A cartilage organoid based on a DNA-silk fibroin hybrid hydrogel sustained-release system and a preparation method and application thereof

Abstract

The application relates to a cartilage organoid based on a DNA-silk fibroin hybrid hydrogel sustained-release system and a preparation method and application thereof. The DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system after a DNA-silk fibroin hybrid hydrogel sustained-release system premixing solution is printed through a digital light processing system, wherein the DNA-silk fibroin hybrid hydrogel sustained-release system premixing solution contains DNA, silk fibroin, acrylated RGD peptide, acrylated polyethylene glycol NHS ester, glucosamine, TD-198946 and 2,4,6-trimethylbenzoyl lithium phosphate. Compared with the prior art, the glucosamine and TD-198946 introduced in the DNA-silk fibroin hybrid hydrogel sustained-release system can significantly improve the cartilage differentiation efficiency of bone marrow mesenchymal stem cells; and the application can be transplanted to a cartilage defect as a cartilage graft to promote cartilage regeneration and repair.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medical materials, and particularly relates to a cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system and a preparation method and application thereof. BACKGROUND

[0002] Osteoarthritis is a common degenerative joint disease characterized by articular cartilage degeneration and is one of the major causes of disability in adults worldwide. According to statistics, more than 500 million people worldwide suffer from osteoarthritis, which has brought huge economic burden to patients and society. The commonly used cartilage repair strategies, including microfracture, autologous cartilage transplantation, and allogeneic cartilage transplantation, have been widely used in clinical practice, but all have certain limitations and deficiencies. For example, microfracture may lead to poor defect filling and cartilage fibrosis; autologous cartilage transplantation is limited by the donor area and has the problem of donor graft incompatibility; allogeneic cartilage transplantation has the risk of immune rejection and infection, and the matching of allogeneic tissue and autologous cartilage is difficult, which may lead to uneven biomechanical load and decreased joint bearing capacity. Therefore, there is an urgent need for new technologies and means to solve the problem of cartilage repair. In recent years, researchers have carried out a lot of exploration in the use of biomaterials to repair cartilage defects. However, after simply relying on the implantation of biomaterials, a series of processes such as endogenous cell recruitment, proliferation, and matrix secretion are usually required, and the repair period is relatively long. Organoids are derived from stem cells or progenitor cells, have some key characteristics, structures, and functions of organs, and can self-renew and self-organize. Compared with biomaterials, cartilage organoids can repair cartilage defects without the need for endogenous cell recruitment and proliferation, which is expected to shorten the repair period of cartilage defects.

[0003] At present, the methods for constructing cartilage organoids mainly include scaffold-free self-organization method and biomaterial co-culture method. Compared with the scaffold-free self-organization method, the addition of biomaterials not only provides a three-dimensional network scaffold similar to the cartilage extracellular matrix for cartilage organoids, supports the proliferation of chondrocytes and maintains their physiological functions, but also regulates the structure and size of the organoids by designing biomaterials. Studies have shown that DNA-silk fibroin hybrid hydrogel microspheres modified with RGD can load bone marrow mesenchymal stem cells to successfully culture cartilage organoid precursors under 14-day chondrogenic induction. However, 14-day induction is not enough to support the complete synthesis of cartilage extracellular matrix, making it difficult to form mature cartilage organoids. In addition, long-term in vitro culture may lead to the gradual dedifferentiation of chondrocytes, presenting a fibroblast-like morphology with abnormal ECM deposition, and eventually developing into a pathological hypertrophic state. SUMMARY

[0004] In view of the problems in the prior art, the application provides a cartilage organ constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system and a preparation method and application thereof, the hydrogel sustained-release system can continuously supply drugs for promoting chondrogenic differentiation of bone marrow mesenchymal stem cells for a long time, and the cartilage organ can be more effectively constructed. The cartilage organ is prepared by culturing the DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells printed by a digital light processing system in vitro for 2-6 weeks.

[0005] The object of the application can be achieved by the following technical solutions.

