Gender-specific molecular markers of the riverine goby, oxyeleotris marmoratus, and their applications

Abstract

The application belongs to the technical field of molecular biology and aquaculture, and discloses a gender-specific molecular marker of Trigonostigma heteromorpha Odontobutis potamophila ) and application thereof. The molecular marker provided by the application is directly derived from the gender determination region of Trigonostigma heteromorpha, is closely linked to the gender phenotype, is accurate and reliable in identification result, and the accuracy can reach 100%. Only a small amount of tissue samples (such as fin bar, scale, muscle or blood) of Trigonostigma heteromorpha is needed to extract sufficient DNA for detection, which does not harm the brood fish and guarantees the integrity of the breeding material. The application provides strong technical support for the all-male / all-female breeding, family construction, growth and gender relationship research and production management of Trigonostigma heteromorpha, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and aquaculture technology, specifically relating to sex-specific molecular markers of the river goby (Odontobutispota mophila) and their applications. Background Technology

[0002] The river goby is a freshwater fish of high economic value, belonging to the order Perciformes and family Channidae. Its flesh is tender, delicious, and highly nutritious, and it has no intramuscular bones, making it very popular with consumers. With the continuous growth of market demand, the artificial breeding industry of river gobies has developed rapidly. In the process of industrialized breeding and genetic propagation of river gobies, precise sex control and identification techniques are the core links to improve economic benefits and achieve germplasm innovation.

[0003] However, current methods for sex determination in river goby are still very primitive, severely hindering the development of its industry. Traditional methods mainly rely on observing the external morphology of adult fish, but this method is highly subjective, has low accuracy, and cannot identify fry or juveniles. Another accurate method is to dissect and observe the gonads, but this is fatal to the fish and cannot be applied to the selection of live parent fish.

[0004] Despite the significant success of molecular marker technology in other fish species, prior to this invention application, no publicly reported or patent applications for sex-specific molecular markers for the river goby have been found, either domestically or internationally. This technological gap prevents aquaculture farmers and breeders of the river goby from implementing precise sex management. Therefore, this invention, through the most reliable technical approach, develops the first sex-specific molecular marker for the river goby, representing a crucial step in filling this technological gap and overcoming bottlenecks in industry development. It possesses significant theoretical importance and broad market application prospects. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a molecular marker that can accurately, quickly and easily identify the sex of the river goby (Odontobutis potamophila). The molecular marker is a DNA fragment, and the polynucleotide sequence of the fragment is shown in SEQ ID NO.1.

[0006] Another object of the present invention is to provide a reagent for detecting the polynucleotide sequence described in SEQ ID NO.1.

[0007] The final object of the present invention is to provide the application of the above-mentioned DNA fragment or reagent for detecting the above-mentioned DNA fragment in the sex identification of river goby.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] The applicant used a whole-genome resequencing strategy to perform deep sequencing and comprehensive comparison of the complete genomes of male and female populations of river goby, and finally obtained a DNA fragment specific to male river goby. The polynucleotide sequence of the fragment is shown in SEQ ID NO.1.

[0010] The scope of protection of this invention includes:

[0011] A reagent for detecting the polynucleotide sequence described in SEQ ID NO.1.

[0012] The reagents described above are preferably primers.

[0013] The reagents described above preferably use primers of 5'-TCTTAGTTGAGCAATGTT-3' and 5'-GTATCCTATAATAGATATGGAT-3'.

[0014] Application of the reagent for detecting the polynucleotide sequence described in SEQ ID NO.1 in sex determination of the river goby;

[0015] The above-described applications, specifically, include the following application processes:

[0016] The genomic DNA of the river goby was detected using a reagent. If the reagent detected the presence of the polynucleotide shown in SEQ ID NO.1 in the DNA of the river goby, the river goby was determined to be male; if it was not detected, the river goby was determined to be female.

[0017] Application of the reagent for detecting the polynucleotide sequence described in SEQ ID NO.1 in the preparation of a sex identification kit for river goby.

[0018] Application of reagents for detecting the polynucleotide sequence described in SEQ ID NO.1 in the breeding of river goby.

[0019] Compared with the prior art, the present invention has the following significant advantages:

[0020] 1. High accuracy: The molecular markers provided by this invention are directly derived from the sex-determining region of the river goby and are closely linked to the sex phenotype, resulting in accurate and reliable identification results with an accuracy rate of up to 100%.

[0021] 2. Wide applicability: This method is not limited by the individual development stage and season of river goby, and can accurately identify the sex of individuals at different stages such as eggs, fry, juveniles and adults.

[0022] 3. Simple and fast operation: It only requires routine DNA extraction and PCR amplification, with low requirements for experimental equipment and personnel skills. The entire identification process can be completed within a few hours, making it suitable for large-scale sample screening.

[0023] 4. Minimally invasive or non-invasive sampling: Only a small amount of river goby tissue sample (such as fin rays, scales, muscle or blood) is needed to extract enough DNA for testing, without harming the parent fish and ensuring the integrity of the breeding material.

