Biosensor based on covalent organic framework capsule as well as preparation method and application of biosensor

Abstract

The invention discloses a biosensor based on a covalent organic framework capsule as well as a preparation method and application of the biosensor. According to the sensor, horseradish peroxidase (HRP) and a COF ligand are mixed and stirred at the temperature of 0 DEG C, and the enzyme (at) COF capsule is prepared. Furthermore, the COF capsule is subjected to surface functional modification through a CD63 aptamer, and a biosensing element with molecular recognition and signal amplification functions is constructed. When the sensor works, firstly, the surface of a gold electrode is modified with an EpCAM aptamer for capturing the exosome, then the functionalized aptamer-HRP-COF capsule is specifically combined with the exosome through a CD63 aptamer, H2O2 is catalyzed by a large number of HRP in the capsule to oxidize TMB to generate an electrochemical signal, and direct quantitative detection of the exosome is achieved. The method has the advantages of high detection sensitivity, good specificity, no need of additional signal amplification and the like, and a new technical scheme is provided for exosome detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of exosome detection, and relates to a biosensor based on a covalent organic framework capsule, and a preparation method and application thereof. Background Art

[0002] Exosomes are nanoscale (30-150nm) double-membrane vesicles actively secreted by cells. The bioactive molecules they carry, such as proteins, nucleic acids, and lipids, can accurately reflect the physiological and pathological states of the parent cells. Numerous studies have shown that exosomes play an important regulatory role in the development and progression of a variety of major diseases by mediating intercellular communication. As natural carriers with cell traceability and molecular marker enrichment properties, exosomes have become a new biomarker for early tumor diagnosis. In recent years, biosensor-based detection methods have achieved significant breakthroughs in exosome detection by integrating strategies such as nanomaterials, microfluidics, and signal amplification. These methods, with their single-particle detection sensitivity, subtype resolution specificity, real-time dynamic monitoring capabilities, and miniaturized integration advantages, provide strong technical support for the clinical translation and application of tumor-seeding exosomes.

[0003] As an efficient biocatalyst, enzymes are of great value in the field of biosensing due to their substrate specificity and high selectivity. Although enzyme-based biosensors have the advantages of high sensitivity, selectivity and rapid response, natural enzymes are easily inactivated by environmental factors (such as temperature and pH), which seriously limits their application. Enzyme immobilization technology can significantly improve the stability and achieve enzyme recycling by anchoring the enzyme to a specific carrier, but traditional immobilization methods often lead to restricted enzyme conformation, obstructed mass transfer and partial loss of activity. Inspired by biomineralization, the biomimetic encapsulation strategy maintains the conformational freedom of the enzyme while protecting its structure through physical encapsulation, thereby optimizing the catalytic performance. Currently developed immobilization materials (such as magnetic nanoparticles, metal-organic frameworks, etc.) still face challenges such as uneven porosity, crystal defects and insufficient structural stability.

[0004] Covalent organic frameworks (COFs) are ideal candidates for enzyme encapsulation materials due to their high crystallinity, regular pore structure, and excellent thermal stability. However, conventional COF synthesis requires harsh conditions (organic solvents, extreme pH, or high temperature), which can easily lead to enzyme denaturation and inactivation. Recent studies have proposed three mild encapsulation strategies: (1) MOF template etching, (2) crystallization-self-healing coating, and (3) aqueous in situ synthesis at room temperature. Although these methods can maintain enzyme activity and simplify synthesis conditions, they still face technical bottlenecks such as uneven material morphology and complex processes. Summary of the Invention

[0005] Technical problem solved: In order to improve the efficiency of exosome detection, the present invention solves the problems of COF material synthesis control, biosensor functionalization and exosome detection technology, and provides a biosensor based on covalent organic framework capsules and its preparation method and application. The biosensor based on covalent organic framework capsules can realize direct quantitative detection of target exosomes, significantly improve the accuracy and sensitivity of exosome detection, and provide a reliable technical platform for high-sensitivity analysis of exosomes.

