Efficient ribonuclease double-primer isothermal amplification method

Through the ribonuclease double-primer isothermal amplification method, ribonucleotide-embedded hairpin primers and chain-displacing DNA polymerase are used for amplification under constant temperature conditions, which solves the problems of large number of primers and complex design in multi-primer isothermal nucleic acid amplification technology, and achieves highly specific and sensitive nucleic acid amplification, which is suitable for portable detection.

CN120758604APending Publication Date: 2025-10-10SOUTHEAST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510908644.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

Existing multi-primer isothermal nucleic acid amplification technology has problems such as a large number of primers, complex design, and high target dependence, which leads to nonspecific amplification and insufficient detection accuracy.

Method used

The RNase double-primer isothermal amplification method is adopted, and ribonucleotide-embedded hairpin primers are used to amplify under constant temperature conditions with chain-displacing DNA polymerase and RNase. Through RNase-mediated cleavage and extension, efficient double-primer-mediated amplification is achieved, reducing the number of primers and the difficulty of design.

Benefits of technology

Achieving highly specific and sensitive nucleic acid amplification under constant temperature conditions reduces the difficulty of primer design for portable detection and improves the accuracy and reliability of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758604A_ABST
    Figure CN120758604A_ABST
Patent Text Reader

Abstract

The invention discloses an efficient ribonuclease double-primer isothermal amplification method which comprises a pair of ribonucleotide embedded hairpin primers, strand displacement DNA polymerase, ribonuclease, nucleic acid embedded dye and a target nucleic acid sequence. The ribonucleotide embedded hairpin primer is composed of a 5 '-end hairpin sequence, a 3'-end linear sequence and ribonucleotide embedded between the 5 '-end hairpin sequence and the 3'-end linear sequence, ribonuclease recognizes and cuts the ribonucleotide embedded in an amplification product and forms a gap, and the tail end of the gap can serve as a primer for further extension and replacement. According to the ribonuclease double-primer isothermal amplification method disclosed by the invention, an amplification product of which the 3 '-end sequence can be subjected to intramolecular hybridization in the amplification process can be autonomously extended and can be paired and extended by other primers as a substrate, and the ribonuclease double-primer isothermal amplification method disclosed by the invention only needs one pair of primers, has the advantages of simple primer design, high sensitivity and high specificity, and has a great application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a high-efficiency ribonuclease double-primer isothermal amplification method. Background Art

[0002] Nucleic acid amplification (NAA) is a core technology in modern molecular biology, medical diagnostics, pathogen detection, and genetic engineering. Since the advent of polymerase chain reaction (PCR) in 1985, NAA has been widely used in numerous fields. However, traditional PCR relies on thermal cycling, requiring large and expensive instrumentation and long reaction times, limiting its application in on-site and portable testing. Therefore, developing efficient, rapid, and portable NAA methods has become a research hotspot. Isothermal NA, with its advantages of constant temperature reaction, simple equipment, and rapid portability, has gradually become a tool for on-site and at-home testing.

[0003] Currently, isothermal nucleic acid amplification methods are primarily categorized into two main types: multi-primer isothermal amplification and multi-enzyme isothermal amplification. Multi-enzyme isothermal amplification (MIA) requires the combined efforts of at least two functional enzymes to efficiently amplify nucleic acids under constant temperature. Its simplicity and portability make it widely applicable for rapid on-site testing and home use. Common MIA techniques include recombinase polymerase amplification (RPA) and strand displacement amplification (SDA). However, these techniques have limitations, such as the need to add crowding reagents (such as Carbowax 20M and PEG), which increase system viscosity, affecting reagent dispersion and sensitivity in detecting trace molecules. Furthermore, nonspecific amplification is common, making specific detection difficult using low-cost nucleic acid dyes (such as SYBR Green and EvaGreen). Accuracy often requires reliance on costly nucleic acid probes or secondary product analysis (such as lateral flow strips).

[0004] Multi-primer isothermal amplification uses at least two pairs of primers to identify at least four target sites. Under the action of a strand-displacing polymerase, only fluorescent nucleic acid dyes are required to achieve efficient and rapid nucleic acid amplification. Examples include loop-mediated isothermal amplification (LAMP) and isothermal multi-primer self-priming amplification (IMSA). However, during the primer design process, multi-primer isothermal amplification is prone to nonspecific amplification and false-positive results due to factors such as the large number of primers, complex primer design, and high target dependence, which affect the accuracy and reliability of the test. Therefore, to address the shortcomings of existing multi-primer isothermal technology, there is an urgent need to develop new isothermal nucleic acid amplification methods that can achieve highly specific nucleic acid amplification detection with a single primer using nucleic acid-intercalating dyes under constant temperature conditions, potentially reducing the number of primers and the difficulty of design. Summary of the Invention

[0005] Technical problem to be solved: In response to the problems existing in the above-mentioned technology of current multi-primer isothermal nucleic acid amplification in primer design, such as a large number of primers, complex primer design and high target dependence, the present invention provides a high-efficiency ribonuclease double-primer isothermal amplification method, which can realize double-primer-mediated high-efficiency amplification detection under constant temperature conditions using nucleic acid intercalating dyes, and can reduce the number of primers and the design difficulty of multi-primer isothermal nucleic acid technology.