[0006] In a first aspect of the application, a DNA-silk fibroin hybrid hydrogel sustained-release system is provided, the DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system printed by a digital light processing system after a DNA-silk fibroin hybrid hydrogel sustained-release system premixing solution,

[0007] In the DNA-silk fibroin hybrid hydrogel sustained-release system premixing solution, DNA, silk fibroin, acrylated RGD peptide, acrylated polyethylene glycol NHS ester, amino sugar, TD-198946 and 2,4,6-trimethylbenzoyl lithium phosphate are contained.

[0008] In an embodiment of the application, the DNA in the DNA-silk fibroin hybrid hydrogel sustained-release system premixing solution exists in the form of a DNA supramolecular network structure, the DNA is composed of Y-type DNA single strands and L-type DNA single strands, the Y-type DNA single strands are three, which are Y1, Y2 and Y3, and the molar ratio of Y1, Y2 and Y3 is 1:1:1; the L-type DNA single strands are two, which are L1 and L2, and the molar ratio of L1 and L2 is 1:1; the molar ratio of the Y-type DNA single strands and the L-type DNA single strands is 1:1-1:2; Y1, Y2 and Y3 each have three sticky ends, and L1 and L2 each have sticky ends at both ends, and the L-type DNA single strands can be fully complementary to the sticky ends of the Y-type DNA single strands.

[0009] In an embodiment of the application, the nucleotide sequences of Y1, Y2, Y3, L1 and L2 are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, respectively.

[0010] In one embodiment of the present application, the concentration of DNA in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system is 300,000 nM to 10,00,000 nM, the concentration of silk fibroin is 5 to 20 wt%, the concentration of acrylated RGD peptide is 5 to 10 wt%, the concentration of acrylated polyethylene glycol NHS ester is 4.5 to 10 wt%, the concentration of glucosamine is 10 to 20 mM, the concentration of TD-198946 is 100 to 200 nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25 to 1 wt%. In one embodiment of the present application, preferably, the concentration of DNA in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system is 500,000 nM, the concentration of silk fibroin is 10 wt%, the concentration of acrylated RGD peptide is 5 wt%, the concentration of acrylated polyethylene glycol NHS ester is 4.5 wt%, the concentration of glucosamine is 10 mM, the concentration of TD-198946 is 100 nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25 wt%.

[0011] In the second aspect of the present application, a preparation method of the DNA-silk fibroin hybrid hydrogel sustained-release system is provided, and the specific steps include:

[0012] Step 1: Construction of DNA supramolecular network: mixing Y-type DNA single strand and L-type DNA single strand in a phosphate buffer solution to obtain a DNA solution, and forming a DNA supramolecular network structure through complementary pairing of sticky end bases;

[0013] Step 2: Preparation of DNA-silk fibroin hybrid hydrogel sustained-release system:

[0014] Preparation of premix: mixing methyl acrylated silk fibroin, acrylated RGD peptide, acrylated polyethylene glycol NHS ester, glucosamine, TD-198946 and 2,4,6-trimethylbenzoyl lithium phosphate with the DNA solution in step 1 to obtain a premix of the DNA-silk fibroin hybrid hydrogel sustained-release system;

[0015] Preparation of hydrogel spheres: using digital light processing system technology, hydrogel spheres are formed under ultraviolet light irradiation, which are the final DNA-silk fibroin hybrid hydrogel sustained-release system.

[0016] In one embodiment of the present application, the concentration of DNA single strand in step 1 is 300,000 nM to 10,00,000 nM, and preferably 500,000 nM.

[0017] In one embodiment of the present application, the concentration of fibroin dissolved in the DNA solution in step 2 is 5-20 wt%, the concentration of acrylated RGD peptide is 5-10 wt%, the concentration of acrylated polyethylene glycol NHS ester is 4.5-10 wt%, the concentration of glucosamine is 10-20 mM, the concentration of TD-198946 is 100-200 nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25-1 wt%; preferably, the concentration of fibroin is 10 wt%, the concentration of acrylated RGD peptide is 5 wt%, the concentration of acrylated polyethylene glycol NHS ester is 4.5 wt%, the concentration of glucosamine is 10 mM, the concentration of TD-198946 is 100 nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25 wt%.

[0018] In one embodiment of the present application, the digital light processing system technology in step 2 is set to a wavelength of 365 nm, a light intensity of 4.0-15.0 mW cm -2 The particle size of the printed hydrogel spheres is 500-10000 microns.

