Modified immune cell, gRNA of targeted Mettl13 gene and application

Abstract

The invention provides a modified immune cell, gRNA of a targeted Mettl13 gene and application, and relates to the technical field of biology. According to the modified immune cell provided by the invention, the killing effect of the immune cell on tumor cells is enhanced by down-regulating or eliminating expression of the Mettl13 gene. The target sequence of the gRNA of the targeted Mettl13 gene provided by the invention is shown as SEQ ID NO.12, or is a reverse complementary sequence of the gRNA, has the advantage of high editing efficiency, and opens up a new way for immunotherapy.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a modified immune cell, a gRNA targeting the Mettl13 gene, and applications thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Immunotherapy has revolutionized cancer treatment, yet many patients experience poor responses, primarily due to functional inactivation of tumor-infiltrating lymphocytes (TILs). Epigenetic abnormalities are considered a major contributor to TIL dysfunction in the tumor microenvironment. Immune cells play a crucial role in the immune control of cancer, infectious diseases, and autoimmunity. For example, CD8+ T cells, a type of cytotoxic immune cell, exert anti-tumor immunity by directly killing tumor cells. Activation of antigen-specific CD8+ T cells is initiated by the T cell receptor (TCR) recognizing cognate antigens presented by major histocompatibility complex (MHC) class I (MHC-I), leading to T cell proliferation, cytokine production, and target cell killing. T cell deficiencies can lead to recurrent infection or cancer, while overactivation of CD8+ T cells can lead to immunopathology and autoimmunity. CD8+ T cells have become a key focus of new cancer therapeutics. Approved immune checkpoint inhibitors enhance the anti-tumor response of CD8+ T cells by neutralizing CTLA-4 or PD-1 / PD-L1. These drugs are effective across a variety of oncology indications, either as monotherapy or in combination with other therapies.

[0004] Cell therapy using immune cells with chimeric antigen receptors (CARs) has demonstrated clinical success in treating tumors. However, a large proportion of patients remain unresponsive to currently approved therapies or experience undesirable side effects. The discovery of previously unknown genes that regulate immune cell function could open up different avenues for immunotherapy.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The first objective of the present invention is to provide a modified immune cell to further enhance its ability to kill tumors. The second objective of the present invention is to provide a method for preparing the modified immune cell and related products used in the preparation method to improve the efficiency of preparing the modified immune cell. The present invention also aims to provide the use of the modified immune cell and its preparation method in oncology medicine.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions: In one aspect, the present application provides an engineered immune cell, wherein Mettl13 gene expression is down-regulated or eliminated.

[0008] In some embodiments, the immune cell is selected from the group consisting of T cells, B cells, natural killer cells, granulocytes, mast cells, macrophages, tumor infiltrating lymphocytes and / or peripheral blood mononuclear cells.

[0009] In some embodiments, the engineered immune cell is a chimeric antigen receptor-expressing immune cell.

[0010] In some embodiments, the Mettl13 gene expression is down-regulated or eliminated by administering to the immune cell one or more of the following: antisense RNA, siRNA, shRNA, CRISPR / Cas system, RNA editing system ADAR, RNA-guided endonuclease, zinc finger nuclease, Mega-TAL nuclease and TALENs.

[0011] In some embodiments, the Mettl13 gene expression is down-regulated or eliminated by administering to the immune cell at least one CRISPR / Cas gene editing system for gene editing.

[0012] In some embodiments, the CRISPR / Cas gene editing system comprises at least one gRNA targeting Mettl13 gene, wherein the target sequence of the gRNA comprises at least one of the sequence set forth in SEQ ID NO. 12 and the reverse complement of SEQ ID NO. 12.

[0013] In another aspect, the present application also provides a composition for editing Mettl13 gene, comprising (i) and (ii): (i) a gRNA or a polynucleotide encoding the gRNA, wherein the target sequence of the gRNA is the sequence set forth in SEQ ID NO. 12, or the reverse complement of SEQ ID NO. 12; (ii) a Cas nuclease or a polynucleotide encoding the Cas nuclease.

[0014] In another aspect, the present application also provides a method for preparing an engineered immune cell, comprising obtaining the composition, introducing the composition into an immune cell, thereby down-regulating or eliminating Mettl13 gene expression.

[0015] In another aspect, the present application also provides a delivery system, comprising an active ingredient and a delivery carrier, wherein the active ingredient comprises the gRNA or the composition of the present application; and the delivery carrier comprises a liposome, a nanoparticle, a gene gun or an electroporation device.

[0016] On the other hand, the present invention also provides the use of the modified immune cells, or the gRNA, or the composition, or the preparation method, or the delivery system in the preparation of drugs for treating tumors.

[0017] In another aspect, the present invention also provides a drug for treating tumors, comprising the modified immune cells.

