Application of rhein in preparation of medicine for resisting iridovirus of micropterus salmoides
By adding rhein to largemouth bass feed, the problem of lack of effective drugs for largemouth bass iridovirus infection was solved, and the effects of improving survival rate, inhibiting viral expression and maintaining intestinal health were achieved, providing a safe and effective antiviral prevention and control method.
Patent Information
- Application Number
- CN202510964226.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-14
- Publication Date
- 2025-10-10
AI Technical Summary
Currently, there is a lack of effective drugs to prevent largemouth bass iridovirus (LMBV) infection. Existing vaccines and chemical drugs have problems of abuse and environmental pollution. The application of the Chinese herbal medicine rhein in aquaculture has not been reported.
Different concentrations of rhein are added to aquatic fish feed as a feed additive and medicine to improve the immune function of largemouth bass, inhibit the expression of LMBV virus in target tissues, and enhance the intestinal mucosal barrier function.
Rhein significantly improved the survival rate of largemouth bass, inhibited the expression of viruses in target tissues, reduced tissue damage, reduced mortality, and maintained intestinal health, providing an effective antiviral prevention and control measure.
Smart Images

Figure CN120754076A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of aquaculture, and particularly relates to application of rhein in preparing a drug for resisting largemouth bass iridovirus. Background Art
[0002] Since its introduction to my country in 1983, the largemouth bass (Micropterus salmoides), commonly known as the California bass, has rapidly become an important freshwater fish aquaculture species due to its rapid growth and high nutritional value. Frequent disease outbreaks have severely hampered the development of the largemouth bass aquaculture industry, with the largemouth bass ranavirus (LMBV) being one of the most serious viral pathogens. LMBV is a member of the genus Ranavirus in the family Iridoviridae. LMBV spreads rapidly in largemouth bass aquaculture, with mortality rates as high as 60%, seriously jeopardizing the healthy development of the largemouth bass aquaculture industry. Although various vaccines have been developed, including inactivated vaccines, subunit vaccines, and DNA vaccines, most remain in the laboratory evaluation stage and are not suitable for large-scale deployment. Furthermore, the overuse of feed additives such as antibiotics, chemicals, and hormones is a common problem, leading to water pollution and numerous other issues, including drug residues, that pose a serious threat to human health. Currently, there is still no effective drug to fight LMBV infection and no means to prevent and control largemouth bass iridovirus disease.
[0003] Because the immune system plays a crucial role in aquatic animals' resistance to pathogen infection and invasion, enhancing host immune function is crucial for preventing and halting disease. Currently, disease-fighting immune enhancers offer advantages such as a short development cycle, low cost, convenient application, and minimal side effects. They offer anti-infection capabilities, promote growth, and enhance immunity, holding great potential for application as feed additives in aquatic animal breeding and disease control. Among these, Chinese herbal medicines are less likely to develop drug resistance and toxic side effects, and they do not pollute the aquatic environment. They regulate body balance and physiological functions, enhance immunity, digestion and absorption, and promote growth in aquatic animals, and have recently gained significant attention in aquaculture. Rhein, a 1,8-dihydroxyanthraquinone derivative of the monoanthracene nucleus, is a major active ingredient in various traditional Chinese medicines, including rhubarb, Polygonum multiflorum, and Polygonum cuspidatum. It possesses a wide range of pharmacological effects, including anti-inflammatory, antioxidant, anti-tumor, neuroprotective, anti-aging, and antiviral properties, and has a positive impact on increasing aquaculture yields. However, research on the effects of rhein supplementation in feed on the resistance of largemouth bass to LMBV infection has been lacking. Summary of the Invention
[0004] The application aims to provide an application of rheum emodin in preparing a product for inhibiting / against LMBV.
[0005] Further, the product comprises an inhibitor, a medicine, a feed, a feed additive.
[0006] The application also aims to provide a product for preventing and treating LMBV, and the active ingredient of the product comprises rheum emodin.
[0007] Preferably, the final concentration of rheum emodin in the product is 0.005% to 0.05%.