[0019] Further preferably, the digital light processing system technology in step 2 is set to a wavelength of 365 nm, a light intensity of 8.0 mW cm -2 The particle size of the printed hydrogel spheres is 2500 microns.

[0020] In a third aspect of the present application, a cartilage organoid is provided, which is constructed based on a DNA-fibroin hybrid hydrogel sustained-release system, and is prepared by culturing the DNA-fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells in vitro for 2-6 weeks after printing by a digital light processing system. The specific steps include:

[0021] Step 1: Preparation of biological ink: uniformly mix the DNA-fibroin hybrid hydrogel sustained-release system pre-mixed solution with bone marrow mesenchymal stem cells at a concentration of (1-10) x 106 cells / mL to obtain biological ink;

[0022] Step 2: Preparation of cartilage organoid: using a digital light processing system technology, the biological ink is irradiated with ultraviolet light to form a 3D biological printing sphere, and the 3D biological printing sphere is continuously cultured in a cartilage induction medium in vitro for 2-6 weeks to obtain a cartilage organoid.

[0023] Further, the digital light processing system technology in step 2 is set to a wavelength of 365 nm, a light intensity of 4.0-15.0 mW cm -2 The particle size of the printed hydrogel spheres is 500-10000 microns.

[0024] Further preferably, the hydrogel spheres in step 2 are continuously cultured in vitro with the chondrogenic induction medium for 4 weeks.

[0025] In a fourth aspect, the application provides use of the cartilage organoid constructed based on the DNA-silk fibroin hybrid hydrogel sustained-release system according to the application, selected from one of the following uses:

[0026] (1) for preparing a cartilage tissue repair material;

[0027] (2) for drug screening;

[0028] (3) for disease model construction.

[0029] In a fifth aspect, the application provides use of the DNA-silk fibroin hybrid hydrogel sustained-release system according to the application, selected from one of the following uses:

[0030] (1) cell culture;

[0031] (2) construction of tissue structure;

[0032] (3) construction of organoid.

[0033] The DNA-silk fibroin hybrid hydrogel can continuously provide the functions of promoting chondrogenic differentiation of bone marrow mesenchymal stem cells, promoting synthesis efficiency of cartilage extracellular matrix, and preventing dedifferentiation and hypertrophy of bone marrow mesenchymal stem cells during long-term differentiation, and is expected to realize construction of long-term cultured and mature cartilage organoids.

[0034] The application scheme is proposed based on the above inventive concept.

[0035] Glucosamine is a component of cartilage matrix and a precursor of glycosaminoglycans (such as hyaluronic acid, chondroitin sulfate and dermatan sulfate) and proteoglycans. Not only can it stimulate bone marrow mesenchymal stem cells to generate extracellular matrix closer to natural cartilage, but also can maintain the stability of chondrocytes and cartilage extracellular matrix. In a three-dimensional culture system, as the cells proliferate and the matrix changes, the local mechanical tension will promote the dedifferentiation and hypertrophy of bone marrow mesenchymal stem cells.

[0036] TD-198946 is a thienoxazole derivative and is a highly efficient chondroinductive agent. Compared with other chondroinductive agents, TD-198946 can not only promote the hypertrophy of bone marrow mesenchymal stem cells, but also inhibit the hypertrophy and dedifferentiation of bone marrow mesenchymal stem cells. However, simple drug loading in hydrogels can easily cause burst release. Chemical grafting of drugs into hydrogels is a common strategy to avoid burst release. The commonly used methods for chemical grafting of drugs include covalent grafting, molecular imprinting, self-assembly and click chemistry. Compared with other methods, covalent grafting has higher stability, targeting and controllable drug release.

[0037] The acrylated polyethylene glycol NHS ester is a covalent crosslinker of bifunctional esterification reaction. The NHS ester functional group thereof can react with the amino sugar and the amino group on TD-198946, and the other end of the acrylate group can react with SilMA. Therefore, the amino sugar and TD-198946 can be covalently anchored to the DNA-silk fibroin hybrid hydrogel by the acrylated polyethylene glycol NHS ester, and the covalent grafting of the amino sugar and TD-198946 to the silk fibroin hydrogel network can be achieved. Therefore, the sustained nutrient supply can be achieved by covalently anchoring the amino sugar and TD-198946 to the DNA-silk fibroin hybrid hydrogel through the acrylated polyethylene glycol NHS ester, which is used for long-term culture of cartilage organoids.