[0018] Compared with the prior art, the present invention has the following beneficial effects: The modified immune cells provided by the present invention enhance the immune cell's ability to kill tumor cells by downregulating or eliminating the expression of the Mettl13 gene. Under co-culture conditions, the ability to eliminate tumor cells is approximately three times that of the control group. It also enhances the secretion and degranulation of the cytokines IFN-γ and TNF-α in immune cells, further enhancing the immune cell's killing effect. Downregulating or eliminating the Mettl13 gene in immune cells promotes the differentiation of immune cells into memory effector subsets, while also enhancing their migration ability, increasing the number of immune cells infiltrating tumor tissue, and enhancing the killing ability of tumor-infiltrating T cells. In vivo experiments have shown that downregulating or eliminating the Mettl13 gene in immune cells can more effectively inhibit tumor growth in test animals.

[0019] The present invention uses CRISPR / Cas technology to modify the Mettl13 gene of immune cells, selectively knocking out the Mettl13 gene, and thereby obtaining immune cells that can effectively inhibit tumors.

[0020] The gRNA targeting the Mettl13 gene provided by the present invention has good targeting specificity, can effectively edit the Mettl13 gene, and can effectively knock down the expression of the Mettl13 gene. The mutant genotype carried by the constructed immune cells is highly stable and heritable.

[0021] The modified immune cell preparation method provided by the present invention is simple, effective, and low-cost. The prepared immune cells have the advantages of sustained and efficient tumor suppression effect and good safety.

[0022] Those skilled in the art will readily appreciate other aspects and advantages of the present invention from the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 Shown are the construction of OTI:Cas9-expressing mice and the detection of Mettl13 gene editing effects; Figure 2 It was shown that Mettl13 gene knockout enhanced the anti-tumor effect of CD8+ T cells in vivo; Figure 3 It was shown that Mettl13 gene knockout enhanced the anti-tumor killing activity of CD8+ T cells in vitro; Figure 4 Shown is the effect of Mettl13 gene knockout on the immune phenotype of CD8+ T cells. DETAILED DESCRIPTION

[0025] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0026] the term Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0027] Unless the context clearly dictates otherwise, as used herein, the expressions "a" and "an" include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0028] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0029] The terms "comprising" or "including" herein may be open, semi-closed or closed. In other words, the terms also include "consisting essentially of" or "consisting of."

[0030] "Optional" or "optionally" herein means that the subsequently described event or circumstance may occur but need not.

[0031] As used herein, "and / or" is used to indicate that one or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0032] As used herein, a "chimeric antigen receptor (CAR)" is a fusion protein comprising an extracellular domain capable of binding to an antigen, a transmembrane domain derived from a different polypeptide than the extracellular domain, and at least one intracellular domain. An "extracellular domain capable of binding to an antigen" refers to any oligopeptide or polypeptide capable of binding to an antigen, and an "intracellular domain" refers to any oligopeptide or polypeptide known to function as a domain that transmits signals to activate or inhibit intracellular biological processes. A "domain" refers to a region of a polypeptide that is independent of other regions and folds into a specific structure.

[0033] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. Polynucleotide encoding may alternatively encode a sense strand or an antisense strand. Polynucleotides may be naturally occurring, synthetic, recombinant, or any combination thereof.

[0034] Mettl13 (also known as eEF1A-KNMT or FEAT) is a dual-specificity methyltransferase that targets both the N-terminus and lysine 55 (Lys55) of eukaryotic translation elongation factor 1α (eEF1A). By catalyzing the methylation of eEF1A, it influences translational dynamics, including the overall rate of protein synthesis and the efficiency of translation at specific codons.

[0035] Modified immune cells In one aspect, the present invention provides a modified immune cell in which the expression of the Mettl13 gene is downregulated or eliminated.

[0036] In some embodiments, the immune cell is selected from T cells, B cells, natural killer cells, granulocytes, mast cells, macrophages, tumor infiltrating lymphocytes, and / or peripheral blood mononuclear cells.

[0037] In some embodiments, the expression of the Mettl13 gene is downregulated or eliminated by administering one or more of the following substances to the immune cells: antisense RNA, siRNA, shRNA, CRISPR / Cas system, RNA editing system ADAR, RNA-guided nuclease, zinc finger protease, Mega-TAL nuclease and TALENs.

[0038] In some embodiments, the Mettl13 gene expression is down-regulated or eliminated by gene editing with at least one CRISPR / Cas gene editing system. The CRISPR / Cas9 system can cut double-stranded DNA in vitro, and the Cas9 protein can be delivered to human primary cells to effectively knock out the target gene.

