorphism is G / A.

[0011] The InDel marker is located at positions 412-466 of the nucleotide sequence shown in SEQ ID NO. 1, and is a 55 bp deletion.

[0012] The primer combination is as follows:

[0013] The primer combination of the SNP marker is as follows:

[0014] F2: GAAGGTGACCAAGTTCATGCTaggactgcgtagacaacatcG;

[0015] F1: GAAGGTCGGAGTCAACGGATTaggactgcgtagacaacatcA;

[0016] R: atcgtctatggcgttccccg;

[0017] The primer combination of the InDel marker is as follows:

[0018] F: AGCCGCCTCATCATGTAACA;

[0019] R: AAACAGGGGTCCTTCTTCGG.

[0020] Further, the application further provides a kit comprising the primer combination of the molecular marker related to the texture of jackfruit flesh.

[0021] Further, the application further provides application of the primer combination of the molecular marker related to the texture of jackfruit flesh in identifying the texture of jackfruit flesh.

[0022] Further, the application further provides a method for identifying the texture of jackfruit flesh, comprising the following steps: Further, the application further provides a method for identifying the texture of jackfruit flesh, comprising the following steps:

[0023] 1) extract the total DNA of the genome of the jackfruit to be tested;

[0024] 2) use the primer combination described above to perform PCR amplification on the sample to be tested;

[0025] 3) sequence the PCR amplification product to determine the genotype.

[0026] Further, by analyzing the nucleotide sequence of the jackfruit, the SNP marker and / or InDel marker of the jackfruit flesh texture are identified, and the nucleotide sequence is shown in SEQ ID NO. 1.

[0027] Further, when the SNP marker is GG at position 1379 of the nucleotide sequence shown in SEQ ID NO. 1, it is wet; when the SNP marker is AA at position 1379 of the nucleotide sequence shown in SEQ ID NO. 1, it is dry with hard flesh; and when the SNP marker is GA at position 1379 of the nucleotide sequence shown in SEQ ID NO. 1, it is dry with soft flesh.

[0028] When the InDel marker is a heterozygous genotype at positions 412 to 466 of the nucleotide sequence shown in SEQ ID NO. 1, it is a soft type dry with hard flesh; when it is a homozygous non-deletion genotype, it is a hard type dry with hard flesh; and when it is a homozygous deletion genotype, it is a wet dry with hard flesh.

[0029] The advantages and positive effects of the molecular marker, primer combination and application related to the jackfruit flesh texture provided by the present application are:

[0030] The present application provides a molecular marker and primer combination related to the jackfruit flesh texture, which can be used for early identification in jackfruit hybrid breeding. By detecting the jackfruit using the molecular marker provided by the present application, the flesh texture is analyzed, and the ideal jackfruit variety is selected, which not only shortens the breeding time, but also lays a foundation for the genetic breeding of jackfruit.

[0031] The technical solutions of the present application will be further described in detail below with the aid of the drawings and examples. DETAILED DESCRIPTION

[0032] Figure 1 The SLAF marker-based jackfruit genetic linkage map in the embodiments of the present application;

[0033] Figure 2 The marker site on the LG16 linkage group in the embodiments of the present application;

[0034] Figure 3Screening results of SNP02, SNP03, SNP06 and SNP07 sites in the embodiments of the present application, wherein A is SNP02, B is SNP03, C is SNP06, and D is SNP07; the square symbol represents the GG, CC, GG, and GG genotypes in the A, B, C, and D graphs, respectively; the circular symbol is a homozygous genotype, and represents the CC, TT, AA, and AA genotypes in the A, B, C, and D graphs, respectively; the triangular symbol is a heterozygous genotype, and represents the GC, CT, GA, and GA genotypes in the A, B, C, and D graphs, respectively;

[0035] Figure 4 Identification results of the SNP06 primer set on the F1 hybrid offspring in the embodiments of the present application, the square symbol is a homozygous genotype (GG), and the triangular symbol is a heterozygous genotype (GA);

[0036] Figure 5 Identification results of the SNP06 primer set on the wet and dry bract germplasm in the embodiments of the present application, the square symbol (GG, wet bract) and the circular symbol are homozygous genotypes (AA, dry bract), and the triangular symbol is a heterozygous genotype (GA, dry bract with soft pulp).

[0037] Figure 6 Identification results of the indel marker primer set on the F1 hybrid offspring and the wet and dry bract germplasm in the embodiments of the present application, s is a wet bract; f is a dry bract with hard pulp; and hs is a dry bract with soft pulp. DETAILED DESCRIPTION

[0038] The technical solutions of the present application are further described below through the drawings and examples.