[0038] In the DNA-silk fibroin hybrid hydrogel sustained release system, the DNA network is formed by single-stranded DNA through base complementary pairing. The DNA-silk fibroin hybrid hydrogel sustained release system is mainly composed of DNA-silk fibroin hybrid hydrogel, and two drugs (amino sugar and TD-198946) are covalently anchored to the silk fibroin hydrogel network through acrylated polyethylene glycol NHS ester. The introduction of the amino sugar in the system can promote the synthesis of the cartilage extracellular matrix, the introduction of TD-198946 can promote the chondrogenic differentiation of mesenchymal stem cells, and the acrylated RGD peptide can provide cell adhesion sites. The hydrogel sustained release system can support the long-term culture of mesenchymal stem cells in the system by continuously releasing the drug for chondrogenic differentiation of mesenchymal stem cells. The cartilage organoids prepared by culturing mesenchymal stem cells in the system for 2 to 6 weeks in vitro can efficiently repair cartilage defects, and provide a new treatment strategy for repairing cartilage defects.

[0039] Compared with the prior art, the present application has the following effects:

[0040] Firstly, the NHS ester functional group of the acrylated polyethylene glycol NHS ester in the DNA-silk fibroin hybrid hydrogel sustained release system can react with the amino sugar and the amino group on TD-198946, and the other end of the acrylate group can react with SilMA, so that the amino sugar and TD-198946 can be covalently anchored to the DNA-silk fibroin hybrid hydrogel, and the sustained nutrient supply can be achieved.

[0041] Secondly, the introduction of the amino sugar and TD-198946 in the DNA-silk fibroin hybrid hydrogel sustained release system can significantly improve the efficiency of promoting chondrogenic differentiation of mesenchymal stem cells.

[0042] Thirdly, the present application can be used as a cartilage graft to promote cartilage regeneration and repair. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1Preparation flow chart of DNA-silk fibroin hybrid hydrogel sustained-release system obtained in embodiment 1 of the present application.

[0044] Figure 2 Actual object diagram of DNA-silk fibroin hybrid hydrogel sustained-release system prepared in embodiment 1 of the present application.

[0045] Figure 3 Scanning electron microscope diagram of DNA-silk fibroin hybrid hydrogel sustained-release system prepared in embodiment 2 of the present application.

[0046] Figure 4 Swelling curve diagram of DNA-silk fibroin hybrid hydrogel sustained-release system prepared in embodiment 2 of the present application in phosphate buffer solution.

[0047] Figure 5 Degradation curve diagram of DNA-silk fibroin hybrid hydrogel sustained-release system prepared in embodiment 2 of the present application in complete cell culture medium.

[0048] Figure 6 Drug release curve diagram of DNA-silk fibroin hybrid hydrogel sustained-release system prepared in embodiment 2 of the present application in phosphate buffer solution.

[0049] Figure 7 Preparation flow chart of 3D bioprinted spheroid obtained in embodiment 1 of the present application.

[0050] Figure 8 Cell death and live staining experimental result diagram of bone marrow mesenchymal stem cells co-cultured with 3D bioprinted spheroid in embodiment 3 of the present application.

[0051] Figure 9 Cell skeleton staining experimental result diagram of cells of bone marrow mesenchymal stem cells in 3D bioprinted spheroid in embodiment 3 of the present application.

[0052] Figure 10 Alcian blue staining experimental result diagram of bone marrow mesenchymal stem cells co-cultured with 3D bioprinted spheroid in embodiment 3 of the present application.

[0053] Figure 11 Macroscopic, HE, alcian blue, ponceau solid green and immunostaining experimental result diagrams of different culture periods of cartilage organoids constructed by DNA-silk fibroin hybrid hydrogel sustained-release system in embodiment 4 of the present application.