[0039] In some embodiments, the immune cells are selected from the group consisting of T cells, B cells, natural killer (NK) cells, granulocytes, granulocytes in particular selected from the group consisting of neutrophils, eosinophils and / or basophils, mast cells, tumor infiltrating (TIL) lymphocytes and / or peripheral blood mononuclear cells.

[0040] In some embodiments, the source of the immune cells comprises allogeneic and autologous sources.

[0041] In some embodiments, the immune cells are human-derived cells.

[0042] In some embodiments, the immune cells are selected from the group consisting of CD8+ T cells.

[0043] In some embodiments, the immune cells are CAR (chimeric antigen receptor)-expressing immune cells, preferably CAR-expressing T cells (CAR-T) cells, further preferably CAR-expressing CD8+ T cells.

[0044] The present application does not limit the structure of the chimeric antigen receptor in the CAR-expressing immune cells. For the extracellular domain capable of binding to the antigen, the transmembrane domain and the intracellular domain in the chimeric antigen receptor, the person skilled in the art can select them according to the methods described in the known textbooks, references, process manuals, product instructions and standard documents, and the present application does not limit them.

[0045] The structure of an exemplary CAR is as follows: the extracellular domain is composed of a single-chain variable fragment (scFv) that recognizes and binds to an antigen and a hinge region (Hinge). The single-chain variable fragment determines the specificity and function of the immune cell expressing the CAR, and the hinge region connects the single-chain variable fragment and the transmembrane domain, an exemplary hinge region is derived from the hinge of IgG or the extracellular region of CD8a / CD28. The transmembrane domain connects the extracellular domain of the CAR with the intracellular signal transduction domain. An exemplary transmembrane domain is derived from CD4, CD8, CD28 and CD3 zeta or their derivatives. The intracellular domain contains a signal transduction domain, or is jointly composed of a costimulatory domain and a signal transduction domain. An exemplary costimulatory domain is from the CD28 receptor family (CD28, ICOS) or the tumor necrosis factor receptor family (4-1BB, OX40, CD27). An exemplary signal transduction domain is the T cell receptor TCR / CD3 zeta chain or the immunoglobulin Fc receptor Fc epsilon R1 gamma chain.

[0046] In some embodiments, the immune cells expressing CARs target points include, but are not limited to, PSMA, CD19, CD20, CD22, CD23, CD30, CD33, CD38, CD44v6, CD56, CD70, CD117, CD123, CD138, CD319 (CS1, SLAMF7), CD371 (CLL-1), BCMA, BAFF-R, FLT-3, FR beta, IL1RAP, LMP1, ROR1, PSMA, FAP, EGFRvIII, CEA, CD171, GD2, Glypican-3, HER2, IL-13, Claudin, FR alpha, L1-CAM, CAIX, CD56, CD70, NKG2D, AFP, AXL, c-MET, DLL-3, DR5, EpHA2, gp100, MAGE A1, MAGE A3, MAGE A4, MUC1, CD25, PD-1, PD-L1, PD-L2, CTLA-4, immunoglobulin receptor (KIR), LAG-3, TIM-3, 4-1BB, 4-1BBL, GITR, CD40, CD40L, OX40, OX40L, CXCR2, B7-H3, B7-H4, BTLA, HVEM, CD28, A2aR, CD27, TCRICOS, CD80, CD86, ICOS-L, Gal-9, VISTA, CD137, CD155, CD266, PVR, PVR-2, CD47, CD160, NT5E, CD96 and TNFRSF18.

[0047] In some embodiments, the CAR-expressing immune cell targets prostate-specific membrane antigen, and its chimeric antigen receptor contains a PSMA (prostrate specific membrane antigen) binding domain (PSMA-CAR).

[0048] CRISPR-Cas system targeting the Mettl13 gene In one aspect, the present invention provides a CRISPR / Cas gene editing system targeting the Mettl13 gene, comprising at least one guide RNA (gRNA) targeting the METTL13 gene.

[0049] The guide RNA of the present invention may include a single-stranded guide RNA (sgRNA) or a double-stranded guide RNA consisting of crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). In some embodiments, the guide RNA is a double-stranded structure consisting of a crRNA and a tracrRNA. The crRNA generally contains a guide sequence and a tracr partner sequence, and the tracrRNA generally contains a tracr sequence.

[0050] In some embodiments, the guide RNA can be a single-stranded molecule that can include a guide sequence, a tracr partner sequence, and a tracr sequence. This single-stranded molecule is also referred to as a chimeric single-stranded guide RNA (sgRNA). When the tracr sequence and the tracr partner sequence are contained in a single transcript, hybridization between the two produces a transcript with a secondary structure (such as a hairpin). The sequence used in the hairpin structure can be a loop-forming sequence, for example, a sequence that can be four nucleotides in length. For example, the sequence used in the hairpin structure can have a sequence of the sequence GAAA. Longer or shorter loop sequences can also be used, such as alternative sequences. In some cases, these sequences can include triplets (e.g., AAA), as well as other nucleotides (e.g., C or G). Examples of loop-forming sequences can include CAAA and AAAG. In some cases, the transcript or transcribed polynucleotide sequence can have at least two or more hairpins. In some specific cases, the transcript can have two, three, four, or five hairpins. In other cases, the transcript can have up to five hairpins.