[0008] Preferably, the final concentration of rheum emodin in the product is 0.05%.
[0009] Further, the product comprises a medicine, a feed or a feed additive.
[0010] Further, the dosage form of the medicine is injection, oral preparation or soaking preparation.
[0011] In order to achieve the above-mentioned purposes, the application adopts the following technical solutions:
[0012] The application adds rheum emodin with different concentrations into aquatic fish feed, and the rheum emodin has good in-vivo safety and no pathological damage effect on the liver and spleen of fish after feeding largemouth bass.
[0013] Meanwhile, rheum emodin also has certain effect on largemouth bass infected with LMBV virus, and research shows that rheum emodin can improve the survival rate of largemouth bass after being infected with LMBV, inhibit the expression of virus in target tissues, reduce the damage of virus-induced target tissue structure of fish, and reduce the mortality rate caused by virus infection, and the relative protection rate of LMBV is 63.5%, and rheum emodin has good effect of resisting LMBV virus infection and can be used for preparing a medicine for resisting LMBV virus infection.
[0014] In addition, adding rheum emodin in feed can also enhance the function of intestinal mucosal barrier, improve the intestinal health of largemouth bass, and can be used for preparing an anti-disease immune enhancer and a feed additive, and can be better applied in the prevention and control of LMBV.
[0015] Compared with the prior art, the application has the following beneficial effects:
[0016] This invention, for the first time, discovers and demonstrates that rhein can be used as a fish feed additive, demonstrating good in vivo safety. After feeding, it can be used as a drug to combat LMBV infection in largemouth bass. It demonstrates excellent anti-LMBV activity, improving survival rates after LMBV infection, inhibiting viral expression in target tissues, mitigating virus-induced structural damage to target tissues, and reducing mortality from viral infection. Furthermore, as an anti-disease immunopotentiator, it maintains the intestinal mucosal barrier, safeguarding the intestinal health of largemouth bass. This allows for better application in the prevention and control of iridovirus disease in largemouth bass and can be used to prepare antiviral products. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 A shows the morphology of 0.005% and 0.05% rhein added to the feed; B shows the effect of adding 0.05% rhein to the feed on the growth of largemouth bass; C shows the effect of adding 0.05% rhein to the feed on the apparent morphology of the liver and spleen of largemouth bass; D shows the effect of adding 0.05% rhein to the feed on the tissue morphology of the liver and spleen of largemouth bass.
[0018] Figure 2 A shows the effect of adding 0.005% and 0.05% rhein to the feed on the survival rate of largemouth bass injected with LMBV; B shows the apparent characteristics of each group of largemouth bass after injection with LMBV; C shows the changes in LMBV viral load in the liver, spleen and intestine of largemouth bass after adding 0.05% rhein to the feed.
[0019] Figure 3 Figures AB show the effects of adding 0.05% rhein to the feed on the apparent morphology and histomorphology of the liver and spleen of largemouth bass injected with LMBV.
[0020] Figure 4 Shown are the pathological changes in the intestine and changes in intestinal mucosal goblet cells of largemouth bass after LMBV injection when 0.05% rhein was added to the feed. DETAILED DESCRIPTION
[0021] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0022] The conventional experimental methods and experimental materials involved in the embodiments of the present invention are as follows:
[0023] 1. Rhein was purchased from Dannai Biological Co., Ltd.
[0024] 2. Virus: The virus used in the experiment was LMBV preserved in the laboratory. FHM cells were infected with LMBV, and after 3 freeze-thaw lysis, the virus was collected and stored at -80°C. The titer of the virus was determined by the median tissue culture infectious dose method (TCID 50 ) to be 2.37 x 10 8 TCID 50 / mL.
[0025] 3. Experimental fish: The largemouth bass was purchased from the Largemouth Bass Farm in Dongcheng District, Sihui, Guangzhou, China. The species was largemouth bass (Micropterus salmoides), and the fish were raised in the aquaculture system at the Nansha Huannong Fisheries Research Institute in Guangzhou. The body weight was 3-4 g, and the body length was 7.0-8.0 cm. Before the experiment, a portion of the largemouth bass was randomly selected to extract RNA from the tissue, reverse transcribed into cDNA, and PCR was used to detect the virus carrying status, thereby confirming that the largemouth bass did not carry LMBV.