[0006] Technical solution: The first object of the present invention is to provide an efficient ribonuclease double-primer isothermal amplification method, which includes pairing a ribonucleotide-embedded hairpin primer with a target nucleic acid sequence and extending it under the action of a strand-displacing DNA polymerase, ribonuclease-mediated cleavage and extension, and an amplification product in which the 3′-end sequence can undergo intramolecular hybridization, can undergo autonomous extension, and can be paired with other primers to mediate exponential cyclic amplification. The reagents used in the ribonuclease double-primer isothermal amplification method include an upstream ribonucleotide-embedded hairpin primer, a downstream ribonucleotide-embedded hairpin primer, a strand-displacing DNA polymerase, a ribonuclease, a nucleic acid-intercalating dye, and a target nucleic acid sequence. The upstream or downstream ribonucleotide-embedded hairpin primer is composed of a 5′-end hairpin sequence, a 3′-end linear sequence, and a ribonucleotide embedded therebetween. The 5′-end hairpin sequence is composed of two complementary target nucleic acid sequence sites, and the 3′-end linear sequence is composed of a single target nucleic acid sequence site.

[0007] The isothermal amplification process is exemplified by the example of an upstream ribonucleotide embedded hairpin primer first recognizing the target nucleic acid sequence and initiating amplification. The amplification process initiated by the downstream ribonucleotide embedded hairpin primer is similar, including:

[0008] a) The upstream ribonucleotide-embedded hairpin primer, under the action of strand-displacing DNA polymerase, recognizes the upstream site of the target nucleic acid sequence and, using the target nucleic acid sequence as a template, extends along the 5′ end of the target nucleic acid sequence. The extension product further opens the target nucleic acid sequence to form a double-stranded product containing a hairpin structure, i.e., a hairpin double-stranded product;

[0009] b) a new upstream ribonucleotide intercalating hairpin primer recognizes the upstream site of the double-stranded hairpin product in step a), and a downstream ribonucleotide intercalating hairpin primer recognizes the downstream site of the double-stranded hairpin product in step a), and primers are extended and displaced by a strand-displacing DNA polymerase, respectively, to generate the same double-stranded hairpin product as that in step a), thereby forming a cyclic process. Simultaneously, an amplification product is generated, which has a double-stranded structure with an intercalating ribonucleotide at one end and a hairpin structure at the other end, i.e., a substrate for ribonuclease-mediated cleavage.

[0010] c) the substrate cleaved by the ribonuclease in step b) is recognized by the ribonuclease, which cleaves the phosphodiester bond between the ribonucleotide and the deoxyribonucleotide to form a gap containing a hydroxyl terminus, wherein the hydroxyl terminus can serve as a primer to be extended and displaced by the strand-displacing DNA polymerase to form a double-stranded extension product embedded with the ribonucleotide;

[0011] d) the double-stranded extension product in step c) is again recognized and cleaved by ribonuclease to form a nick containing a hydroxyl terminus. Similarly, the hydroxyl terminus can serve as a primer and be extended and displaced by a strand-displacing DNA polymerase to form a double-stranded extension product and a hairpin double-stranded product having a double-stranded ribonucleotide at one end and a hairpin structure at the other end;

[0012] e) the 3′ end sequence of the double-stranded hairpin product described in step d) can undergo intramolecular hybridization, i.e., self-matching, and the amplified product can be recognized and matched by upstream and downstream ribonucleotide intercalating hairpin primers, i.e., primer matching. After self-matching and primer matching, the amplified product is extended and displaced by a strand-displacing DNA polymerase, thereby generating a core product of exponential cyclic amplification. Similarly, the double-stranded extension product described in step d) is recognized and extended by upstream and downstream ribonucleotide intercalating hairpin primers as a substrate, thereby generating a core product of exponential cyclic amplification.

[0013] f) The core product of the exponential cyclic amplification in step e) enters exponential cyclic amplification under the joint action of upstream and downstream ribonucleotide intercalating hairpin primers and strand displacement DNA polymerase.

[0014] Preferably, the 5′-end hairpin sequence consists of two complementary target nucleic acid sequence sites, the number of nucleotides in the target nucleic acid sequence sites is greater than or equal to 10 and less than or equal to 100, and the 3′-end linear sequence consists of a single target nucleic acid sequence site, the number of nucleotides in the single target nucleic acid sequence site is greater than or equal to 10 and less than or equal to 100.

[0015] Preferably, the number of the embedded ribonucleotides is greater than or equal to 1 and less than or equal to 25.

[0016] Preferably, the ribonuclease is ribonuclease H1 (or HI), ribonuclease H2 (or HII), ribonuclease H3 (HIII), or retroviral ribonuclease H.

[0017] Preferably, the target nucleic acid sequence is a DNA sequence in a sample, an RNA sequence in a sample, a mixed sequence of DNA and RNA in a sample, or a pre-amplification reaction product of a DNA or RNA sequence in a sample.

[0018] Preferably, the pre-amplification reaction includes at least one of a multi-enzyme isothermal rapid nucleic acid amplification (MIRA) reaction, a recombinase-mediated isothermal nucleic acid amplification (RAA) reaction, a recombinase polymerase amplification (MIRA) reaction, a loop-mediated isothermal amplification (LAMP) reaction, a cross-primer amplification (CPA) reaction, a rolling circle amplification (RCA) reaction, a helicase-dependent amplification (HDA) reaction, a nucleic acid sequence-dependent amplification (NASBA) reaction, a recombinase transcriptase-mediated isothermal amplification reaction, and a strand displacement amplification (SDA) reaction.

[0019] Preferably, the strand-displacing DNA polymerase is at least one of Bacillus stearothermophilus DNA polymerase, Bacillus smithii DNA polymerase, Bacillus subtilis DNA polymerase, phi29 DNA polymerase and Vent (exo-) DNA polymerase.