[0006] Technical solution: A method for preparing a biosensor based on a covalent organic framework capsule, comprising the following steps in proportion: (a) Preparation of covalent organic framework capsules: dissolve 13-15 mg of 1,3,5-tris(4-aminophenyl)benzene (TPB) in 8-10 mL of ethanol, add horseradish peroxidase (HRP) solution and stir for 5-10 minutes, then add 10-20 mg of [1,1':4',1"-triphenyl]-2',5'-dicarboxaldehyde (TPDA) and 60-100 μL of acetic acid, stir to react, and centrifuge and wash to obtain TPB-TPDA-HRP@COF capsules; (b) Preparation of aptamer-modified covalent organic framework capsules: dissolve TPB-TPDA-HRP@COF gel in 8-10 mL of ethanol, add horseradish peroxidase (HRP) solution and stir for 5-10 minutes, then add 10-20 mg of [1,1':4',1"-triphenyl]-2',5'-dicarboxaldehyde (TPDA) and 60-100 μL of acetic acid, stir to react, and centrifuge and wash to obtain TPB-TPDA-HRP@COF capsules; The capsule solution was mixed with glutaraldehyde solution and CD63 aptamer DNA solution and vortexed to obtain the aptamer-HRP@COF capsule complex; (c) Sensor construction: (i) The gold electrode was polished with alumina, treated with piranha solution, and electrochemically cleaned; (ii) The EpCAM aptamer was added to the electrode surface for incubation, and then 6-mercaptohexanol (MCH) was added after rinsing to block the solution; (iii) The exosome sample was added for incubation, and then the aptamer-HRP@COF capsule complex was added after rinsing to form a working electrode.

[0007] The CD63 aptamer DNA sequence in step (b) is: 5′-NH2-tttcacccca cctcgctcccgtgacactaa tgcta-3′;

[0008] The EpCAM aptamer sequence in step (c) (ii) is: 5′-SH-cactacagag gttgcgtctgtcccacgttg tcatgggggg ttggcctg-3′.

[0009] Step (a) specifically comprises: dissolving 14 mg of TPB in 9 mL of ethanol; adding 2 mL of a 5 mg / mL HRP solution and stirring for 5 minutes; adding 17 mg of TPDA dissolved in 1 mL of THF and 80 μL of acetic acid, stirring at 200 rpm at 0°C for 30 minutes; centrifuging at 10,000 rpm for 10 minutes, and washing three times with deionized water.

[0010] Step (b) specifically comprises: diluting the glutaraldehyde solution to 5% with PBS buffer; mixing 500 μL of 4 mg / mL TPB-TPDA-HRP@COF capsule solution, 500 μL of 5% glutaraldehyde solution and 100 μL of 10 μM CD63 aptamer DNA solution, and vortexing at room temperature for 1 hour.

[0011] The electrochemical cleaning in step (i) of step (c) is performed by performing a cyclic voltammetry scan in a potential range of -0.3V to 1.6V in a 0.5M sulfuric acid solution.

[0012] In step (c) (ii): the EpCAM aptamer concentration was 0.5 μM and was fixed using a buffer containing 10 mM Tris-HCl, 1.0 mM EDTA, 1.0 M NaCl, and 1.0 mM pH = 7.4 TCEP, and incubated for 4 hours; the MCH solution concentration was 1 mM and incubated for 0.5 hours.

[0013] In step (c) (iii): the incubation time of exosomes was 2 hours; the incubation time of aptamer-HRP@COF capsule complex was 2 hours.

[0014] The biosensor based on covalent organic framework capsule is prepared by the above method.

[0015] The above biosensor is used in the detection of exosomes, and the detection range of exosome concentration is 1×10 2 to 1×10 8 Particles / μL.

[0016] During the detection, HRP in the aptamer-HRP@COF capsule catalyzed H2O2 to oxidize TMB to generate an electrochemical signal. The current response value (I, μA) and the exosome concentration (c, particles / μL) satisfied the linear equation: I = 0.0652logc + 0.2649, with a correlation coefficient R 2 =0.9956, and the detection limit was 80 particles / μL.

[0017] Beneficial effects: The present invention proposes a direct and effective method to synthesize spherical COF capsules without the use of templates, and realizes in situ encapsulation of enzymes. The cavity structure of the COF capsule not only protects the conformational freedom of the enzyme, but also significantly improves its stability during long-term storage. The in situ encapsulation method provides the enzyme with a cavity of suitable size, which effectively reduces the leakage of enzyme molecules while maintaining the catalytic activity of the enzyme. Compared with free HRP and HRP@COFs prepared by physical adsorption, HRP@COF capsules exhibit superior enzyme activity. This COFs-based active biomolecule encapsulation strategy has the advantages of simple operation and high efficiency, and provides a new idea for the stable loading of biomacromolecules. This method has high selectivity, reproducibility and reliability, and provides a promising approach for the rapid and sensitive detection of exosomes, showing important clinical application value in the field of early diagnosis of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the synthesis (A) and application (B) of the material described in the present invention.

[0019] Figure 2 Transmission electron microscopy image (A) and DLS analysis (B) results of TPB-TPDA-HRP@COF capsules.

