Plasmid point mutation or small fragment insertion method

Abstract

The invention relates to the technical field of gene engineering, in particular to a plasmid point mutation or small fragment insertion method, which is characterized in that a specific primer is designed at a mutation or insertion site, another primer is designed in other non-target regions of a plasmid to form upstream and downstream pairing with the specific primer, and the distance between the other non-target regions and the insertion site is 500-1000bp; carrying out a first-step PCR reaction on the plasmid by using the specific primer and the other primer; a PCR reaction product is recovered, and a DNA double-chain fragment is obtained; and carrying out a second-step PCR reaction on the plasmid by taking a DNA double-chain fragment as a large primer, and recovering and digesting a PCR product, so as to convert. The method can realize 100% correct rate of plasmid point mutation or small fragment insertion, is an efficient method for plasmid point mutation or small fragment insertion, and has a good promotion effect on molecular biology.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a method for plasmid point mutation or small fragment insertion. BACKGROUND

[0002] In the prior art, plasmid point mutation and small fragment insertion mainly depend on QuikChange and its improved methods (such as QuikChange II). These methods introduce a mutation site at both ends of the full-length plasmid by designing a pair of complementary primers, and finally obtain the mutant plasmid by transforming the PCR amplified linear product after DpnI enzyme digestion of the original template. However, this method has significant limitations:

[0003] The primer design depends on long complementary sequences (usually covering the full plasmid), and the synthesis cost is high and prone to failure due to primer mismatch;

[0004] The amplification efficiency of long fragment plasmid (>5kb) is low, and non-specific mutations are easily introduced;

[0005] The success rate of small fragment insertion (such as <20bp) is low, and multiple repeated experiments are required.

[0006] Although other alternative technologies (such as Gibson assembly and CRISPR editing) can partially solve the problem, they are complex, time-consuming or dependent on special reagents. Therefore, there is an urgent need for a plasmid point editing method with good specificity, high success rate, low cost and wide applicability. SUMMARY

[0007] Therefore, the present application provides a method for plasmid point mutation or small fragment insertion to solve the problems of non-specific amplification and low success rate in the prior art when inserting small fragments into plasmids.

[0008] The technical scheme of the present application is as follows:

[0009] On the one hand, the present application provides a method for plasmid point mutation or small fragment insertion, comprising the following steps:

[0010] S1, designing a specific primer at the mutation or insertion site;

[0011] S2, designing another primer at other non-target regions of the plasmid, which forms an upstream and downstream pair with the specific primer in step S1; the other non-target region is 500-1000bp away from the insertion site;

[0012] S3, using the specific primer in step S1 and the primer in step S2 to perform a first step PCR reaction on the plasmid;

[0013] S4, recovering the PCR reaction product in step S3 to obtain a DNA double-stranded fragment;

[0014] S5. Using the double-stranded DNA fragment in step S4 as a large primer, a second PCR reaction is performed on the plasmid. The PCR product is recovered and digested with DpnI, and then directly transformed into DH5α competent cells. The plasmid containing the gap is repaired using the repair function of E. coli to complete the mutation and insertion.

[0015] Based on the above scheme, preferably, the length of the small fragment is <20 bp.

[0016] Based on the above scheme, preferably, in step S2, the other non-target regions are located upstream or downstream of the mutation or insertion site.

[0017] Based on the above scheme, preferably, in step S5, the mass ratio of double-stranded DNA fragments: plasmid in the second-step PCR reaction system is (4-6):1; further preferably, the mass ratio of double-stranded DNA fragments: plasmid is 5:1.

[0018] Based on the above scheme, preferably, the enzyme used in the PCR reaction is a high-fidelity Mix enzyme, and the enzyme used in the digestion is a DpnI enzyme.

[0019] In a second aspect, a mutant plasmid is provided, which is preferably prepared by the above-mentioned method of plasmid point mutation or small fragment insertion.

[0020] In a third aspect, a mutant strain is provided, preferably comprising the mutant plasmid described above.

[0021] In a fourth aspect, a method for point mutation of a plasmid or insertion of a small fragment as described above is provided for use in genetic engineering.