[0020] Preferably, the nucleic acid intercalating dye is one of the SYBR Green series, SYTO series and EvaGreen series.

[0021] The second object of the present invention is to provide a high-efficiency ribonuclease double primer isothermal amplification kit, the main components of which include the above-mentioned upstream and downstream ribonucleotide intercalating hairpin primers, strand displacement DNA polymerase, ribonuclease, and nucleic acid intercalating dye.

[0022] Preferably, the main components of the kit further include reaction buffer, dNTPs, betaine and / or magnesium ions.

[0023] Beneficial Effects: Compared to existing technologies, this method utilizes a ribonucleotide-intercalating hairpin primer, a strand-displacing DNA polymerase, a ribonuclease, a nucleic acid-intercalating dye, and a target nucleic acid sequence, among other reagent components, to perform exponential cyclic amplification of a target nucleic acid sequence under constant temperature. This method offers advantages such as high specificity, high sensitivity, and strong versatility. It addresses the technical challenges of current multi-primer isothermal nucleic acid amplification methods in terms of primer quantity and design difficulty, and has the potential to reduce the difficulty of primer design for portable isothermal nucleic acid detection. This method is an important supplement to current nucleic acid amplification detection technologies and can be used for pathogen detection, clinical diagnosis, food safety testing, environmental health monitoring, and livestock and aquatic product inspection and quarantine. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The diagram shows the primer structure design and ribonuclease-mediated cleavage extension of the ribonuclease double-primer isothermal amplification method of the present invention.

[0025] Figure 2The schematic diagram of the substrate for the ribozyme-mediated cleavage in the principle of ribozyme double primer isothermal amplification of the application.

[0026] Figure 3 The schematic diagram of the principle of ribozyme double primer isothermal amplification of the application.

[0027] Figure 4 The real-time fluorescence change curve (A) and the scatter plot column chart (B) between the time threshold value of the exponential fluorescence curve and the target plasmid template concentration in three repeated tests when the ribozyme double primer isothermal amplification method of the application uses Bst DNA polymerase large fragment to detect different concentrations of plasmid templates containing target nucleic acid sequences of ATPase genes of Decapoda shrimp iridovirus (DIV1). NC is the control group of non-target plasmid templates containing nucleic acid sequences of polymerase genes of CyHV2.

[0028] Figure 5 The agarose gel electrophoresis analysis of the amplification products when the ribozyme double primer isothermal amplification method of the application uses Bst DNA polymerase large fragment to detect different concentrations of plasmid templates containing target nucleic acid sequences of ATPase genes of Decapoda shrimp iridovirus (DIV1). NC is the control group of non-target plasmid templates containing nucleic acid sequences of polymerase genes of CyHV2.

[0029] Figure 6 The real-time fluorescence change curve (A) and the scatter plot column chart (B) between the time threshold value of the exponential fluorescence curve and the target plasmid template concentration in three repeated tests when the ribozyme double primer isothermal amplification method of the application uses Bst DNA polymerase large fragment to detect different concentrations of plasmid templates containing target nucleic acid sequences of polymerase genes of CyHV2. NC is the control group of non-target plasmid templates containing nucleic acid sequences of ATPase genes of Decapoda shrimp iridovirus (DIV1).

[0030] Figure 7 The agarose gel electrophoresis analysis of the amplification products when the ribozyme double primer isothermal amplification method of the application uses Bst DNA polymerase large fragment to detect different concentrations of plasmid templates containing target nucleic acid sequences of polymerase genes of CyHV2. NC is the control group of non-target plasmid templates containing nucleic acid sequences of ATPase genes of Decapoda shrimp iridovirus (DIV1). DETAILED DESCRIPTION

[0031] The application will be described in greater detail below with reference to the drawings. Those skilled in the art will appreciate that the embodiments are only used to illustrate the application and are not used to limit the scope of the application.

[0032] One embodiment of the present invention provides a high-efficiency ribonuclease double-primer isothermal amplification method, including pairing a ribonucleotide-embedded hairpin primer with a target nucleic acid sequence and extending it under the action of a strand-displacing DNA polymerase, ribonuclease-mediated cleavage and extension, and an amplification product in which the 3′-end sequence can undergo intramolecular hybridization, can undergo autonomous extension, and can be paired with other primers to mediate exponential cyclic amplification. The reagents used in the ribonuclease double-primer isothermal amplification method include an upstream ribonucleotide-embedded hairpin primer, a downstream ribonucleotide-embedded hairpin primer, a strand-displacing DNA polymerase, a ribonuclease, a nucleic acid-intercalating dye, and a target nucleic acid sequence. The upstream or downstream ribonucleotide-embedded hairpin primer is composed of a 5′-end hairpin sequence, a 3′-end linear sequence, and a ribonucleotide embedded therebetween. The 5′-end hairpin sequence is composed of two complementary target nucleic acid sequence sites, and the 3′-end linear sequence is composed of a single target nucleic acid sequence site.

[0033] The above isothermal amplification method is based on the existing multi-primer isothermal amplification technology to reduce the number of primer designs and is constructed using a ribonuclease cleavage-mediated chain extension system.