[0051] In some embodiments, the tracrRNA sequence is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 9).

[0052] In some embodiments, the target sequence of the gRNA includes at least one of the sequence shown in SEQ ID NO.12 and the reverse complementary sequence of SEQ ID NO.12.

[0053] Composition for editing the Mettl13 gene In one aspect, the present invention provides a composition for editing the Mettl13 gene, comprising: (i) a gRNA or a polynucleotide encoding the gRNA, wherein the target sequence of the gRNA is the sequence shown in SEQ ID NO. 12, or the reverse complementary sequence of SEQ ID NO. 12; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0054] In some embodiments, the Cas nuclease refers to a Cas nuclease that can bind to a target sequence, or cut or nick a target sequence, or mutate a target sequence. The Cas nuclease includes but is not limited to a natural Cas nuclease or a polypeptide or complex containing the main functional domain of a Cas nuclease; or a mutated Cas nuclease or polypeptide; or a fusion protein containing a Cas nuclease or a Cas nuclease functional domain fused with other functional domains. The Cas nuclease includes but is not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or a protein, polypeptide or complex obtained by mutating the above Cas nucleases and / or fusion with other functional domains. In some embodiments, examples of the functional domain that can be fused to the Cas nuclease include but are not limited to an epitope tag, a reporter gene, and a protein domain having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.

[0055] Immune cell preparation In one aspect, the present invention also provides a method for preparing the above-mentioned modified immune cells, comprising obtaining the above-mentioned composition for editing the Mettl13 gene, introducing the composition into immune cells, thereby downregulating or eliminating the expression of the Mettl13 gene. In the preparation method, the composition for editing the Mettl13 gene can be introduced into the immune cells by any conventional method known in the art, such as, but not limited to, liposome introduction, nanoparticle delivery, vector, transfection, heat shock, electrofection, transduction, gene gun, or microinjection. In an optional embodiment, the composition for editing the Mettl13 gene includes an RNP complex formed by a Cas nuclease and a gRNA, which is introduced into the immune cell to be edited by electrofection.

[0056] deliver In one aspect, the present invention also provides a delivery system, comprising an active ingredient and a delivery vector, wherein the active ingredient comprises the above-mentioned gRNA targeting the Mettl13 gene, or the above-mentioned composition for editing the Mettl13 gene, and the delivery vector comprises a liposome, a nanoparticle, a gene gun, or an electroporation device.

[0057] Pharmaceutical compositions, methods and uses In one aspect, the present invention also provides a drug for treating tumors, comprising the modified immune cells described above. In an optional embodiment, the drug for treating tumors further comprises a pharmaceutically acceptable excipient. The excipient includes, but is not limited to, one or a combination of carriers, diluents, buffers, protective agents, stabilizers, adsorbents, matrices, and excipients.

[0058] On the other hand, the present invention also provides the above-mentioned modified immune cells, or the above-mentioned gRNA targeting the Mettl13 gene, or the above-mentioned composition for editing the Mettl13 gene, or the preparation method of the above-mentioned modified immune cells, or the use of the above-mentioned delivery system in the preparation of drugs for treating tumors.

[0059] The concept of the present application is to improve the killing power of immune cells by inhibiting Mettl13 gene expression, so the types of tumors that can be killed by immune cells are all the objects that can be treated by the tumor treating drugs described herein. Examples of the tumor treating drugs in any of the above aspects include, but are not limited to, hematological tumors, solid tumors, or a combination thereof. Hematological tumors include, but are not limited to, acute myeloid leukemia (AML), multiple myeloma (MM), chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), diffuse large B-cell lymphoma (DLBCL), or a combination thereof. Solid tumors include, but are not limited to, prostate cancer, liver cancer, head and neck cancer, melanoma, non-Hodgkin's lymphoma, bladder cancer, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, osteosarcoma, cholangiocarcinoma, ovarian cancer, gastric cancer, bladder cancer, meningioma, pancreatic cancer, multiple squamous cell carcinoma, esophageal cancer, small cell lung cancer, colorectal cancer, breast cancer, medulloblastoma, breast cancer, or a combination thereof. When the modified immune cells are CAR-expressing immune cells, the tumor treating drugs are more suitable for tumor types that have corresponding tumor markers that can be bound by the antigen binding site in the chimeric antigen receptor in the immune cells. For example, in some embodiments, the modified immune cells are cells expressing a chimeric antigen receptor that binds PSMA, which can be used in the preparation of a drug for treating prostate tumors.