[0026] 4. Experimental reagents: 4% paraformaldehyde fixing solution was purchased from Biosharp Company; dimethylbenzene, n-butanol, concentrated H2SO4, and neutral gum were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd. Anhydrous ethanol (analytical pure) was purchased from Damao Chemical Reagent Factory; phosphate buffer (PBS): weigh NaCl 8.0 g, KCl 0.2 g, Na2HPO4 1.44 g, and KH2PO4 0.24 g in 800 mL ddH2O, fully stir to dissolve with a magnetic stirrer, adjust the pH to 7.2-7.4 with concentrated HCl, and dilute to 1 L with ddH2O for use.
[0027] 5. Total RNA extraction: SV Total RNA Isolation Kit (Promega) was used to extract cell RNA, and RNA extraction was performed according to the operation manual.
[0028] 6. Real-time fluorescence quantitative PCR (qRT-PCR) was performed using 2x SYBR Green Real-time PCR Mix kit (TOYOBO, Japan) for reaction system preparation.
[0029] Example 1 Effect of rhubarb acid added in feed on the safety of largemouth bass
[0030] (1) Preparation of largemouth bass feed
[0031] ① Respectively weigh 350.00 g of largemouth bass basic feed into two vessels. Take 1.72 g and 0.172 g of rhubarb acid powder into beaker 1 and beaker 2, respectively, then add 100 mL of pure water to beaker 1 and beaker 2, respectively, and stir evenly to obtain rhubarb acid dilution 1 and rhubarb acid dilution 2.
[0032] ② Slowly add rhein dilution 1 and rhein dilution 2 into the container containing the feed, stirring evenly while adding until the feed completely absorbs the rhein solution.
[0033] ③ The mixed feed was placed in a 37°C constant temperature oven and dried to constant weight to obtain feed containing rhein with 0.005% low concentration and 0.05% high concentration added ( Figure 1 A).
[0034] (2) Effect of adding rhein to feed on the safety of largemouth bass
[0035] ① Feeding: 600 largemouth bass of uniform length and average weight of 3.25g were randomly divided into three groups, 200 in each group: a basal diet control group (Control), a 0.005% rhein supplemented group (0.005% Rhein), and a 0.05% rhein supplemented group (0.05% Rhein). The fish were fed a basal diet, a 0.005% Rhein diet, and a 0.05% Rhein diet, respectively, at 2% of their body weight, twice daily for 28 consecutive days.
[0036] ② After 28 days of feeding, 10 fish were randomly selected from the Control group and the 0.05% Rhein supplementation group to observe their apparent body shape.
[0037] ③ Then, 6 largemouth seabass were randomly selected from the control group and the 0.05% Rhein-added group, and 3 of them were selected for dissection and removal of the liver and spleen for morphological observation; the liver, spleen, and intestine of the other 3 largemouth seabass were fixed with 4% paraformaldehyde, and the fixed samples were sent to Wuhan Sewell Biotechnology Co., Ltd. for preparation of HE-stained tissue sections.
[0038] The results are as follows Figure 1 As shown in B, there was no significant difference in morphology between the control group and the 0.05% Rhein supplementation group. Further morphological analysis revealed that the liver of the control group was smooth, ruddy, and triangular in shape. The right lobe of the liver was thicker and blunt-rounded, while the left lobe was thinner and pointed with sharp edges. The liver of the 0.05% Rhein supplementation group showed no abnormalities in color, surface smoothness, or shape, and showed no significant differences from the control group. Similarly, the spleen of the 0.05% Rhein supplementation group showed no significant differences from the control group. Both groups showed a slightly darker red color than the liver, a spindle-shaped sesame-sized ( Figure 1 C). Combined with the results of tissue HE staining, it was shown that adding 0.05% rhein to the feed had no pathological damage to the liver and spleen of largemouth bass ( Figure 1 D) This indicates that feeding feed containing 0.05% rhein is safe for fish.