[0022] The method of plasmid point mutation or small fragment insertion of the present invention has the following beneficial effects compared with the prior art:

[0023] (1) High efficiency and high success rate: By replacing short primers with whole plasmid amplification using local amplification (500-1000bp) long fragment "primers", non-specific amplification is reduced, and the success rate is higher especially for small fragment insertion;

[0024] (2) High fidelity and low background: High fidelity PCR Mix enzyme ensures amplification accuracy (error rate <0.5×10 -6 / base); DpnI enzyme completely digests the original template, significantly improving the positive clone screening rate;

[0025] (3) Wide applicability: compatible with point mutations, single base substitutions, and short fragment insertions or deletions;

[0026] (4) Support high-throughput applications: Multiple sets of primers can be designed simultaneously to achieve multi-site editing, meeting the needs of large-scale genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 Schematic diagram of plasmid construction for point mutation or small fragment insertion method of the present invention;

[0029] Figure 2 Schematic diagram of plasmid construction for Quickchange point mutation or small fragment insertion method;

[0030] Figure 3 This is a map of the pJL1-sfGFP plasmid of the present invention;

[0031] Figure 4 This is a map of the pDAP-eGFP plasmid of the present invention;

[0032] Figure 5 This is a map of the pDONR-blue plasmid of the present invention;

[0033] Figure 6 This is a map of the pBAD-Int plasmid of the present invention;

[0034] Figure 7 This is a comparison diagram of the sequencing results of the sfGFP gene insert in Example 1;

[0035] Figure 8 This is a comparison diagram of the sequencing results of the eGFP gene insert in Example 1;

[0036] Figure 9 This is a comparison chart of the sequencing results of the Blue gene insert in Example 1;

[0037] Figure 10 This is a comparison chart of the sequencing results of the Int gene insert in Example 1;

[0038] Figure 11 This is a comparison chart of the sequencing results of the sfGFP gene insert in Comparative Example 1;

[0039] Figure 12 This is a comparison chart of the sequencing results of the eGFP gene insert in Comparative Example 1;

[0040] Figure 13 This is a comparison chart of the sequencing results of the Blue gene insert in Comparative Example 1;

[0041] Figure 14 This is a comparison chart of the sequencing results of the Int gene insert in Comparative Example 1;

[0042] Figure 15 This is a comparison diagram of the sequencing results of point mutations in the sfGFP gene in Example 2;

[0043] Figure 16 This is a comparison chart of the sequencing results of point mutation of the sfGFP gene in Comparative Example 2. DETAILED DESCRIPTION

[0044] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0045] The plasmids used in the present invention are pJL1-sfGFP, pDAP-eGFP, pDONR-blue and pBAD-Int, and the plasmid maps are as follows: Figure 3 、 4 , 5 and 6.

[0046] Example 1

[0047] The method of the present invention was used to insert 6x His fragments into the target genes sfGFP, eGFP, Blue and Int respectively.

[0048] 1. Primer design: A specific primer F / R was designed at the insertion site, and another primer U / D was designed 800 bp upstream or downstream of the insertion site. The specific sequences are shown in Table 1. U indicates that the primer is 800 bp upstream of the insertion site, and D indicates that the primer is 800 bp downstream of the insertion site.

[0049] Table 1 Primer sequence list

[0050]

[0051]

[0052] Note: The underlined part is the insertion sequence 2 and the first PCR reaction

[0053] Prepare the PCR system according to Table 2.

[0054] Table 2 PCR system table

[0055]

[0056]

[0057] Set up the PCR program according to Table 3 and perform the reaction.

[0058] Table 3 PCR reaction program

[0059]

[0060] After the reaction is completed, the next experiment can be carried out, or it can be stored at -20℃ and used within one week.

[0061] 3. Recycling fragments

[0062] First, use agarose gel electrophoresis to detect the PCR fragments, and then use the Novagen fragment recovery kit to recover the fragments (for specific operating steps, please refer to the Novagen DC301-01 product manual).

[0063] 4. Second PCR reaction

[0064] Prepare the PCR reaction system according to Table 4.

[0065] Table 4 PCR reaction system

[0066]

[0067]

[0068] Perform the PCR reaction according to the procedure in Table 5.

[0069] Table 5 PCR reaction program

[0070]

[0071] After the reaction is completed, the fragments are recovered using the Novozymes fragment recovery kit and can be used for the next experiment or stored at -20°C for use within one week.