[0039] Unless otherwise defined, the technical terms or scientific terms used in the present application shall have the usual meanings understood by those skilled in the art to which the present application belongs.

[0040] Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the scope of protection of the present application. The experimental methods not specified in the following examples are generally determined according to national standards. The experimental instruments, equipment and reagents not specified in the following examples are all commercially available raw materials.

[0041] Unless otherwise defined or explained, all professional and scientific terms used in the present application have the same meanings as those familiar to those skilled in the art. In addition, any method and material similar or equivalent to those described can be applied in the present application. It should be noted that the embodiments in the present application and the features in the examples can be combined with each other without conflict.

[0042] A molecular marker related to the fruit texture trait of jackfruit, which is located on the CM046350.1 chromosome of the jackfruit genome GCA_025403435.1.

[0043] The SNP molecular marker is located at position 178266 on the CM046350.1 chromosome of the jackfruit genome GCA_025403435.1, and the polymorphism is G / A.

[0044] The InDel marker is located at positions 177299-177353 on the CM046350.1 chromosome of the jackfruit genome GCA_025403435.1, which is a 55 bp deletion.

[0045] The nucleotide sequence to which the SNP molecular marker belongs is shown in SEQ ID NO. 1, and the marker is located at the polymorphic site at position 1379 of the nucleotide sequence, with a polymorphism of G / A.

[0046] The InDel marker is located at positions 412-466 of the nucleotide sequence shown in SEQ ID NO. 1, which is a 55 bp deletion.

[0047] Examples

[0048] The F1 hybrid population was constructed using germplasm GHsj1405 (wet bract) as the female parent and GHsjf146 (dry bract) as the male parent (the parents and part of the F1 hybrid population were planted in the landscape base of Guangdong Ocean University; GHsj1405 was collected from Xuwen, Zhanjiang, Guangdong in 2010, and GHsjf146 was collected from Donghai Island, Zhanjiang, Guangdong in 2014, both of which were preserved in the landscape base of Guangdong Ocean University in the form of grafted seedlings). The population size was 150 plants. SLAF simplified genome sequencing was used on the population to construct a genetic linkage map. A total of 293592 SLAF tags were developed, of which 138805 were polymorphic SLAF tags, 63499 could be used for genetic map construction, 7760 were markers, and finally a neutral map with a total map distance of 4804.68 cM was obtained, with 28 linkage groups, an average map distance of 16.96 cM, and 16436 SNP markers. Figure 1 、 Figure 2

[0049] Using the genetic linkage map, the fruit flesh texture traits of dry and wet bracts were mapped, and a significant locus was identified on linkage group LG16, located between markers Marker26619 and Marker17320, with a genetic distance of 1.818 cm.

[0050] ​Using the population, the BSAseq method was further used for gene mapping. The sequencing depth of the parents was 30x, and the extreme pool sequencing depth was 100x; 1641977 SNPs were obtained, of which 47996 SNPs caused non-synonymous mutations; 134725 small InDels were obtained; using the SNP-index, ED and InDel-index, ED correlation algorithm, 1 candidate region associated with the trait was obtained, with a total length of 16.56 Mb, and a total of 186 genes were annotated in the candidate region.

[0051] In combination with the transcriptome analysis, XLOC_073424 was determined as a candidate gene (the sequence is shown as SEQ ID NO. 1), and the chromosome is JAIQDR010004116.1.

[0052] SEQ ID NO. 1:

[0053] G AAGACAGCGTCGAAAGTCTCAAAGATTCGGGGAACGCCATAGACGATCTGATCAGGAATGGTACAGCGAAGTCGGAGGACGAGAAATATCAGACGGAGGAGGACGTCAAGACGTGGGTCAGCGCCGCTTTGACGGATGATGACACGTGCTCGGAAGAGCTCGACGAGGAGAAGGTCAGCCC.

[0054] The gene encodes pectinesterase inhibitor, without intron. The SNP site and primer group of the gene sequence of the parents are shown in Table 1:

[0055] According to the above SNP site, 8 groups of SNP marker primers are designed, each group including 3 primers, named A, B and C respectively.

[0056] Table 1 Site and primer group

[0057]

[0058] The indel marker primer is:

[0059] F: AGCCGCCTCATCATGTAACA (SEQ ID NO. 26);

[0060] R: AAACAGGGGTCCTTCTTCGG (SEQ ID NO. 27).

[0061] The length of the indel marker is 55 bp, the amplification length in GHsjf146 (dry bract) is 548 bp, and the amplification length in GHsj1405 (wet bract) is 493 bp.