[0054] Figure 12 Naked eye observation diagram of cartilage repair of cartilage organoids by application of DNA-silk fibroin hybrid hydrogel sustained-release system in embodiment 5 of the present application. DETAILED DESCRIPTION

[0055] The application will be described in detail below with reference to the drawings and specific embodiments.

[0056] The following examples will help those skilled in the art to further understand the present application, but do not limit the present application in any form. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present application. These are all within the scope of protection of the present application.

[0057] To complete the content of the present application, the experimental reagents, materials or instruments used in the examples are purchased from commercial products without special instructions.

[0058] Example 1

[0059] The preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system includes the following steps:

[0060] Step 1, construction of DNA supramolecular network:

[0061] Mixing DNA single strands: mixing Y-type DNA single strands and L-type DNA single strands in a pH 7.4 phosphate buffer solution at 37°C, the total molar concentration of Y-type DNA single strands and L-type DNA single strands is 500,000 nM, to obtain a DNA solution, wherein Y-type DNA single strands and L-type DNA single strands form a DNA supramolecular network structure by complementary pairing of sticky end bases;

[0062] Among them, Y-type DNA single strands are three, respectively Y1, Y2, Y3, and the molar ratio of Y1, Y2, Y3 is 1:1:1; L-type DNA single strands are two, respectively L1, L2, and the molar ratio of L1, L2 is 1:1; in this embodiment, the molar ratio of Y-type DNA single strands to L-type DNA single strands is 1:1.

[0063] The nucleotide sequences of Y1, Y2, Y3, L1, L2 are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, respectively.

[0064] The nucleotide sequences of the Y-type DNA single strands and the L-type DNA single strands are as follows:

[0065] Single-stranded ssDNA sequence (5' to 3') length (nt)

[0066] Y1 CTTACGACGCACAAGGAGATCATGAGTAACTGGACACTT (SEQ ID NO. 1)

[0067] Y2 CTTACGACGCACAAGGAGATCATGAGTAACTGGACACTT (SEQ ID NO. 2)

[0068] Y3 CTCATGATCTCCTTTAGGCAGACAGGTAACTGGACACTT (SEQ ID NO. 3)

[0069] L1 CTACGGTGAATGGAATTCTCATGCGAATAGAAAGTGTCCAGTTA (SEQ ID NO. 4)

[0070] L2 TCTATTCGCATGAGAATTCCATTCACCGTAGAAGTGTCCAGTTA (SEQ ID NO. 5)

[0071] Step 2, preparation of DNA-silk fibroin hybrid hydrogel sustained-release system and 3D bioprinting spheroids

[0072] (1) Preparation of the premix solution: silk fibroin (methylacrylated silk fibroin, SilMA), acrylated RGD peptide (Pep-RGDfKAC), acrylated polyethylene glycol NHS ester (AC-PEG-NHS), glucosamine, TD-198946, 2,4,6-trimethylbenzoyl lithium phosphate, and the DNA solution in step 1 were mixed to obtain a DNA-silk fibroin hybrid hydrogel sustained-release system premix solution. In the DNA-silk fibroin hybrid hydrogel sustained-release system premix solution, the concentration of each substance was: 10 wt% silk fibroin, 5 wt% acrylated RGD peptide, 4.5 wt% acrylated polyethylene glycol NHS ester, 10 mM glucosamine, 100 nM TD-198946, and 0.25 wt% 2,4,6-trimethylbenzoyl lithium phosphate.

[0073] (2) Preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system: using a digital light processing system (which is prior art, and in this embodiment, EFL-BP8601Pro was used, and the specific processing method was to add the premix solution into the machine tank and press the parameters set below to print), the DNA-silk fibroin hybrid hydrogel sustained-release system premix solution obtained in the above step was set to have a UV light wavelength of 365 nm, an intensity of 8.0 mW cm -2 , and the particle size of the printed hydrogel spheroids was 2500 microns.

[0074] (3) Construction of 3D bioprinting spheroids: on the basis of the DNA-silk fibroin hybrid hydrogel sustained-release system premix solution obtained in Example 1, bone marrow mesenchymal stem cells were added at a concentration of 1 x 10 6Cells / mL were mixed with the premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system, and the ultraviolet light was set to 365nm wavelength and 8.0mW cm⁻¹ using a digital light processing system. -2 The light intensity is such that the particle size of the 3D bioprinted spheres is 2500 micrometers.