[0072] 5. Digest the template in the PCR product

[0073] Prepare the DpnⅠ digestion system according to Table 6 and digest in a water bath at 37°C for 15 min. After the reaction is complete, proceed to the next transformation.

[0074] Table 6 DpnⅠ digestion system

[0075]

[0076] 6. Conversion

[0077] Take a DH5α competent cell, thaw it quickly, add the above digestion product, let it stand on ice for 20 minutes, heat shock at 42℃ for 90 seconds, let it stand on ice for 2 minutes, add 300μL of antibody-free LB, and recover in a 37℃ constant temperature shaker for 30 minutes. After that, spread it on LB agar plate containing kanamycin and culture it in a 37℃ constant temperature incubator overnight.

[0078] 7. Sequencing Verification

[0079] Four clones were randomly selected from each plate for Sanger sequencing, and the sequencing results were aligned with the designed map. In this example, the alignment results of sfGFP, eGFP, Blue and Int genes were as follows: Figure 7 、 8 , 9 and 10, in which A represents upstream and B represents downstream.

[0080] Comparative Example 1

[0081] The Quickchange method was used to insert 6x His fragments into the target genes sfGFP, eGFP, Blue and Int respectively.

[0082] 1. Primer design: A pair of specific primers F and R were designed at the insertion site. The specific sequences are shown in F and R in Table 1.

[0083] 2. PCR reaction

[0084] Prepare PCR reaction system according to Table 7

[0085] Table 7 PCR reaction system

[0086]

[0087] Carry out the reaction according to the PCR program in Table 3. After the reaction is completed, the next experiment can be carried out, or it can be stored at -20°C and used within one week.

[0088] 3. Recycling fragments

[0089] The same method as in Example 1 was used for recovery.

[0090] The PCR products were digested, transformed, and sequenced using the same method as in Example 1. The sequencing results were aligned with the designed map. The alignment results of sfGFP, eGFP, Blue, and Int genes in this comparative example were as follows: Figure 11 、 12 , 13 and 14.

[0091] When the method of the present invention was used to insert the 6xHis fragment into sfGFP, the sequencing accuracy of the upstream and downstream colonies was 100% ( Figure 7), all four colonies were sequenced correctly; however, when the sfGFP gene was inserted into 6xHis using the Quickchange method, the accuracy was only 25% ( Figure 11 ), 4 colonies were sequenced, only 1 was correct, and 3 introduced irrelevant sequences.

[0092] When the method of the present invention is used to insert the 6xHis fragment into eGFP, the accuracy of upstream colony sequencing is 100% ( Figure 8 Figure A in the figure), all four colonies were sequenced correctly, and the accuracy of downstream colony sequencing was 75% ( Figure 8 ), 4 colonies were sequenced, 3 were correct, and 1 was not inserted; when the Quickchange method was used to insert eGFP into 6xHis, the accuracy was 75% ( Figure 12 ), 4 colonies were sequenced, 3 were correct, and 1 had no insertion.

[0093] When the method of the present invention was used to insert the 6xHis fragment into Blue, the sequencing accuracy of the upstream and downstream colonies was 100% ( Figure 9 ), all four colonies were sequenced correctly; and when Blue was inserted into 6xHis using the Quickchange method, the accuracy was 50% ( Figure 13 ), 4 colonies were sequenced, 2 were sequenced correctly, and 2 introduced unrelated sequences.

[0094] When the method of the present invention is used to insert the 6xHis fragment into Int, the accuracy of upstream colony sequencing is 100% ( Figure 10 Figure A in the figure), all four colonies were sequenced correctly, and the accuracy of downstream colony sequencing was 75% ( Figure 10 ), 4 colonies were sequenced, 3 were completely correct, and 1 introduced an unrelated sequence; when the Quickchange method was used to insert Int into 6xHis, the accuracy rate was 75% ( Figure 14 ), 4 colonies were sequenced, 3 were correct, and 1 introduced an unrelated sequence.

[0095] In summary, the method of the present invention, combined with the design of upstream and downstream primers, can achieve 100% accuracy when inserting small fragments of plasmids, effectively improving the low accuracy problem of the Quickchange method and achieving efficient insertion of small fragments.