[0062] The two parents GHsj1405 and GHsjf146 and their F1 population were used as materials, and the above SNP primers were screened by PARMS-SNP method, and the enzyme system for screening was as follows: DNA template (10 ng / μL) 2 μL, 2×PARMS MasterMix 5 μL, primer A (10 μmol / μL) 0.3 μL, primer B (10 μmol / μL) 0.3 μL, primer C (10 μmol / μL) 0.6 μL, deionized water 1.8 μL.

[0063] The detection was performed using a BioRAD CFX connected fluorescence quantifier, and the reaction procedure was as follows: 94 DEG C, 15 min; 94 DEG C, 20 s, 65 DEG C, 1 min, 10 cycles, and the temperature was reduced by 0.8 DEG C each cycle; 94 DEG C, 20 s, 57 DEG C, 1 min, 32 cycles; 30 DEG C, 1 min, and fluorescence data were read.

[0064] The screening results show that (as shown in Figure 3 SNP02, SNP03, SNP06 and SNP07 can effectively distinguish the dry and wet bracts in the parent and hybrid offspring. Since SNP06 and SNP07 belong to the same SNP site, finally, SNP06 primer group is used to associate the texture traits of jackfruit.

[0065] The enzyme reaction system of the indel marker primer is as follows: 2 μL of DNA template (10 ng / μL), 2 μL of 10x buffer (containing MgCl2), 0.2 μL of primer R (10 μmol / μL), 0.2 μL of primer F (10 μmol / μL), 0.2 μL of Taq enzyme (5 U / μL), 2 μL of dNTPs (2 mmol / μL), and 13.4 μL of deionized water.

[0066] The fruit texture traits and genotypes of 3 wet bracts and 8 dry bracts of jackfruit germplasm were analyzed using the SNP06 primer group. The results show that among 150 F1 hybrid offspring, 65 wet bract individuals are homozygous genotypes, and the remaining 85 plants are dry bracts with soft texture, and the genotypes are all heterozygous genotypes (as shown in Figure 4 ).

[0067] The analysis results of 3 wet bracts and 8 dry bracts of jackfruit germplasm show that the 3 wet bracts are homozygous genotypes, and among the 8 dry bracts, 2 are homozygous genotypes, and 6 are heterozygous genotypes. The fruit pulp of the homozygous genotype is less moist, and the fruit pulp texture is hard; the fruit pulp texture of the heterozygous genotype is soft (as shown in Figure 5 ).

[0068] The identification results of the indel marker primer (as shown in Figure 6 are the same as those of the SNP06 primer group.

[0069] Therefore, the molecular marker, primer combination and application related to the fruit pulp texture of jackfruit can be used for early identification in jackfruit hybrid breeding. By detecting jackfruit using the molecular marker provided by the application, analyzing the fruit pulp texture, and further breeding ideal jackfruit varieties, the breeding time is shortened, and the foundation for the genetic breeding of jackfruit is laid.

[0070] It should be pointed out finally that the above examples are only used to illustrate the technical solutions of the present application but not to limit it, and although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can still be modified or replaced equivalently, and these modifications or equivalent replacements should not make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A molecular marker associated with the texture of jackfruit pulp, characterized by: The molecular marker is a SNP marker and / or an InDel marker; the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1; The polymorphism of the SNP marker at position 1379 of the nucleotide sequence shown in SEQ ID NO. 1 is G / A; The InDel marker is a 55 bp deletion of CCTCGCTTCAAATTTATTAATTTGTCTCAGACCTTTTGATCTAATAGCATGAGTA at positions 412-466 of the nucleotide sequence shown in SEQ ID NO.

1.

2. A primer combination of a molecular marker associated with the texture of jackfruit pulp, characterized by: The molecular marker is the molecular marker in claim 1; the molecular marker is a SNP marker and an InDel marker; The primer combination is as follows: SNP marker primer combination: F2: GAAGGTGACCAAGTTCATGCTaggactgcgtagacaacatcG; F1: GAAGGTCGGAGTCAACGGATTaggactgcgtagacaacatcA; R: atcgtctatggcgttccccg; InDel marker primer combination: F: AGCCGCCTCATCATGTAACA; R: AAACAGGGGTCCTTCTTCGG.

3. A kit comprising the primer combination of a molecular marker related to the texture of jackfruit flesh according to claim 2.

4. A primer set for detecting the SNP marker related to the texture of jackfruit flesh according to claim 1, characterized in that: The primer set of the SNP marker is as follows: F2: GAAGGTGACCAAGTTCATGCTaggactgcgtagacaacatcG; F1: GAAGGTCGGAGTCAACGGATTaggactgcgtagacaacatcA; R: atcgtctatggcgttccccg.

Images