[0020] Figure 3 This is a comparison of the enzyme activities of HRP@COF capsules, HRP@COF, and free HRP after treatment at different temperatures in Example 1.

[0021] Figure 4 This is the linear relationship between the current response and the logarithm of the exosome concentration in Example 2.

[0022] Figure 5 These are the clinical sample analysis results in Example 3. DETAILED DESCRIPTION

[0023] The following examples may enable those skilled in the art to more fully understand the present invention, but are not intended to limit the present invention in any way.

[0024] Example 1

[0025] The technical method involved in the present invention mainly includes three parts: the preparation of TPB-TPDA-HRP@COF capsules, the preparation of Aptamer-HRP@COF capsules, and the construction of the sensor. The specific implementation contents are as follows:

[0026] 1. Preparation of TPB-TPDA-HRP@COF capsules:

[0027] (1) Weigh 14 mg of 1,3,5-tris(4-aminophenyl)benzene (TPB) and dissolve it in 9 mL of ethanol;

[0028] (2) Add 2 ml of horseradish peroxidase (HRP) solution (5 mg / mL) to the TPB ethanol solution under stirring and continue stirring for 5 minutes;

[0029] (3) 17 mg of [1,1':4',1"-triphenyl]-2',5'-dicarbaldehyde (TPDA) (0.06 mmol, dissolved in 1 mL of THF) was added to the mixed solution, and 80 μL of acetic acid was added dropwise. The mixture was stirred at 200 rpm for 30 min.

[0030] (4) After thorough stirring, the solution was centrifuged at 10,000 rpm for 10 minutes to collect the product;

[0031] (5) The centrifuged product was washed three times with deionized water to obtain a yellow product, namely TPB-TPDA-HRP@COF capsules.

[0032] 2. Preparation of Aptamer-HRP@COF Capsules:

[0033] (1) Dilute the glutaraldehyde solution from 25% to 5% using PBS buffer;

[0034] (2) Take TPB-TPDA-HRP@COF capsule solution (4 mg / mL, 500 μL), 5% glutaraldehyde solution (500 μL) and CD63 aptamer DNA solution (10 μM, 100 μL) and mix them at room temperature. Oscillate the reaction on a vortex for 1 hour to obtain the Aptamer-HRP@COF capsule complex.

[0035] The CD63 aptamer DNA sequence is: 5′-NH2-tttcacccca cctcgctccc gtgacactaa tgcta-3′.

[0036] 3. Construction of sensor:

[0037] (1) The bare gold electrode was polished with 0.3 μm and 0.05 μm aluminum oxide respectively, and then ultrasonically cleaned with ethanol and deionized water for 5 minutes respectively;

[0038] (2) Immerse the electrode in a piranha solution consisting of concentrated sulfuric acid and hydrogen peroxide in a volume ratio of 3:1 for 30 minutes;

[0039] (3) Cyclic voltammetry was performed in a 0.5 M sulfuric acid solution at a potential range of -0.3 V to 1.6 V to complete the electrochemical cleaning of the electrode surface;

[0040] (4) The electrode was rinsed with deionized water, and 10 μL of DNA immobilization buffer (10 mM Tris-HCl, 1.0 mM EDTA, 1.0 M NaCl, 1.0 mM TCEP, pH = 7.4) containing 0.5 μM EpCAM aptamer was added dropwise to the surface of the gold electrode. After incubation for 4 h, the aptamer-modified electrode was obtained.

[0041] The EpCAM aptamer sequence is: 5′-SH-cactacagag gttgcgtctg tcccacgttg tcatggggggttggcctg-3′.

[0042] (5) After rinsing the unmodified EpCAM aptamer on the electrode surface with deionized water, 10 μL of 1 mM 6-mercaptohexanol (MCH) solution was added to the electrode surface and incubated for 0.5 h to block the unmodified active sites on the electrode surface;

[0043] (6) After rinsing with deionized water, the solution to be tested was added dropwise and incubated for 2 hours; after rinsing with deionized water, 10 μL of aptamer-HRP@COF capsule solution was added dropwise and incubated for 2 hours to obtain the final working electrode, which was then rinsed with deionized water for electrochemical detection.

[0044] Example 2

[0045] To investigate the protective effect of various types of COF capsules on HRP enzyme under different temperature conditions

[0046] (1) Add 100 μL of TMB solution to a centrifuge tube, followed by 10 μL of HRP enzyme solution;

[0047] (2) After the mixed system reacted for 10 minutes, 100 μL of 2 M H2SO4 was immediately added to terminate the reaction. At this time, the solution changed from blue to stable yellow;

[0048] (3) After the reaction was terminated, the absorbance of the sample was measured at 450 nm using a UV-visible spectrophotometer. Each sample was measured three times to eliminate operational errors.