[0075] The flowchart for the preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system in this embodiment is as follows: Figure 1 As shown, Figure 1 In this context, Y-scaffold refers to a Y-type DNA single strand, and Linker refers to an L-type DNA single strand. A physical image of the DNA-silk fibroin hybrid hydrogel sustained-release system is shown below. Figure 2 As shown in the figure, the DNA-silk fibroin hybrid hydrogel sustained-release system printed by the digital light processing system has a smooth surface and a complete shape.

[0076] Example 2

[0077] This embodiment primarily examines whether the material properties of the DNA-silk fibroin hybrid hydrogel sustained-release system can support the long-term culture of cartilage organoids.

[0078] The hydrogel spheres obtained in step (2) of Example 1 above are used as the DNA-silk fibroin hybrid hydrogel sustained-release system in this example. Figure 3 The image shows a scanning electron microscope (SEM) image of the DNA-silk fibroin hybrid hydrogel sustained-release system in Example 2. As can be seen from the image, it has a porous structure, which facilitates the transport of cellular nutrients and the removal of metabolic waste, as well as cell adhesion.

[0079] Figure 4 The swelling curve of the DNA-silk fibroin hybrid hydrogel sustained-release system shows that it has good swelling properties and is suitable for long-term 3D cell culture.

[0080] Figure 5 This is the degradation curve of the DNA-silk fibroin hybrid hydrogel sustained-release system in complete cell culture medium. The figure shows that after 6 weeks, more than 40% of the DNA-silk fibroin hybrid hydrogel sustained-release system remained. This moderate degradation rate provides favorable conditions for the growth of cartilage organoids, ensuring that the hydrogel can support cell growth and tissue construction during cell expansion while gradually degrading during long-term culture without affecting cartilage tissue growth.

[0081] Figure 6 The figure shows the drug release curves of glucosamine and TD-198946 in the DNA-silk fibroin hybrid hydrogel sustained-release system. As can be seen from the figure, the DNA-silk fibroin hybrid hydrogel sustained-release system can support the continuous release of drugs for up to 4 weeks.

[0082] Example 3

[0083] The 3D bioprinted spheroid obtained in (3) of Example 1, Step 2 was used as the research object of this example.

[0084] Figure 7 The flow chart of preparing 3D bioprinted spheroid in (3) of Example 1, Step 2. To investigate the effect of DNA-silk fibroin hybrid hydrogel sustained-release system on the behavior of bone marrow mesenchymal stem cells, cell viability and death staining was performed on the obtained 3D bioprinted spheroid and the cells co-cultured therewith using a cell viability and death staining kit, incubated in the dark at 37°C for 15 minutes, and the cells were stained with green for live cells and red for dead cells. The experimental results are shown in Figure 8 It can be seen from Figure 8 that the DNA-silk fibroin hybrid hydrogel sustained-release system has good cell compatibility.

[0085] The bone marrow mesenchymal stem cells cultured in the 3D bioprinted spheroid were fixed after one day of culture using a general tissue fixative, and the cytoskeleton of the cells was stained using a phalloidin-labeled microfilament skeleton staining reagent, incubated in the dark at room temperature for 30 minutes, and the results are shown in Figure 9 The bone marrow mesenchymal stem cells in the DNA-silk fibroin hybrid hydrogel sustained-release system exhibited good spreading effect. The 3D bioprinted spheroid containing bone marrow mesenchymal stem cells was co-cultured, and the cells were fixed after 7 days (7D) and 14 days (14D) of chondrogenic induction culture using a general tissue fixative, and alizarin red staining was performed using alizarin red dye for 30 minutes. The experimental results are shown in Figure 10 The experimental results showed a relatively significant positive staining signal, indicating that the DNA-silk fibroin hybrid hydrogel sustained-release system significantly promoted the chondrogenic differentiation of bone marrow mesenchymal stem cells.

[0086] Example 4

[0087] The 3D bioprinted spheroid obtained in (3) of Example 1, Step 2 was used as the research object of this example.