[0034] The isothermal amplification process is exemplified by the example of an upstream ribonucleotide embedded hairpin primer first recognizing the target nucleic acid sequence and initiating amplification. The amplification process initiated by the downstream ribonucleotide embedded hairpin primer is similar, including:

[0035] a) The upstream ribonucleotide-embedded hairpin primer, under the action of strand-displacing DNA polymerase, recognizes the upstream site of the target nucleic acid sequence and, using the target nucleic acid sequence as a template, extends along the 5′ end of the target nucleic acid sequence. The extension product further opens the target nucleic acid sequence to form a double-stranded product containing a hairpin structure, i.e., a hairpin double-stranded product;

[0036] b) a new upstream ribonucleotide intercalating hairpin primer recognizes the upstream site of the double-stranded hairpin product in step a), and a downstream ribonucleotide intercalating hairpin primer recognizes the downstream site of the double-stranded hairpin product in step a), and primers are extended and displaced by a strand-displacing DNA polymerase, respectively, to generate the same double-stranded hairpin product as that in step a), thereby forming a cyclic process. Simultaneously, an amplification product is generated, which has a double-stranded structure with an intercalating ribonucleotide at one end and a hairpin structure at the other end, i.e., a substrate for ribonuclease-mediated cleavage.

[0037] c) the substrate cleaved by the ribonuclease in step b) is recognized by the ribonuclease, which cleaves the phosphodiester bond between the ribonucleotide and the deoxyribonucleotide to form a gap containing a hydroxyl terminus, wherein the hydroxyl terminus can serve as a primer to be extended and displaced by the strand-displacing DNA polymerase to form a double-stranded extension product embedded with the ribonucleotide;

[0038] d) the double-stranded extension product in step c) is again recognized and cleaved by ribonuclease to form a nick containing a hydroxyl terminus. Similarly, the hydroxyl terminus can serve as a primer and be extended and displaced by a strand-displacing DNA polymerase to form a double-stranded extension product and a hairpin double-stranded product having a double-stranded ribonucleotide at one end and a hairpin structure at the other end;

[0039] e) the 3′ end sequence of the double-stranded hairpin product described in step d) can undergo intramolecular hybridization, i.e., self-matching, and the amplified product can be recognized and matched by upstream and downstream ribonucleotide intercalating hairpin primers, i.e., primer matching. After self-matching and primer matching, the amplified product is extended and displaced by a strand-displacing DNA polymerase, thereby generating a core product of exponential cyclic amplification. Similarly, the double-stranded extension product described in step d) is recognized and extended by upstream and downstream ribonucleotide intercalating hairpin primers as a substrate, thereby generating a core product of exponential cyclic amplification.

[0040] f) The core product of the exponential cyclic amplification in step e) enters exponential cyclic amplification under the joint action of upstream and downstream ribonucleotide intercalating hairpin primers and strand displacement DNA polymerase.

[0041] As one of the preferred embodiments, the 5′-end hairpin sequence consists of two complementary target nucleic acid sequence sites, the number of nucleotides in the target nucleic acid sequence site is greater than or equal to 10 and less than or equal to 100, and the 3′-end linear sequence consists of a single target nucleic acid sequence site, the number of nucleotides in the single target nucleic acid sequence site is greater than or equal to 10 and less than or equal to 100.

[0042] As a preferred embodiment, the number of the embedded ribonucleotide is 1.

[0043] As a preferred embodiment, the ribonuclease is ribonuclease H2 (or HII), namely RNaseH2.

[0044] As a preferred embodiment, the target nucleic acid sequence is a DNA sequence in a sample.

[0045] As a preferred embodiment, the strand-displacing DNA polymerase is Bst DNA polymerase large fragment.

[0046] As a preferred embodiment, the nucleic acid intercalating dye is EvaGreen.

[0047] As a preferred embodiment, the reagents used in the isothermal amplification method further include a reaction buffer, dNTPs, betaine and magnesium ions.

[0048] The reaction system of the present invention mainly includes: Figure 1The shown ribonucleotide-embedded hairpin primer (including the upstream ribonucleotide-embedded hairpin primer and the downstream ribonucleotide-embedded hairpin primer), displacement strand DNA polymerase, ribonuclease H2, target nucleic acid sequence, also includes nucleic acid-embedded dye, reaction buffer, dNTPs, betaine and magnesium ions, its reaction principle is as shown in Figure 2 and Figure 3 The specific amplification reaction process is as follows:

[0049] a) The upstream ribonucleotide-embedded hairpin primer recognizes the upstream site of the target nucleic acid sequence under the action of strand displacement DNA polymerase, and extends along the 5' end of the target nucleic acid sequence with the target nucleic acid sequence as the template, and the extension product will further open the target nucleic acid sequence to form a double-stranded product containing a hairpin structure, i.e. a hairpin double-stranded product (as shown in Figure 2 );

[0050] b) The new upstream ribonucleotide-embedded hairpin primer recognizes the upstream site of the hairpin double-stranded product in step a), and the downstream ribonucleotide-embedded hairpin primer recognizes the downstream site of the hairpin double-stranded product in step a), and each occurs primer extension and displacement under the action of strand displacement DNA polymerase, generating the same hairpin double-stranded product as in step a), forming a cyclic process, while also generating an amplification product with one end being a double-stranded embedded ribonucleotide and the other end being a hairpin structure, i.e. a ribonuclease-mediated cleavage substrate (as shown in Figure 2 );

[0051] c) The ribonuclease-mediated cleavage substrate in step b) is recognized by ribonuclease and cleaves the phosphodiester bond between ribonucleotide and deoxyribonucleotide to form a gap containing a hydroxyl end, which can act as a primer to extend and displace under the action of strand displacement DNA polymerase, forming a double-stranded extension product embedded with ribonucleotide (as shown in Figure 3 );

[0052] d) The double-stranded extension product in step c) is again recognized and cleaved by ribonuclease to form a gap containing a hydroxyl end, which can also act as a primer to extend and displace under the action of strand displacement DNA polymerase, forming a double-stranded extension product and a hairpin double-stranded product with one end being a double-stranded embedded ribonucleotide and the other end being a hairpin structure (as shown in Figure 3 );