[0024] 5. Immense application value: It provides strong technical support for all-male / all-female breeding, family construction, growth and sex relationship research, and aquaculture production management of river sand goby, and has broad application prospects. Attached Figure Description

[0025] Figure 1 This image shows the agarose gel electrophoresis results of PCR amplification products from different river goby samples using sex-specific primers, as described in this embodiment of the invention.

[0026] In this context, M stands for DNA Marker; lanes 1-7 are female river goby samples; and lanes 9-15 are male river goby samples. Detailed Implementation

[0027] The present invention will be further described in detail below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made in accordance with the content of the present invention shall fall within the scope of protection of the present invention.

[0028] Example 1:

[0029] Screening of sex-specific molecular markers in river goby:

[0030] 1. Experimental Materials

[0031] Sixty healthy adult river goby fish were selected. Dissection and observation of their gonads identified 24 females and 36 males. Caudal fin tissue was collected and preserved in 95% ethanol for subsequent genomic DNA extraction.

[0032] 2. Genome resequencing and differential region screening

[0033] Genomic DNA was extracted from the 60 samples using the phenol-chloroform method. Sequencing libraries were constructed from 10 male and 10 female samples, and whole-genome resequencing was performed using the BGI Genomics T7 platform.

[0034] After quality control of the raw data, the data were aligned to the reference genome of *Cyprinus scutellarioides* using BWA software. SNP detection and genotyping were performed using GATK software. By comparing the SNP data of 10 male and 10 female samples, SNP loci consistent in all males but absent in all females, along with their corresponding genomic regions, were identified as candidate male-specific regions.

[0035] 3. Primer design and synthesis

[0036] Based on the selected male-specific regions, PCR primers were designed using Primer Premier 5.0 software. The designed primers were 5'-TCTTAGTTGAGCAATGTT-3' and 5'-GTATCCTATAATAGATATGGAT-3'.

[0037] Example 2:

[0038] Method for identifying the sex of river goby using detection primers obtained in Example 1:

[0039] (1) Extracting genomic DNA from river goby;

[0040] (2) PCR amplification and verification

[0041] Set up a 25 μL PCR reaction system: 12.5 μL of 2×Taq PCR MasterMix, 1 μL of forward primer F (10 μM), 1 μL of reverse primer R (10 μM), 1 μL of genomic DNA template (approximately 50 ng / μL), and ddH2O to bring the total volume to 25 μL.

[0042] The PCR amplification program was as follows: pre-denaturation at 94℃ for 3 min; then denaturation at 94℃ for 30 s, annealing at 52℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles; and finally extension at 72℃ for 5 min.

[0043] Take 5 μL of PCR product and perform electrophoresis on a 1.5% agarose gel at 120 V for 30 min. Observe and photograph using a gel imaging system. Products with only a 192 bp specific band are male, while those without the band are female.

[0044] The amplified 192bp specific band DNA fragment is shown in SEQ ID NO.1, specifically as follows: 5'-TCTTAGTTGAGCAATGTTTTTCAGATGGTAAAGAGCTGACGATGCTAAGTCAGAGT ACGTGGCGAAGGCTAGATGTCGGTGTTTTCTCTGTTTTGTTGTTGAAGATTGATTAGAT CTGTCTGATGCCATGAAACAGTGAGTTTATATTCACCTGCTGTGAGTTATTTGTAATCCA TATCTATTATAGGATAC-3'

[0045] Example 3:

[0046] Application of the reagent for detecting the polynucleotide sequence described in SEQ ID NO.1 in sex determination of the river goby:

[0047] DNA from 7 samples each of the remaining 14 female and 26 male samples from Example 1 was selected for PCR amplification. The primers and PCR system used were as shown in Example 2.

[0048] PCR amplification and electrophoresis results are as follows Figure 1 As shown, all seven male samples amplified a clear, bright, single target band, approximately 192 bp in size, consistent with the expected size. However, none of the seven female samples amplified this band. These results demonstrate that the primer pairs designed in this invention can stably and specifically identify the sex of the river goby.

Claims

1. A male river goby ( Odontobutis potamophila A specific DNA fragment, the polynucleotide sequence of which is shown in SEQ ID NO.

1.

2. A primer for detecting the DNA fragment of claim 1.

3. The primer of claim 2, wherein the primer is 5'- TCTTAGTTGAGCAATGTT-3' and 5'- GTATCCTATAATAGATATGGAT-3'.

4. Use of the primer of claim 2 in sex identification of Odontobutis potamophila.

5. The use of claim 4, wherein the use process comprises: detecting the genomic DNA of Odontobutis potamophila by using the primer of claim 2, and if the reagent detects the polynucleotide of SEQ ID NO. 1 in the DNA of Odontobutis potamophila, it is determined that the Odontobutis potamophila is a male fish, and if it is not detected, it is determined that the Odontobutis potamophila is a female fish.

6. Use of the primer of claim 2 in preparation of a kit for sex identification of Odontobutis potamophila.

7. Use of the primer of claim 2 in breeding of Odontobutis potamophila. ​

Images