[0088] The 3D bioprinted spheroids were cultured in the chondrogenic induction medium for up to 6 weeks to construct the cartilage organoids. The cartilage organoids at different culture time points were photographed to observe its macroscopic morphology. The cartilage organoids at different culture time points were paraffin-embedded sectioned, and then subjected to HE, Safranin O-fast green, and Alcian blue staining. Finally, the cartilage organoids at different culture time points were fixed with universal tissue fixative, permeated with rapid permeation solution for 10 minutes, blocked with 10% normal goat serum at room temperature for 2 hours, and then incubated with the primary antibody solution diluted at a ratio of 1:200-1:1000 at 4°C overnight. The next day, the primary antibody was washed, and the secondary antibody solution diluted at a ratio of 1:500 and the phalloidin-labeled microfilament staining reagent were added and incubated at room temperature for 1 hour in the dark. Finally, the anti-fluorescence quenching mounting medium containing DAPI was added for ACAN, COL II (chondrogenic index), COL I (fibrosis index), and COL X (hypertrophy index) immunofluorescence staining. The experimental results are shown in Figure 11 As shown in Table 1, the HE experimental results show that, at weeks 2 and 4, the bone marrow mesenchymal stem cells formed a tissue-like structure in the hydrogel. However, at week 6, vacuoles appeared in the hydrogel due to partial cell apoptosis. The Alcian blue staining results show that, compared with weeks 2 and 6, the staining signal of the cartilage organoids cultured for 4 weeks is the strongest, indicating that the content of glycosaminoglycan in the cartilage organoids cultured for 4 weeks is the richest. The Safranin O-fast green staining results show that the cartilage organoids at weeks 2, 4, and 6 all exhibit red staining characteristic of cartilage, further proving the effective formation of the cartilage organoids. Compared with weeks 2 and 6, the staining signal is the strongest at week 4, further indicating that the phenotype of the cartilage organoids at week 4 is closest to that of natural cartilage. The immunofluorescence staining results show that the cartilage organoids cultured for 4 weeks have high expression of chondrogenic index and low expression of fibrosis and hypertrophy indexes. This indicates that the 4-week culture period is likely the best period for the development of the cartilage organoids, which exhibit the most potential cartilage phenotype.

[0089] Example 5

[0090] (1) Construction of a rat cartilage defect model: 6-7-week-old SD male rats (body weight about 200 g) were used. After general anesthesia, the joint capsule was incised to expose the distal femoral intercondylar fossa, and a 2-mm-diameter and 1.5-mm-deep cartilage defect was constructed in the middle using a punch.

[0091] (2) Application of DNA-silk fibroin hybrid hydrogel sustained release system (DSRGT, i.e. the hydrogel spheres without bone marrow mesenchymal stem cells obtained in (2) of step 2 of Example 1) and cartilage organoids (Or, i.e. the 3D bioprinted spheres containing bone marrow mesenchymal stem cells obtained in (3) of step 2 of Example 1) cultured for 4 weeks to repair cartilage defects: the above materials are transplanted into cartilage defects, the surface is sprayed with fibrin glue for fixation, and then the rats are sutured layer by layer. Among them, the Sham group is the sham operation group, and the Control group is the group without treatment. After operation, the rats are normally fed, and the rats are sacrificed after 8 weeks, and the repair effect is analyzed.

[0092] This example mainly investigates the repair effect of DNA-silk fibroin hybrid hydrogel sustained release system and cartilage organoids on cartilage defects, Figure 12 The above is the macroscopic observation of the femur of each group of animals at 8 weeks, compared with the control group and the DNA-silk fibroin hybrid hydrogel sustained release system group, the cartilage organoid group can hardly see the cartilage defects, and is closest to the sham operation group. The results prove that cartilage organoids can promote the rapid regeneration and repair of cartilage.

[0093] The above description of the embodiments is for the convenience of the ordinary skilled person in the art to understand and use the invention. Those skilled in the art can obviously make various modifications to these embodiments, and apply the general principles described herein to other embodiments without having to go through creative labor. Therefore, the present application is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art according to the disclosure of the present application without departing from the scope of the present application should be within the scope of protection of the present application.