[0053] e) The 3′ end sequence of the double-stranded hairpin product described in step d) can undergo intramolecular hybridization, i.e., self-matching. At the same time, the amplified product can be recognized and matched by the upstream and downstream ribonucleotide embedded hairpin primers, i.e., primer matching. After self-matching and primer matching, it is extended and displaced under the action of a strand-displacing DNA polymerase to generate a core product of exponential cyclic amplification. Similarly, the double-stranded extension product described in step d) is recognized and extended by the upstream and downstream ribonucleotide embedded hairpin primers as a substrate to also generate a core product of exponential cyclic amplification (e.g., Figure 3 shown);

[0054] f) The core product of the exponential cyclic amplification in step e) enters the exponential cyclic amplification under the joint action of the upstream and downstream ribonucleotide intercalating hairpin primers and the strand displacement DNA polymerase (e.g. Figure 3 shown).

[0055] In the embodiments of this specification, the upstream and downstream ribonucleotide embedded hairpin primers are composed of a single ribonucleotide embedded in the 5' end hairpin sequence and the 3' end linear sequence, wherein the 5' end hairpin sequence is composed of two complementary target nucleic acid sequence sites, and the 3' end linear sequence is composed of a single target nucleic acid sequence site.

[0056] Furthermore, the selection criteria for the two complementary target nucleic acid sequence sites of the 5′-end hairpin sequence in the upstream and downstream ribonucleotide embedded hairpin primers are that their annealing temperature is 60-68°C, and the selection criteria for the target nucleic acid sequence site of the 3′-end linear sequence is that its annealing temperature is 55-63°C.

[0057] The specific embodiments are as follows:

[0058] Example 1

[0059] In this example, a synthetic plasmid containing the target nucleic acid sequence T1 of the ATPase gene of the decapod shrimp iridovirus (DIV1) was used as the test object to verify the feasibility of the method using Bst DNA polymerase large fragment to amplify DNA targets of different concentrations at a constant temperature of 60 ° C. Primers were designed based on the target nucleic acid sequence of the ATPase gene, the reaction system was constructed using Bst DNA polymerase large fragment, and the nucleic acid intercalating dye EvaGreen was used to display real-time fluorescence signal changes. The reaction principle can be found in Figure 2 and Figure 3 , the specific steps are as follows:

[0060] (1) Take an EP tube and add 9 μL of 10× reaction buffer (200 mM Tris-HCl, 100 mM (NH4)2SO4, 500 mM KCl, 20 mM MgSO4, 1.0% Triton X-100, pH 8.8), 14.4 μL of dNTPs (concentration of 10 mM), 3.6 μL of MgSO4 (concentration of 4 mM), 1.8 μL of upstream ribonucleotide embedded hairpin primer (concentration of 0.8 μM), 1.8 μL of downstream ribonucleotide embedded hairpin primer (concentration of 0.8 μM), 4.5 μL of EvaGreen (concentration of 1×), 14.4 μL of betaine (concentration of 0.8 M), 9 μL of RNase H2 (concentration of 0.002 U / μL), 13.5 μL of Bst DNA polymerase large fragment (concentration of 1.2 U / μL) and 9 ... μL of nuclease-free water was mixed to form mixed solution I;

[0061] (2) Take 7 EP tubes, add 90 μL of nuclease-free water to each tube, and add the plasmid template containing the target nucleic acid sequence T1 of the ATPase gene of decapod shrimp iridovirus (DIV1) in sequence, so that the concentration is increased by tenfold from 10 6 to 10 0 Copy number / μL distribution, and take another EP tube and add 10 6 A plasmid template containing the nucleic acid sequence T2 of the Cyprinus herpesvirus type II (CyHV2) polymerase gene (see Example 2) at a copy number / μL was used as a non-target control group (NC);

[0062] (3) Take 8 PCR tubes and add 1 μL of the above 10 6 to 10 0 The number of copies / μL of plasmid template and 1 μL of 10 6 The plasmid template containing the nucleic acid sequence T2 of the Cyprinus herpesvirus type Ⅱ (CyHV2) polymerase gene has a copy number / μL.

[0063] (4) Add 9 μL of mixed solution I to each of the above 8 PCR tubes, mix well to form the final reaction solution, and incubate at 60 °C for 60 min. Measure the change in fluorescence of the solution in each tube over time with an acquisition time interval of 1 minute, and draw a real-time fluorescence change curve.

[0064] (5) Repeat the above test three times, and construct a scatter histogram with the time threshold of the exponential fluorescence change curve as the vertical axis and the concentration value as the horizontal axis.

[0065] (6) Take 5 μL of the above amplified solution and perform 2% TBE agarose gel electrophoresis analysis. At the same time, the non-target control group (NC) reaction solution is used as a control.

[0066] The sequence of the target nucleic acid sequence T1 of the ATPase gene of the decapod shrimp iridovirus (DIV1) is as follows:

[0067] T1:

[0068] 5'-AGCTGCAAGTCCCGAATTGGCCAGGGCGGGAGATGGTGTTAGATGGGCAGTCATGGATGAACCAAATGCTGACGAAATCATCAGTTCGGGAACGTTAAAGGGTCTCACGGGAAACGATTCGTAT TGGGCTCGAGATTTGTTCCAACGAGGAAAGGAAACGAAAGAAATTATACCCTTTTTCAAATTACACATGATTTGCAACAAGCTTCCAGCAATCAAGGATGCCGATCAAGCAACGTGGAATCGAATCAG GGTTATTCCATTCGAAAGTACATTCAAACATGAAAACGATTGCCCCGTTGAATTTGAAGAACAAATGAAACAGAAAACATTCCCCATGGATAAAAATTTCACAGAAAAGATTCCCGAAATGGTAAAACCCCTGGCTTGGTATCTTATTCAGAGATGGAAGACTATCAGGAAGTGTGAAATTGTAGAGCCAGAGATTGTAACGGTAGCTACATCTTCGTACCGAAACGAAAACGATATTTACAAGCAAT-3' (SEQ ID No.1).