[0049] (4) The results show that Figure 3 ), after treatment at 70°C for 2 h, HRP@COF capsules still retained 60% of the initial enzyme activity, which was significantly higher than that of free HRP (30%) and HRP@TPB-TPDA-COFs (40%);

[0050] (5) By comparing the performance differences of TPB-TPDA-HRP@COF capsules, free HRP, and HRP@TPB-TPDA-COFs prepared by physical adsorption method at different temperatures, it was found that COF capsules have an excellent protective effect on enzymes.

[0051] Example 3

[0052] Detection performance analysis of TPB-TPDA-HRP@COF capsules

[0053] (1) The bare gold electrode was polished with 0.3 μm and 0.05 μm aluminum oxide respectively, and then ultrasonically cleaned with ethanol and deionized water for 5 minutes respectively;

[0054] (2) Immersing the electrode in a piranha solution consisting of concentrated sulfuric acid and hydrogen peroxide in a volume ratio of 3:1 for 30 minutes; performing a cyclic voltammetric scan in a potential range of -0.3 V to 1.6 V in a 0.5 M sulfuric acid solution to complete electrochemical cleaning of the electrode surface;

[0055] (3) The electrode was rinsed with deionized water, and 10 μL of DNA immobilization buffer (10 mM Tris-HCl, 1.0 mM EDTA, 1.0 M NaCl, 1.0 mM TCEP, pH = 7.4) containing 0.5 μM EpCAM aptamer was added dropwise to the surface of the gold electrode. After incubation for 4 h, the aptamer-modified electrode was obtained.

[0056] (4) After rinsing the unmodified EpCAM aptamer on the electrode surface with deionized water, 10 μL of 1 mM 6-mercaptohexanol (MCH) solution was added to the electrode surface and incubated for 0.5 h to block the unmodified active sites on the electrode surface;

[0057] (5) Rinse thoroughly with deionized water, then add the test solution and incubate for 2 hours;

[0058] (6) Rinse with deionized water, and finally add 10 μL of aptamer-HRP@COF capsule solution and incubate for 2 h to obtain the final working electrode. After rinsing with deionized water, electrochemical detection was performed.

[0059] The biosensor was used to detect and analyze breast cancer exosomes at different concentrations. The results showed that when the exosome concentration was 10 2 to 10 8 When the gradient increases within the range of particles / μL, the amperometric response current generated by the sensor shows a significant concentration-dependent enhancement characteristic ( Figure 4By establishing a linear relationship between the sensor response current (I, μA) and the logarithm of the exosome concentration (logc), the linear equation can be obtained as I = 0.0652logc + 0.2649, and the correlation coefficient (R 2 ) was 0.9956, and the detection limit was 80 particles / μL, which confirmed the reliability of the quantitative model.

[0060] Example 4

[0061] Clinical sample analysis of TPB-TPDA-HRP@COF capsules

[0062] (1) The bare gold electrode was polished with 0.3 μm and 0.05 μm aluminum oxide respectively, and then ultrasonically cleaned with ethanol and deionized water for 5 minutes respectively;

[0063] (2) Immersing the electrode in a piranha solution consisting of concentrated sulfuric acid and hydrogen peroxide in a volume ratio of 3:1 for 30 minutes; performing a cyclic voltammetric scan in a potential range of -0.3 V to 1.6 V in a 0.5 M sulfuric acid solution to complete electrochemical cleaning of the electrode surface;

[0064] (3) The electrode was rinsed with deionized water, and 10 μL of DNA immobilization buffer (10 mM Tris-HCl, 1.0 mM EDTA, 1.0 M NaCl, 1.0 mM TCEP, pH = 7.4) containing 0.5 μM EpCAM aptamer was added dropwise to the surface of the gold electrode. After incubation for 4 h, the aptamer-modified electrode was obtained.

[0065] (4) After rinsing the unmodified EpCAM aptamer on the electrode surface with deionized water, 10 μL of 1 mM 6-mercaptohexanol (MCH) solution was added to the electrode surface and incubated for 0.5 h to block the unmodified active sites on the electrode surface;

[0066] (5) After rinsing with deionized water, the diluted serum sample was added dropwise and incubated for 2 hours;

[0067] (6) Rinse with deionized water, and finally add 10 μL of aptamer-HRP@COF capsule solution and incubate for 2 h to obtain the final working electrode. After rinsing with deionized water, electrochemical detection was performed.