[0060] The present application is further illustrated by the following specific examples, but it is understood that these examples are merely for the purpose of illustrating in more detail and should not be construed as limiting the present application in any manner.

[0061] Examples Example 1 Construction of OTI:Cas9 mice and detection of target gene editing efficiency Construction and identification of OTI:Cas9 mice Figure 1 In Example A, CD8+T cells were isolated from the spleen of 6-8 week old OTI:Cas9 mice, activated in vitro for 3 days, and then the activated CD8+T cells were transfected with lentivirus lenti-Mettl13 for 72 h, followed by detection of editing efficiency by sanger sequencing Figure 1 In Example B, the expression of Mettl13 at the transcriptional and translational levels was detected by qPCR and western blot Figure 1 In Examples C and D, the results showed that sgRNA targeting Mettl13 could effectively edit the Mettl13 gene.

[0062] The details are as follows: 1. Construction of OTI:Cas9 mice Rosa26-Cas9 transgenic mice were crossed with OT-I mice to construct OT-I:Cas9 expressing mice. The OTI:Cas9 expressing mice were screened by PCR using the following primers (Table 1).

[0063] Table 1 PCR detection primers

[0064] 2. Isolation and culture of murine CD8+T cells The spleen of OT-I:Cas9 mice was placed in pre-cooled PBS solution containing 2% FBS (FBS was purchased from Sigma, and PBS was purchased from GIBCO). The spleen was ground through a 100 pm cell strainer to prepare a single cell suspension. Then, the cells were treated with ACK lysis buffer (Lonza) for 5 minutes at room temperature to lyse the red blood cells, and then washed with 2% FBS. The lymphocytes were further filtered through a 40 pm strainer and resuspended using MACS buffer (PBS containing 0.5% BSA and 2 mM EDTA). Next, the naive CD8+T cells were isolated using a mouse CD8+naive T cell isolation kit (BioLegend). Finally, the cells were resuspended in cRPMI-1640 medium at a final concentration of 1 x 10 6 cells / mL. Among them, the cRPMI-1640 medium formula is: RPMI-1640 medium, supplemented with 10% FBS, 2 mM L-glutamine, 100 U / mL penicillin-streptomycin (Pen / Strep), and 49 nM β-mercaptoethanol. In addition, for in vivo experiments, 2 ng / mL IL-2, 2.5 ng / mL IL-7, 50 ng / mL IL-15 and 1 pg / mL anti-CD28 antibody were additionally added to the cRPMI-1640 medium; while for in vitro experiments, 2 ng / mL IL-2, 2 ng / mL IL-12p70 and 1 pg / mL anti-CD28 antibody were added to the cRPMI-1640 medium. All cells were cultured in culture plates pre-coated with 5 pg / mL anti-CD3 antibody.

[0065] 3. sgRNA design sgRNA targeting sequences were designed according to the Mettl13 gene, PD-1 gene (positive control), and non-targeting control (NTC), and the tracrRNA sequence is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 9).

[0066] The sgRNA structure is 5'-targeting sequence+tracrRNA sequence-3'.

[0067] Table 2. sgRNA targeting sequences

[0068] 4. Construction of single-gene LentiGuide-Puro-sgRNA lentiviral vector To successfully synthesize primer pairs complementary to the sgRNA sequence, a specific base sequence, 5'-CACCG-3', is added to the 5' end of the forward primer. However, if the first base of the sgRNA forward sequence is a G, this additional G is not required. Furthermore, a 5'-AAAC-3' sequence is added to the 5' end of the reverse primer. However, if the last base of the reverse sequence is a C, this additional C is not required. This design ensures that the two primers will form double-stranded DNA fragments with sticky ends after annealing. Next, these DNA fragments with specific sticky ends were ligated to the sticky ends of the lentiviral vector LentiGuide-Puro (Addgene, #52963), which had been previously digested with BsmBI, using DNA ligase to construct recombinant plasmids. These lentiviral vectors, lenti-sgMettl13, lenti-sgPD-1, and lenti-sgNTC, expressing the respective sgRNAs, were generated.

[0069] 5. Preparation of Lentivirus 1) Virus Preparation: Lentivirus was prepared by co-transfecting the lentiviral plasmids LentiGuide-Puro (Addgene, #52963), psPAX2 (Addgene, #12260), and pMD2.G (Addgene, #12259) containing the target gene (target gene: Mettl13; positive control: PD-1; NTC: non-targeting control) into HEK293T cells grown in 10 cm dishes at approximately 80% confluence. Viral supernatants were collected 48 hours after transfection and filtered through a 0.45 μm filter (Corning) to remove cellular debris. Subsequently, the supernatant was concentrated by centrifugation at 20,000 rpm for 2.5 hours at 4°C. Lentiviral particles were again concentrated by centrifugation at 20,000 rpm under the same conditions. Finally, the lentiviral particles were resuspended in serum-free RPMI 1640 medium (1 / 100 of the original volume) and stored at -80°C until use.