[0069] The sequence of the upstream ribonucleotide embedded hairpin primer is as follows:

[0070] 5'-CGATTGCCCCGTTGAATTTGAAGACTTCAAATTCAACGGGGCAATCGaGAATCAGGGTTATTCCATTCG-3' (SEQ ID No. 2, a represents an RNA base, the same below).

[0071] The sequence of the downstream ribonucleotide embedded hairpin primer is as follows:

[0072] 5'-CTTCAAATTCAACGGGGCAATCGACGATTGCCCCGTTGAATTTGAAGaTCGGGAATCTTTTCTGTGA-3' (SEQ ID No. 3).

[0073] The experimental results are as follows Figure 4 As shown in A, under the incubation condition of 60 °C, the isothermal amplification method of the present invention can stably detect as low as 10 0 The plasmid template containing the target nucleic acid sequence T1 of the ATPase gene of decapod shrimp iridovirus (DIV1) at the copy number / μL showed an exponential real-time fluorescence change curve, while the fluorescence of the NC control group containing the non-target plasmid template containing the nucleic acid sequence T2 of the polymerase gene of carp herpesvirus type II (CyHV2) did not change with time. At the same time, a scatter histogram was constructed with the time threshold as the vertical axis and the concentration value as the horizontal axis. Figure 4 As shown in B, three repeated tests can stably measure the value as low as 10 0 The time threshold of the plasmid template containing the target nucleic acid sequence T1 of the ATPase gene of decapod shrimp iridovirus (DIV1) was 0.01, while the NC control group containing the non-target plasmid template containing the nucleic acid sequence T2 of the polymerase gene of cyprinid herpesvirus type Ⅱ (CyHV2) had no time threshold. In addition, the amplified products were analyzed by agarose gel electrophoresis, and the results were as follows. Figure 5 As shown, all amplification products of plasmid templates containing the target nucleic acid sequence T1 of the decapod shrimp iridovirus (DIV1) ATPase gene showed obvious large fragments (greater than 1500 bp), while the NC control group, which contained the non-target plasmid template containing the nucleic acid sequence T2 of the cyprinid herpesvirus type 2 (CyHV2) polymerase gene, showed no large fragments. Therefore, these results demonstrate that the method of the present invention, using the Bst DNA polymerase large fragment, has high sensitivity and specificity in amplifying the target nucleic acid sequence T1 of the decapod shrimp iridovirus (DIV1) ATPase gene.

[0074] Example 2

[0075] In this example, the synthetic T2 plasmid containing the target nucleic acid sequence of the Cyprinus cyprinid herpesvirus type II (CyHV2) polymerase gene was used as the detection object to verify the feasibility of the method using Bst DNA polymerase large fragment to amplify DNA targets of different concentrations at a constant temperature of 60 ° C. Primers were designed based on the target nucleic acid sequence of the CyHV2 polymerase gene, the reaction system was constructed using Bst DNA polymerase large fragment, and the nucleic acid intercalating dye EvaGreen was used to display the real-time fluorescence signal changes. Reaction principle see Figure 2 and Figure 3 , the specific steps are as follows:

[0076] (1) Take 1 EP tube, add 9 μL of 10× reaction buffer (200 mM Tris-HCl, 100 mM (NH4)2SO4, 500 mM KCl, 20 mM MgSO4, 1.0% Triton X-100, pH 8.8), 14.4 μL of dNTPs (concentration of 10 mM), 3.6 μL of MgSO4 (concentration of 4 mM), 1.8 μL of upstream ribonucleotide-embedded hairpin primer (concentration of 0.8 μM), 1.8 μL of downstream ribonucleotide-embedded hairpin primer (concentration of 0.8 μM), 4.5 μL of EvaGreen (concentration of 1×), 14.4 μL of betaine (concentration of 0.8 M), 9 μL of RNase H2 (concentration of 0.002 U / μL), 13.5 μL of Bst DNA polymerase large fragment (concentration of 1.2 U / μL), and 9 μL of nuclease-free water to mix evenly to form a mixed solution I;

[0077] (2) Take 7 EP tubes, each add 90 μL of nuclease-free water, and then add plasmid templates containing CyHV2 polymerase gene target nucleic acid sequence T2 to make the concentration of the target nucleic acid sequence T2 in the plasmid templates distributed in a ten-fold gradient from 10 6 to 10 0 copies / μL, respectively, while another 1 EP tube is added with 10 6 copies / μL of plasmid templates containing DIV1 ATPase gene nucleic acid sequence T1 (see Example 1) as a non-target control group (NC);

[0078] (3) Take 8 PCR tubes, and then add 1 μL of the above 10 6 to 10 0 copies / μL of plasmid templates and 1 μL of 10 6 copies / μL of plasmid templates containing DIV1 ATPase gene nucleic acid sequence T1, respectively.

[0079] (4) Add 9 μL of mixed solution I to each of the above 8 PCR tubes, mix well to form a final reaction solution, and then incubate at 60 °C for 60 min. Measure the change in fluorescence of each tube solution over time with a time interval of 1 min, and plot the real-time fluorescence change curve.