[0039] Example 2 Effect of adding rhein to feed on the resistance of largemouth bass to LMBV infection
[0040] (1) Experimental treatment:
[0041] Rhein was added to the feed and fed to largemouth bass according to the feeding method of step 2 of Example 1. The fish were divided into a basal feed control group, a 0.005% rhein supplemented group (0.005% Rhein), and a 0.05% rhein supplemented group (0.05% Rhein). The feeding was continued for 28 days.
[0042] (2) Mortality of largemouth bass infected with LMBV:
[0043] Thirty largemouth bass in each group were injected intraperitoneally with 100 μL of LMBV virus (5×10 4.375 TCID 50 ), and 30 healthy, untreated largemouth bass were intraperitoneally injected with 100 μL of sterile PBS buffer as a negative control. The fish were observed for 14 days, and the number of largemouth bass deaths in each group was recorded, and the survival rate was calculated.
[0044] (3) Histopathology of largemouth bass infected with LMBV:
[0045] Thirty largemouth sea bass in each group were intraperitoneally injected with LMBV according to the above dose. The clinical symptoms of largemouth sea bass were observed after infection. During the peak period of disease, liver and spleen tissues of three fish were randomly collected from each group for HE staining analysis.
[0046] (4) Expression of viral genes in tissues of LMBV-infected largemouth bass:
[0047] The liver, spleen and intestine of 9 fish were randomly collected from each group infected with LMBV. The single tissues of 3 fish were mixed into one sample, and each group had three samples. The total RNA of tissue was extracted using Animal Total RNA Isolation Kit (Foregene) according to the instructions. cDNA template was obtained by reverse transcription using qPCRRT Kit (TOYOBO). Fluorescence quantitative PCR was used to detect the transcriptional expression of the viral gene major capsid protein (MCP) in infected tissues.
[0048] The fluorescent quantitative PCR was performed using 2x SYBR Green Real-time PCR Mix kit (TOYOBO), and the PCR reaction was performed on Applied Biosystems QuantStudio 5 fluorescent quantitative PCR instrument (Thermo, USA), and the reaction conditions were as follows: 95℃, 1min; 95℃, 5s; 60℃, 15s; 72℃, 45s; 40 cycles. β-actin was used as an internal reference, and the data represented the average value ± standard deviation of three repeated experiments. The primers of the internal reference and the virus gene were as follows:
[0049] MsF-β-actin-RT-F (SEQ ID NO. 1): CCACCACAGCCGAGAGGGAA;
[0050] MsF-β-actin-RT-R (SEQ ID NO. 2): TCATGGTGGATGGGGCCAGG;
[0051] LMBV-MCP-RT-F (SEQ ID NO. 3): CTCGCCACTTATGACAGCCTTGAC;
[0052] LMBV-MCP-RT-R (SEQ ID NO. 4): AACCCACGGGATAATGCTCTTTGAC;
[0053] The cumulative mortality rate of each group of fish infected with LMBV is shown in Figure 2 A, it is found that the survival rate of largemouth bass infected with LMBV after feeding with basic feed is 16.7%, while the survival rate of largemouth bass infected with LMBV in 0.005% Rhein group and 0.05% Rhein group is increased to 70.0% and 60.0% respectively, and the relative protection rates are 63.5% and 51.4% respectively.
[0054] The morphology of largemouth bass infected with LMBV is shown in Figure 2 B, compared with healthy largemouth bass, the body color of largemouth bass infected with LMBV is black, and the abdomen is red and swollen; while the body color of largemouth bass in 0.05% Rhein group is yellow, but the abdomen is not red and swollen.
[0055] The results of fluorescent quantitative PCR are shown in Figure 2 C, it is found that the transcriptional expression of virus MCP gene in 0.05% Rhein group infected tissue is significantly reduced compared with LMBV infected tissue in basic feed control group, which indicates that the addition of 0.05% Rhein in feed can inhibit the expression of virus gene in infected largemouth bass tissue, and reduce the mortality rate caused by virus infection.