[0096] Example 2

[0097] The method of the present invention is used to perform Y66F point mutation on the target gene sfGFP.

[0098] 1. Primer design: A specific primer F2 / R2 was designed at the insertion site, and another primer U / D was designed 800 bp upstream or downstream of the insertion site. The specific sequences are shown in Table 8, where U indicates that the primer is 800 bp upstream of the insertion site, and D indicates that the primer is 800 bp downstream of the insertion site.

[0099] Table 8 Primer sequence list

[0100] Gene Primer sequence No. sfGFP-F2 gtaacgacgctgacttttggtgttcagtgcttt SEQ ID NO: 17 sfGFP-U tggtatctttatagtcctgtcgggtttc SEQ ID NO: 2 sfGFP-R2 aaagcactgaacaccaaaagtcagcgtcgttac SEQ ID NO: 18 sfGFP-D ccaaaaggagcctttaattgtatcggt SEQ ID NO: 4

[0101] Note: The underlined part is the insertion sequence

[0102] The same steps 2 to 6 as in Example 1 were used, followed by sequencing verification, and the sequencing results were aligned with the designed map. The alignment results of the sfGFP gene in this example are shown in FIG. Figure 15 As shown, in the figure, A represents upstream and B represents downstream.

[0103] Comparative Example 2

[0104] The target gene sfGFP was subjected to Y66F point mutation using the Quickchange method.

[0105] Primer design: A pair of specific primers F2 and R2 were designed at the mutation site. The specific sequences are shown in Table 8 for F2 and R2.

[0106] The same PCR reaction, recovery, digestion, transformation and sequencing as in Comparative Example 1 were used to align the sequencing results with the designed map. Figure 16 shown.

[0107] When the Y66F point mutation of the sfGFP gene was performed using the method of the present invention, the accuracy of upstream colony sequencing was 100% ( Figure 15 Figure A in the figure), all four colonies were sequenced correctly, and the accuracy of downstream colony sequencing was 75% ( Figure 15 ), 4 colonies were sequenced, 3 were completely correct, and 1 introduced an irrelevant sequence; and when the target gene sfGFP was subjected to the Y66F point mutation using the Quickchange method, the accuracy rate was 75% ( Figure 16 ), 3 of the 4 colonies were sequenced correctly, and 1 introduced an unrelated sequence. This shows that the method of the present invention can also achieve a 100% accuracy rate when performing point mutations, significantly improving the accuracy of gene point mutations compared to the Quickchange method.

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for plasmid point mutation or small fragment insertion, characterized in that: The following steps are involved: S1, design a specific primer at the mutation or insertion site; S2, designing another primer in other non-target regions of the plasmid to form upstream and downstream pairs with the specific primer in step S1; the other non-target regions are 500 to 1000 bp away from the insertion site; S3, using the specific primers in step S1 and the primers in step S2, performing a first PCR reaction on the plasmid; S4, recovering the PCR reaction product in step S3 to obtain double-stranded DNA fragments; S5, using the double-stranded DNA fragment in step S4 as a large primer, a second PCR reaction is performed on the plasmid. After the PCR product is recovered and digested, it can be transformed.

2. The method for plasmid point mutation or small fragment insertion according to claim 1, characterized in that: The length of the small fragment is <20 bp.

3. The method for plasmid point mutation or small fragment insertion according to claim 1, characterized in that: In step S2, the other non-target regions are located upstream or downstream of the mutation or insertion site.

4. The method for plasmid point mutation or small fragment insertion according to claim 1, characterized in that: In step S5, the mass ratio of the double-stranded DNA fragment to the plasmid in the second-step PCR reaction system is (4-6):

1.

5. The method for plasmid point mutation or small fragment insertion according to claim 1, characterized in that: The enzyme used in the PCR reaction is a high-fidelity Mix enzyme, and the enzyme used in the digestion is a DpnI enzyme.

6. A mutant plasmid, characterized in that The plasmid is prepared by the method of plasmid point mutation or small fragment insertion according to any one of claims 1 to 5.

7. A mutant strain, characterized in that Comprising the mutant plasmid according to claim 6.

8. Use of the method for plasmid point mutation or small fragment insertion according to any one of claims 1 to 5 in genetic engineering.

Images