Claims

1. A DNA-silk fibroin hybrid hydrogel sustained-release system, characterized in that, The DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system printed by a digital light processing system from a premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system. The DNA-silk fibroin hybrid hydrogel sustained-release system premix contains DNA, silk fibroin, acrylamide RGD peptide, acrylamide polyethylene glycol NHS ester, glucosamine, TD-198946 and lithium 2,4,6-trimethylbenzoyl phosphate. The DNA exists in the form of a DNA supramolecular network structure in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system. The DNA consists of Y-type DNA single strands and L-type DNA single strands. There are three Y-type DNA single strands, namely Y1, Y2, and Y3, and the molar ratio of Y1, Y2, and Y3 is 1:1:

1. There are two L-type DNA single strands, namely L1 and L2, and the molar ratio of L1 and L2 is 1:

1. The molar ratio of Y-type DNA single strands to L-type DNA single strands is 1:1 to 1:

2. Y1, Y2, and Y3 each have three sticky ends, and L1 and L2 each have sticky ends at both ends. The sticky ends of the L-type DNA single strands are completely complementary to those of the Y-type DNA single strands. The nucleotide sequences of Y1, Y2, Y3, L1, and L2 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively. The premix of the DNA-silk fibroin hybrid hydrogel sustained-release system contains DNA at a concentration of 300,000 nM to 10,000,000 nM, silk fibroin at a concentration of 5 to 20 wt%, acrylated RGD peptide at a concentration of 5 to 10 wt%, acrylated polyethylene glycol NHS ester at a concentration of 4.5 to 10 wt%, glucosamine at a concentration of 10 to 20 mM, TD-198946 at a concentration of 100 to 200 nM, and lithium 2,4,6-trimethylbenzoyl phosphate at a concentration of 0.25 to 1 wt%.

2. The preparation method of the DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 1, characterized in that, The specific steps include: Step 1, Construction of DNA supramolecular network: Y-type DNA single strands and L-type DNA single strands are mixed in phosphate buffer solution to obtain DNA solution, and a DNA supramolecular network structure is formed through sticky end base complementary pairing; Step 2: Preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system: Preparation of premix: Methacrylamide silk fibroin, acrylamide RGD peptide, acrylamide polyethylene glycol NHS ester, glucosamine, TD-198946 and lithium 2,4,6-trimethylbenzoyl phosphate were mixed with the DNA solution in step 1 to obtain the DNA-silk fibroin hybrid hydrogel sustained-release system premix. Preparation of hydrogel spheres: Hydrogel spheres are formed under ultraviolet light irradiation using digital light processing system technology, which is the final DNA-silk fibroin hybrid hydrogel sustained-release system.

3. The method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 2, characterized in that, The digital light processing system technology described in step 2 uses ultraviolet light set to a wavelength of 365 nm and a wavelength of 4.0~15.0 mW / cm². -2 The light intensity is such that the particle size of the printed hydrogel spheres is 500-10000 micrometers.

4. A cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, characterized in that, The cartilage organoids are prepared by printing the DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells described in claim 1 using a digital light processing system, followed by in vitro culture for 2-6 weeks, comprising the following steps: Step 1, Preparation of bio-ink: The premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system is mixed with bone marrow mesenchymal stem cells at a ratio of (1~10) × 10⁻⁶. 6 Mix the cells / mL solution to obtain the bio-ink; Step 2, Preparation of cartilage organoids: Using digital light processing system technology, bio-ink is formed into 3D bioprinted spheres under ultraviolet light irradiation. The 3D bioprinted spheres are continuously cultured in vitro in cartilage induction medium for 2-6 weeks to obtain cartilage organoids.

5. The cartilaginous organoid according to claim 4, characterized in that, The digital light processing system technology described in step 2 uses ultraviolet light set to a wavelength of 365 nm and a wavelength of 4.0~15.0 mW / cm². -2 The light intensity is such that the particle size of the printed hydrogel spheres is 500-10000 micrometers.

6. The application of the cartilaginous organoid according to claim 4, characterized in that, Choose from one of the following applications: (1) Used to prepare cartilage tissue repair materials; (2) Used for drug screening; (3) Used for disease model construction.

7. The application of the DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 1, characterized in that, Choose from one of the following applications: (1) Cell culture; (2) Organizational structure construction; (3) Organoid construction.

Images