[0080] (5) Repeat the above test three times, and take the time threshold value of the exponential fluorescence change curve as the vertical axis and the concentration value as the horizontal axis to construct a scatter column chart.

[0081] (6) Take 5 μL of the above amplified solution for 2% TBE agarose gel electrophoresis analysis, and the non-target control group (NC) reaction solution is used as a control.

[0082] The sequence of the target nucleic acid sequence T2 of the Cyprinus cyprinid virus type II (CyHV2) polymerase gene is as follows:

[0083] T2:

[0084] 5'-TCTGCACTTATGATTTTTCGAGTCTGTACCCCAGCAACATGTGCGACGGAGGCATCAGCCCAGAGTCCATAGTGTCTAGGAGCGACCCGTTCTGTCTCGAGTATGTCAGAAACTGCGTGCTGCT CGATTGGAAAAAGATACCGGCCGCCAGTAACATGGAAGAGATCAAGGAATACCCGCACAGCGAAGACCTGTACACGATCCTGTGCTACAAGAACCGAGAGGTCGGTTGGACTCGGTTTGTGACCTACA CCGCTTCCAGTCTGGGCCACTACCTCTCTATGAGATCTCAGTACAAGAAACGCATCAAGACCGAGAAAGACGCGAGTCTCAAGGCGTACTATGATCAGATGCAGGGTGAGATGAAAGTATGCGCCAA CTCTCACTACGGCGTGAGCCAGAGTCTCTGTCAGCATCTGACTACTTGGTCCGGACGCCAAAAGATTCTGCTGGTCGAGAACGCTGTAAAACACACTCCGGGTATGACTGTGGTGTACGGA-3' (SEQ ID No.4).

[0085] The sequence of the upstream ribonucleotide embedded hairpin primer is as follows:

[0086] 5'-CAAGGAATACCCGCACAGCGAATCGCTGTGCGGGTATTCCTTGaAGAAACTGCGTGCTGCTC-3' (SEQ ID No. 5).

[0087] The sequence of the downstream ribonucleotide embedded hairpin primer is as follows:

[0088] 5'-TCGCTTGCGGGTATTCCTTGACAAGGAATACCCGCACAGCGAaACCGACCTCTCGGTTCTT-3' (SEQ ID No. 6).

[0089] The experimental results are as follows Figure 6As shown in A, under the incubation condition of 60 °C, the isothermal amplification method of the present invention can stably detect as low as 10 0 The plasmid template containing the target nucleic acid sequence T2 of the Cyprinus herpesvirus type II (CyHV2) polymerase gene at the same copy number / μL showed an exponential real-time fluorescence change curve, while the fluorescence of the NC control group containing the non-target plasmid template containing the nucleic acid sequence T1 of the ATPase gene of the decapod shrimp iris disease virus (DIV1) did not change with time. At the same time, a scatter histogram was constructed with the time threshold as the vertical axis and the concentration value as the horizontal axis. Figure 6 As shown in B, three repeated tests can stably measure the value as low as 10 0 The time threshold of the plasmid template containing the target nucleic acid sequence T2 of the Cyprinus herpesvirus type Ⅱ (CyHV2) polymerase gene was 0.01447 copies / μL, while the NC control group containing the non-target plasmid template containing the nucleic acid sequence T1 of the ATPase gene of the decapod shrimp iris disease virus (DIV1) had no time threshold. In addition, the amplified products were analyzed by agarose gel electrophoresis, and the results were as follows. Figure 7 As shown, all amplification products of plasmid templates containing the target nucleic acid sequence T2 of the Cyprinus cyprinid herpesvirus type Ⅱ (CyHV2) polymerase gene had obvious large fragments (greater than 1500 bp), while the NC control group containing the non-target plasmid template containing the nucleic acid sequence T1 of the ATPase gene of the decapod shrimp iris disease virus (DIV1) had no large fragment products. Therefore, the above results show that the method of the present invention has high sensitivity and high specificity for the amplification of the target nucleic acid sequence T2 of the Cyprinus cyprinid herpesvirus type Ⅱ (CyHV2) polymerase gene using the Bst DNA polymerase large fragment.