[0070] 2) Lentiviral infection of cells: Add concentrated virus to CD8+ T cells activated in vitro for 48 hours at a ratio of 1:200. Incubate at 37°C for 48 hours, then replace with fresh medium and continue culturing.

[0071] 6. Detection of Mettl13 gene editing efficiency The upstream and downstream primers Mettl13 check-F (SEQ ID NO.10) and Mettl13 check-R (SEQ ID NO.11) for detection were designed according to the corresponding editing positions of the genome, and PCR detection was performed using the above primers.

[0072] After Sanger sequencing of the PCR products and analysis of the editing efficiency, it was found that the cutting efficiency mediated by Mettl13-sgRNA was approximately 96% ( Figure 1 The expression of Mettl13 mRNA and protein in Mettl13-down-CAR-T cells was analyzed by quantitative PCR and Western blot ( Figure 1 ), Mettl13 mRNA and protein expression in Mettl13-down-CAR-T cells was significantly reduced. qPCR primers are shown in Table 3.

[0073] Table 3 qPCR primers

[0074] Example 2: Mettl13 KO enhances the anti-tumor effect of CD8+ T cells in vivo 6-8 week old Rag1- / - immunodeficient mice (GemPharmatech, #T004753) were used in this example, all mice were housed in standard individually ventilated, pathogen-free barrier facilities, mice were euthanized using carbon dioxide at the time of sacrifice, and used for experiments according to procedures approved by the Animal Care and Use Committee of East China Normal University.

[0075] To explore the role of Mettl13 in CD8+ T cells in tumor immune response, the key molecule Pdcd1 (programmed cell death protein 1) in tumor immunotherapy was selected as a positive control to verify the reliability of the experimental system. And the lentiviral vectors expressing sgNTC (non-targeting control), sgPdcd1 and sgMettl13 constructed in Example 1 were prepared. The specific test steps are as follows: First, the GFP-OVA cell line was constructed, and B16 mouse melanoma cells were transduced with lentivirus expressing GFP-OVA. On the 3rd day after transduction, the transduced B16 cells were cultured in 96-well plates by resuspending the cells to 10 cells / mL and culturing 100 μL of cell suspension in each well. After 2 weeks, the cloned B16-GFP clones were identified by fluorescence microscopy. The B16-GFP clones were stained with anti-mouse SIINFEKL:H-2Kb antibody to determine OVA expression.

[0076] 2 × 10 6 B16-OVA-GFP cells were subcutaneously injected into Rag1 − / − mice. Ten days after transplantation, the CD8+ T cells infected with lentivirus obtained in Example 1 were intravenously injected into tumor-bearing Rag1 − / − mice. After 7 days, lymph nodes, spleen and tumor samples were collected and DNA extraction or flow cytometry analysis was performed. The spleen and lymph nodes were ground to prepare a single cell suspension. The tumor was broken into small pieces, about the size of a small soybean, and digested with 0.5 mg / mL collagenase IV (Yeasen) and 200 IU / mL DNase I (Yeasen) at 37°C for 1 h. Then the cell suspension was filtered through a 70 μM filter to remove large volume cell clumps, tissue fragments or impurities before staining. To test the percentage of TIL in the tumor, the tumor suspension was stained with anti-mouse CD8 antibody on ice for 30 min, and analyzed by flow cytometry (BD). Each mouse was subcutaneously inoculated with 2 × 10 6A tumor-bearing model was established using B16-GFP-OVA cells. When tumors became palpable, mice with similar tumor sizes were selected by measurement and randomly divided into four groups (no fewer than five mice per group). For in vivo experiments, the culture medium of OT-I;Cas9CD8+ T cells activated in vitro with CD3 / CD28 antibodies should be supplemented with 2 ng / mL IL-2, 2.5 ng / mL IL-7, 50 ng / mL IL-15, and 1 μg / mL anti-CD28 antibody.

[0077] The prepared sgNTC, sgPdcd1 and sgMettl13 lentiviruses were used to infect the cells respectively, and the positive cells were selected by using puromycin. 6 Virus-infected T cells were intravenously injected into tumor-bearing Rag1 − / − Mice. Tumor size was measured with calipers once or twice weekly. Six weeks after adoptive transfer, tumors and spleens were dissected for flow cytometry analysis.

[0078] After screening, these edited T cells were adoptively infused into the corresponding group of tumor-bearing mice via intravenous injection. At the same time, tumor-bearing mice injected with only an equal volume of PBS were set up as a negative control group ( Figure 2 Middle A).