[0068] The test results showed that the response in the serum of healthy individuals was significantly lower than that of breast cancer patients. At the same time, the response of patients after treatment was lower than that before treatment, but slightly higher than that of healthy people ( Figure 5 ). The scatter plot showed significant differences between breast cancer patients and healthy individuals, validating the diagnostic ability of this method for breast cancer patients.

Claims

1. A method for preparing a biosensor based on a covalent organic framework capsule, characterized in that: According to the proportion, the method includes the following steps: (a) preparation of covalent organic framework capsules: dissolving 13-15 mg of 1,3,5-tris(4-aminophenyl)benzene (TPB) in 8-10 mL of ethanol, adding horseradish peroxidase (HRP) solution and stirring for 5-10 minutes, then adding 10-20 mg of [1,1':4',1"-triphenyl]-2',5'-dicarboxaldehyde (TPDA) and 60-100 μL of acetic acid, stirring for reaction, centrifuging and washing to obtain TPB-TPDA-HRP@COF capsules; (b) preparation of aptamer-modified covalent organic framework capsules: dissolving TPB-TPDA-HRP@COF gel in 8-10 mL of ethanol, adding horseradish peroxidase (HRP) solution and stirring for 5-10 minutes, then adding 10-20 mg of [1,1':4',1"-triphenyl]-2',5'-dicarboxaldehyde (TPDA) and 60-100 μL of acetic acid, stirring for reaction, and centrifuging and washing to obtain TPB-TPDA-HRP@COF capsules; The capsule solution was mixed with glutaraldehyde solution and CD63 aptamer DNA solution and vortexed to obtain the aptamer-HRP@COF capsule complex; (c) Sensor construction: (i) The gold electrode was polished with alumina, treated with piranha solution, and electrochemically cleaned; (ii) The EpCAM aptamer was added to the electrode surface for incubation, and then 6-mercaptohexanol (MCH) was added after rinsing to block the solution; (iii) The exosome sample was added for incubation, and then the aptamer-HRP@COF capsule complex was added after rinsing to form a working electrode.

2. The method according to claim 1, characterized in that The CD63 aptamer DNA sequence in step (b) is: 5′-NH2-tttcacccca cctcgctccc gtgacactaa tgcta-3′; The EpCAM aptamer sequence in step (c) (ii) is: 5′-SH-cactacagag gttgcgtctg tcccacgttg tcatgggggg ttggcctg-3′.

3. The method according to claim 1, characterized in that Step (a) specifically comprises: dissolving 14 mg of TPB in 9 mL of ethanol; adding 2 mL of a 5 mg / mL HRP solution and stirring for 5 minutes; adding 17 mg of TPDA dissolved in 1 mL of THF and 80 μL of acetic acid, stirring at 200 rpm at 0°C for 30 minutes; centrifuging at 10,000 rpm for 10 minutes, and washing three times with deionized water.

4. The method according to claim 1, wherein Step (b) specifically comprises: diluting the glutaraldehyde solution to 5% with PBS buffer; mixing 500 μL of 4 mg / mL TPB-TPDA-HRP@COF capsule solution, 500 μL of 5% glutaraldehyde solution and 100 μL of 10 μM CD63 aptamer DNA solution, and vortexing at room temperature for 1 hour.

5. The method according to claim 1, wherein The electrochemical cleaning in step (i) of step (c) is performed by performing a cyclic voltammetry scan in a potential range of -0.3V to 1.6V in a 0.5M sulfuric acid solution.

6. The method according to claim 1, characterized in that In step (c) (ii): the EpCAM aptamer concentration was 0.5 μM and was fixed using a buffer containing 10 mM Tris-HCl, 1.0 mM EDTA, 1.0 M NaCl, and 1.0 mM pH = 7.4 TCEP, and incubated for 4 hours; the MCH solution concentration was 1 mM and incubated for 0.5 hours.

7. The method according to claim 1, characterized in that In step (c) (iii): the exosome incubation time was 2 hours; The incubation time of aptamer-HRP@COF capsule complex was 2 h.

8. A biosensor based on covalent organic framework capsules prepared by the method according to any one of claims 1 to 7.

9. Use of the biosensor according to claim 8 in exosome detection, characterized in that: The concentration range of exosomes detected was 1×10 2 to 1×10 8 Particles / μL.

10. The use according to claim 9, characterized in that During the detection, HRP in the aptamer-HRP@COF capsule catalyzes H2O2 to oxidize TMB to generate an electrochemical signal. The current response value (I, μA) and the exosome concentration (c, particles / μL) satisfy the linear equation: I = 0.0652logc + 0.2649, with a correlation coefficient R 2 =0.9956, and the detection limit was 80 particles / μL.

Images