Claims

1. A high-efficiency ribonuclease double-primer isothermal amplification method, characterized in that: The method comprises pairing a ribonucleotide-embedded hairpin primer with a target nucleic acid sequence and extending the primer under the action of a strand-displacing DNA polymerase, ribonuclease-mediated cleavage and extension, and an amplification product in which the 3′-end sequence can undergo intramolecular hybridization, autonomously extending the primer and serving as a substrate for exponential cyclic amplification mediated by other primer pairing. The reagents used in the ribonuclease double-primer isothermal amplification method comprise an upstream ribonucleotide-embedded hairpin primer, a downstream ribonucleotide-embedded hairpin primer, a strand-displacing DNA polymerase, a ribonuclease, a nucleic acid-intercalating dye, and a target nucleic acid sequence. The upstream or downstream ribonucleotide-embedded hairpin primer is composed of a 5′-end hairpin sequence, a 3′-end linear sequence, and a ribonucleotide embedded therebetween. The 5′-end hairpin sequence is composed of two complementary target nucleic acid sequence sites, and the 3′-end linear sequence is composed of a single target nucleic acid sequence site. The isothermal amplification process is exemplified by the example of an upstream ribonucleotide embedded hairpin primer first recognizing the target nucleic acid sequence and initiating amplification. The amplification process initiated by the downstream ribonucleotide embedded hairpin primer is similar, including: a) The upstream ribonucleotide-embedded hairpin primer, under the action of strand-displacing DNA polymerase, recognizes the upstream site of the target nucleic acid sequence and, using the target nucleic acid sequence as a template, extends along the 5′ end of the target nucleic acid sequence. The extension product further opens the target nucleic acid sequence to form a double-stranded product containing a hairpin structure, i.e., a hairpin double-stranded product; b) a new upstream ribonucleotide intercalating hairpin primer recognizes the upstream site of the double-stranded hairpin product in step a), and a downstream ribonucleotide intercalating hairpin primer recognizes the downstream site of the double-stranded hairpin product in step a), and primers are extended and displaced by a strand-displacing DNA polymerase, respectively, to generate the same double-stranded hairpin product as that in step a), thereby forming a cyclic process. Simultaneously, an amplification product is generated, which has a double-stranded structure with an intercalating ribonucleotide at one end and a hairpin structure at the other end, i.e., a substrate for ribonuclease-mediated cleavage. c) the substrate cleaved by the ribonuclease in step b) is recognized by the ribonuclease, which cleaves the phosphodiester bond between the ribonucleotide and the deoxyribonucleotide to form a gap containing a hydroxyl terminus, wherein the hydroxyl terminus can serve as a primer to be extended and displaced by the strand-displacing DNA polymerase to form a double-stranded extension product embedded with the ribonucleotide; d) the double-stranded extension product in step c) is again recognized and cleaved by ribonuclease to form a nick containing a hydroxyl terminus. Similarly, the hydroxyl terminus can serve as a primer and be extended and displaced by a strand-displacing DNA polymerase to form a double-stranded extension product and a hairpin double-stranded product having a double-stranded ribonucleotide at one end and a hairpin structure at the other end; e) the 3′ end sequence of the double-stranded hairpin product described in step d) can undergo intramolecular hybridization, i.e., self-matching, and the amplified product can be recognized and matched by upstream and downstream ribonucleotide intercalating hairpin primers, i.e., primer matching. After self-matching and primer matching, the amplified product is extended and displaced by a strand-displacing DNA polymerase, thereby generating a core product of exponential cyclic amplification. Similarly, the double-stranded extension product described in step d) is recognized and extended by upstream and downstream ribonucleotide intercalating hairpin primers as a substrate, thereby generating a core product of exponential cyclic amplification. f) The core product of the exponential cyclic amplification in step e) enters exponential cyclic amplification under the joint action of upstream and downstream ribonucleotide intercalating hairpin primers and strand displacement DNA polymerase.

2. The high-efficiency ribonuclease double-primer isothermal amplification method according to claim 1, characterized in that: The 5′-end hairpin sequence consists of two complementary target nucleic acid sequence sites, the number of nucleotides in the target nucleic acid sequence sites is greater than or equal to 10 and less than or equal to 100, and the 3′-end linear sequence consists of a single target nucleic acid sequence site, the number of nucleotides in the single target nucleic acid sequence site is greater than or equal to 10 and less than or equal to 100.

3. The high-efficiency ribonuclease double-primer isothermal amplification method according to claim 1, characterized in that: The number of the embedded ribonucleotides is greater than or equal to 1 and less than or equal to 25.

4. The high-efficiency ribonuclease double-primer isothermal amplification method according to claim 1, characterized in that: The ribonuclease is ribonuclease H1 (or HI), ribonuclease H2 (or HII), ribonuclease H3 (HIII), or retroviral ribonuclease H.

5. The high-efficiency ribonuclease double-primer isothermal amplification method according to claim 1, characterized in that: The target nucleic acid sequence is a DNA sequence in a sample, an RNA sequence in a sample, a mixed sequence of DNA and RNA in a sample, or a pre-amplification reaction product of a DNA or RNA sequence in a sample.

6. A high-efficiency ribonuclease double-primer isothermal amplification method according to claim 5, characterized in that: The pre-amplification reaction includes at least one of a multi-enzyme isothermal rapid nucleic acid amplification (MIRA) reaction, a recombinase-mediated isothermal nucleic acid amplification (RAA) reaction, a recombinase polymerase amplification (MIRA) reaction, a loop-mediated isothermal amplification (LAMP) reaction, a cross primer amplification (CPA) reaction, a rolling circle amplification (RCA) reaction, a helicase-dependent amplification (HDA) reaction, a nucleic acid sequence-dependent amplification (NASBA) reaction, a recombinase transcriptase-mediated isothermal amplification reaction, and a strand displacement amplification (SDA) reaction.

7. The high-efficiency ribonuclease double-primer isothermal amplification method according to claim 1, characterized in that: The strand displacement DNA polymerase is at least one of Bacillus stearothermophilus DNA polymerase, Bacillus smithii DNA polymerase, Bacillus subtilis DNA polymerase, phi29 DNA polymerase and Vent (exo-) DNA polymerase.

8. The high-efficiency ribonuclease double-primer isothermal amplification method according to claim 1, characterized in that: The nucleic acid intercalating dye is one of the SYBR Green series, SYTO series and EvaGreen series.

9. A high-efficiency ribonuclease double-primer isothermal amplification kit, characterized in that: The main components of the kit include the upstream and downstream ribonucleotide intercalating hairpin primers according to any one of claims 1 to 8, a strand displacement DNA polymerase, a ribonuclease, and a nucleic acid intercalating dye.

10. The high-efficiency ribonuclease double-primer isothermal amplification kit according to claim 9, characterized in that: The main components of the kit also include reaction buffer, dNTPs, betaine and / or magnesium ions.