[0079] Tumor size was measured with a caliper once or twice a week to ensure compliance with ethical standards. Mice were sacrificed before tumor growth reached the upper limit of ethical standards, and tumors and spleens were collected to prepare single-cell suspensions. Compared with the sgNTC control group, the tumor growth inhibition effect of mice in the sgMettl13 group was more significant. The tumor volumes of mice in the sgMettl13 and sgPdcd1 groups were significantly lower than those in the sgNTC control group ( Figure 2 The tumor weights measured at the time of sacrifice showed that the tumor weights of mice in the sgMettl13 and sgPdcd1 groups were significantly lower than those in the sgNTC control group ( Figure 2 Middle C).

[0080] Six weeks after adoptive transfer, tumors and spleens were dissected for flow cytometry analysis. To analyze surface markers, cells were incubated and stained with anti-mouse CD8a (BioLegend, Cat#100706) in PBS (Gibco) containing 2% (w / v) BSA (Sigma) for 30 minutes at 4°C. Flow cytometry was then performed, and the distribution of OT-I:Cas9 CD8⁺ T cells in the spleen and tumor after different gene editing was analyzed using FlowJo software. The results are shown in Figure 2. Figure 2 As shown, compared with the control group, the proportion of CD8+ T cell infiltration in the spleen and tumor of mice in the sgMettl13 group and sgPdcd1 group was significantly increased.

[0081] Flow analysis further showed that the proportion of CD8+ T cell infiltration in the spleen and tumor of sgMettl13 group and sgPdcd1 group mice was significantly higher than that of sgNTC control group (Fig. 4C-D). Figure 2 This indicates that targeting these genes not only helps immune reconstruction, but also enhances the anti-tumor function of CD8+ T cells.

[0082] Example 3 Mettl13 KO enhances anti-tumor killing activity of CD8+ T cells in vitro To detect the anti-tumor activity of CD8+ T cells after Mettl13 gene knockout (KO), this embodiment carried out in vitro co-culture experiment. When B16-OVA-GFP cells were grown to 80% confluence in 10% FBS, 100 U / mL Pen / Strep RPMI-1640 medium, they were replated in 24-well plates at a density of 5x10 5 cells / mL. Subsequently, murine Mettl13 KO or control T cells cultured in cRPMI-1640 medium containing 2 ng / mL IL-2, 2 ng / mL IL-12p70 and 1 μg / mL anti-CD28 antibody were inoculated in the above 24-well plates at a density of 5x10 5 cells / mL at a ratio of 1:1, respectively.