[0056] Tissue phenotypes of largemouth bass infected with LMBV Figure 3 As shown in A, the LMBV-infected largemouth bass in the basic feed control group showed severe pathological changes, manifested as pale liver and enlarged spleen. However, the liver and spleen of the largemouth bass infected with 0.05% Rhein group showed no obvious pathological changes. In addition, the results of HE staining Figure 3 B shows that LMBV-infected largemouth bass in the basal diet control group exhibited significant pathological changes in both liver and spleen tissues. Hepatocyte atrophy, dense cytoplasm, and increased basophilia were observed. Cell membranes were incomplete, and some hepatocytes were necrotic. Splenic cells were necrotic, with localized necrotic foci. In contrast, liver cells in the 0.05% Rhein group showed intact cytoplasmic contents and virtually no basophilia. The white pulp of the spleen was relatively intact, with a clear demarcation from the red pulp. This suggests that adding 0.05% rhein to the diet can mitigate virus-induced damage to target tissue structures in fish.
[0057] Example 3 Effect of Adding Rhein to Feed on Intestinal Structure of Largemouth Bass
[0058] The intestines of the largemouth bass from the uninfected control group and the 0.05% Rhein group, as well as the LMBV-infected group and the 0.05% Rhein+LMBV-infected group in Example 2, were collected and sent to Wuhan Sewell Biotechnology Co., Ltd. for HE and AB-PAS stained tissue sections to observe the structure of the intestinal tissue.
[0059] HE staining observation results, such as Figure 4 As shown, compared with the control group, 0.05% Rhein treatment significantly increased the length and width of the intestinal villi and the thickness of the mucosal and muscularis layers in largemouth bass. Intestinal epithelial cells in the LMBV-infected group were extensively necrotic and sloughed, and the lamina propria and basal mucosal cells in the intestinal lumen were necrotic and sparsely arranged. In contrast, in the LMBV-infected group supplemented with 0.05% Rhein, the intestinal epithelial cells were relatively intact, with the lamina propria and muscularis mucosa structure normal and densely and orderly arranged. Further AB-PAS staining revealed that 0.05% Rhein treatment significantly promoted the proliferation of intestinal goblet cells compared with the uninfected control group. The sharp decrease in goblet cells caused by LMBV infection was partially reversed by 0.05% Rhein. This suggests that dietary supplementation with 0.05% Rhein can protect the intestinal mucosal morphology and maintain the intestinal mucosal barrier function of largemouth bass induced by LMBV infection.
[0060] In summary, the rhein provided by the present invention has good in vivo safety as a fish feed additive. After feeding, it can be used as a drug to resist LMBV viral infection. It has excellent anti-LMBV viral infection effects, can improve the survival rate of largemouth bass infected with LMBV, inhibit viral expression in target tissues, reduce virus-induced damage to target tissue structures in fish, and reduce mortality caused by viral infection. In addition, as an anti-disease immune enhancer, it has the function of maintaining the intestinal mucosal barrier, can maintain the intestinal health of largemouth bass, and can be better applied to the prevention and control of largemouth bass iridovirus disease.
[0061] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. Application of rhein in the preparation of products for inhibiting / resisting largemouth bass iridovirus.
2. The use according to claim 1, characterized in that The products include inhibitors, medicines, feeds, and feed additives.
3. The use according to claim 1, characterized in that The final concentration of rhein in the product is 0.005% to 0.05%.
4. The use according to claim 1, characterized in that The final concentration of rhein in the product was 0.05%.
5. A product for preventing and treating iridovirus disease of largemouth bass, characterized in that: The active ingredient of the product includes rhein.
6. The product according to claim 5, characterized in that The final concentration of rhein in the product is 0.005% to 0.05%.
7. The product according to claim 5, characterized in that The final concentration of rhein in the product was 0.05%.
8. The product according to claim 5, characterized in that The products include medicines, feeds or feed additives.
9. The product according to claim 5, characterized in that The dosage form of the medicine is injection, oral preparation or immersion preparation.