[0083] After 6-8 hours of co-culture, T cells were collected for detection of surface markers such as CD107a, cells were incubated with anti-mouse CD107a (BioLegend, Cat#121611) staining in PBS (Gibco) containing 2% (w / v) BSA (Sigma), 4 degrees for 30 minutes. To detect intracellular markers such as GZMB, IFN-γ and TNF-α, add fixation / breaking reagent kit fixation working solution to the cell suspension, vortex the cells and incubate at room temperature for 30 min. Then resuspend with 100 μL of 1X breaking solution containing anti-mouse GzmB (BioLegend, Cat#396413), anti-mouse TNFα (BioLegend, Cat#506303) and anti-mouse IFNγ (BioLegend, Cat#505829) 2 mL of 1X breaking solution for breaking membrane treatment, after centrifugation at 500 g for 10 min, the cell pellet was stained at 4 degrees for 30 minutes, then detected by flow cytometry, and the expression difference of the above cell effector markers was analyzed by flowjo software. After 24 hours of co-culture, T cell killing detection was performed, and the number of tumor cells was counted using an inverted fluorescence microscope or tumor cell photographs were taken (Figure 3A). It was observed that CD8+T cells after 6-8 hours of co-culture with tumor cells, the expression of CD107a and GZMB in Mettl13 gene knockout CD8+T cells was significantly increased, which indicated that the deletion of Mettl13 gene enhanced the cytotoxic ability of CD8+T cells Figure 3 (Figure 3B and C). The significant increase of interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α) in Mettl13 KO CD8+T cells indicates that targeting Mettl13 gene editing can enhance the anti-tumor effect of CD8+T cells Figure 3 (Figure 3D and E). In addition, it was also observed that the GFP fluorescence of B16-OVA-GFP cells co-cultured with Mettl13 KO CD8+T cells was significantly weaker than that of B16-OVA-GFP cells co-cultured with NTC control group CD8+T cells, about 3 times difference Figure 3 (Figure 3F). These results indicate that the deletion of Mettl13 gene in TCR-specific CD8 cells can enhance the antigen-specific anti-tumor effect in vitro by promoting the secretion of GZMB, IFNγ and its cytotoxicity. Example 4 Effect of Mettl13 KO on the immunological characteristics of CD8+T cells To further investigate the effect of Mettl13 KO on the immunological characteristics of CD8+ T cells, T cells were isolated from the spleen of OTI:Cas9 mice and generated using the method of Example 1. In vitro cell activation, proliferation, migration, and differentiation assays were performed under B16-OVA-GFP cell stimulation. Figure 4 ). The cells were incubated and stained with anti-mouse CD69 (BioLegend, Cat#104508), anti-mouse PD1 (BioLegend, Cat#135207), anti-mouse LAG3 (BioLegend, Cat#125209), anti-mouse Cx3CR1 (BioLegend, Cat#149047), anti-mouse CD44 (BioLegend, Cat#103008) and anti-mouse CD62L (BioLegend, Cat#161211) in PBS (Gibco) containing 2% (w / v) BSA (Sigma) for 30 minutes at 4°C. The cells were then analyzed by flow cytometry and the expression levels of these markers were analyzed using flowjo software. It was found that after Mettl13 KO, the expression of CD69 (an activation marker on the surface of CD8+ T cells) was significantly upregulated ( Figure 4 The expression of Pdcd1 and Lag3, markers associated with intrinsic T cell activation, also increased significantly (Figure 4B and C). The expression level of CX3CR1, a chemokine receptor closely associated with T cell motility and migration, also increased. These results indicate that Mettl13 gene knockout significantly enhanced the tissue infiltration and migration ability of CD8+ T cells ( Figure 4 At the same time, flow cytometry analysis revealed significant changes in the distribution of CD8+ T cell subsets in Mettl13 KO cells. The proportions of the CD62L+CD44- naive subset (TN) and the CD62L+CD44+ central memory T cell (TCM) subset were significantly reduced, while the proportion of the CD62L-CD44+ effector memory T cell (TEM) subset was significantly increased, indicating that the Mettl13 gene plays a key role in regulating the CD8+ T cell differentiation pathway ( Figure 4 (E). Therefore, the Mettl13 gene is associated with T cell activation and effector function and plays a key role in regulating the function of CD8+ T cells.

[0084] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A modified immune cell, characterized in that: The expression of the Mettl13 gene in the immune cells is downregulated or eliminated.

2. The modified immune cell according to claim 1, characterized in that The immune cells are selected from T cells, B cells, natural killer cells, granulocytes, mast cells, macrophages, tumor infiltrating lymphocytes and / or peripheral blood mononuclear cells; Optionally, the engineered immune cell is an immune cell expressing a chimeric antigen receptor.

3. The immune cell according to claim 1 or 2, characterized in that The Mettl13 gene expression is downregulated or eliminated by administering one or more of the following substances to the immune cells: antisense RNA, siRNA, shRNA, CRISPR / Cas system, RNA editing system ADAR, RNA-guided nuclease, zinc finger protease, Mega-TAL nuclease and TALENs; Optionally, the downregulation or elimination of Mettl13 gene expression is performed by administering at least one CRISPR / Cas gene editing system to the immune cells for gene editing.

4. The immune cell according to claim 3, wherein The CRISPR / Cas gene editing system comprises at least one gRNA targeting the Mettl13 gene, and the target sequence of the gRNA includes at least one of the sequence shown in SEQ ID NO.12 and the reverse complementary sequence of SEQ ID NO.

12.

5. A gRNA targeting the Mettl13 gene, characterized in that: The target sequence of the gRNA is the sequence shown in SEQ ID NO.12, or the reverse complementary sequence of SEQ ID NO.

12.

6. A composition for editing the Mettl13 gene, characterized in that Contains (i) and (ii): (i) a gRNA or a polynucleotide encoding the gRNA, wherein the target sequence of the gRNA is the sequence shown in SEQ ID NO. 12, or the reverse complementary sequence of SEQ ID NO. 12; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

7. The method for preparing the modified immune cells according to any one of claims 1 to 4, characterized in that: The method comprises obtaining the composition according to claim 6, and introducing the composition into immune cells, thereby downregulating or eliminating the expression of the Mettl13 gene.

8. A delivery system, characterized in that The delivery system comprises an active ingredient and a delivery vector, wherein the active ingredient comprises the gRNA according to claim 5 or the composition according to claim 6; the delivery vector comprises a liposome, a nanoparticle, a gene gun or an electroporation device.

9. Use of the modified immune cell according to any one of claims 1 to 4, or the gRNA according to claim 5, or the composition according to claim 6, or the preparation method according to claim 7, or the delivery system according to claim 8 in the preparation of a drug for treating tumors.

10. A drug for treating tumors, characterized in that: The immune cell comprises the immune cell according to any one of claims 1 to 4.

Images