Application of iolE gene in improving the ability of plant growth promoting rhizobacteria to promote symbiotic nitrogen fixation

Abstract

The application discloses application of an iolE gene in improving the symbiotic nitrogen fixation capacity of plant growth promoting bacteria, and application of the iolE gene or a protein coded by the iolE gene in at least one of the following (a1)-(a3): (a1) improving the symbiotic nitrogen fixation capacity of plant growth promoting bacteria; (a2) improving the efficiency of nodule formation and nitrogen fixation of host plants by plant growth promoting bacteria assisting rhizobium; and (a3) constructing recombinant bacteria with improved symbiotic nitrogen fixation capacity. The discovery of the application can be used for targeted modification of a target gene iolE, and provides a theoretical basis for development of high-efficiency genetically engineered bacterial agents; can be applied to research on other PGPR functional genes, and promotes the development of agricultural microbial technology.

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial genetic engineering technology, specifically involving the application of the iolE gene in improving the symbiotic nitrogen fixation ability of plant growth-promoting bacteria, especially in improving the efficiency of plant growth-promoting bacteria in assisting rhizobia to enhance the nodulation and nitrogen fixation efficiency of host plants. Background Technology

[0002] Adequate nitrogen supply is a key factor in ensuring high crop yields and quality. Globally, biological nitrogen fixation amounts to approximately 200 million tons annually, with the legume-rhizobium symbiotic system contributing over 50% of this demand, making it the most economical and efficient nitrogen source in nature. However, in actual agricultural production, the nodulation and nitrogen fixation efficiency of rhizobia are often constrained by multiple factors, including differences in nitrogen fixation capacity among strains, competition from indigenous rhizobia, and environmental stresses such as drought, low temperature, and soil acidification. Therefore, there is an urgent need to establish stable and efficient symbiotic nitrogen fixation systems.

[0003] To enhance symbiotic nitrogen fixation efficiency, plant rhizosphere growth-promoting bacteria (PGPRs) are often co-inoculated with rhizobia to exert a synergistic effect. Traditional PGPRs primarily promote symbiotic nitrogen fixation in rhizobia through indirect pathways, such as secreting indoleacetic acid (IAA) to stimulate root development, synthesizing ACC deaminase to alleviate ethylene's inhibition of nodulation, or dissolving inorganic phosphorus to improve rhizobium energy metabolism. However, existing mechanisms do not directly target the regulation of nitrogenase activity, and there is a lack of molecular evidence that PGPRs intervene in symbiotic nitrogen fixation through carbon source metabolism genes, indicating that this synergistic system still has significant development potential. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the iolE gene in enhancing the nitrogen-fixing ability of plant growth-promoting bacteria through symbiotic growth.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] In a first aspect, the present invention seeks protection for the use of the iolE gene, whose nucleotide sequence is shown in SEQ ID NO.1, or the protein encoded by said iolE gene, in at least one of the following (a1)-(a3):

[0007] (a1) Enhance the nitrogen-fixing ability of plant growth-promoting bacteria through symbiosis;

[0008] (a2) Enhance the efficiency of plant growth-promoting bacteria in assisting rhizobia to enhance the host plant's nodulation and nitrogen fixation;

[0009] (a3) Construct recombinant plant growth-promoting bacteria with enhanced symbiotic nitrogen fixation capacity.

[0010] Furthermore, the amino acid sequence of the protein encoded by the iolE gene is shown in SEQ ID NO.2.

[0011] Secondly, the present invention seeks protection for the use of biological materials containing the above-mentioned iolE gene in at least one of the following (a1)-(a3):

[0012] (a1) Enhance the nitrogen-fixing ability of plant growth-promoting bacteria through symbiosis;

[0013] (a2) Enhance the efficiency of plant growth-promoting bacteria in assisting rhizobia to enhance the host plant's nodulation and nitrogen fixation;

[0014] (a3) Construct recombinant plant growth-promoting bacteria with enhanced symbiotic nitrogen fixation capacity.

[0015] Furthermore, the biological material containing the iolE gene is at least one of the following (b1)-(b4):

[0016] (b1) An expression cassette containing the iolE gene;

[0017] (b2) A recombinant vector containing the iolE gene, or a recombinant vector containing the expression cassette (b1);

[0018] (b3) A recombinant microorganism containing the iolE gene, or a recombinant microorganism containing the expression cassette of (b1), or a recombinant microorganism containing the recombinant vector of (b2);

[0019] (b4) A transgenic cell line containing the iolE gene, or a transgenic cell line containing the expression cassette of (b1), or a transgenic cell line containing the recombinant vector of (b2).

[0020] Furthermore, the above application is as follows: using the iolE gene as the target gene, through genetic engineering methods, overexpressing the iolE gene in the target plant growth-promoting bacteria or increasing the level or content of the protein encoded by the iolE gene, thereby improving the symbiotic nitrogen-fixing ability of the plant growth-promoting bacteria, or improving the efficiency of plant growth-promoting bacteria in assisting rhizobia to enhance the host plant's nodulation and nitrogen fixation.

[0021] Thirdly, the present invention claims protection for a recombinant plant growth-promoting bacterium, which is constructed by overexpressing the iolE gene in a target plant growth-promoting bacterium, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0022] Fourthly, the present invention claims protection for a highly efficient nitrogen-fixing bacterial agent, which contains the aforementioned recombinant plant growth-promoting bacteria.

[0023] Fifthly, the present invention claims protection for a method for enhancing the nodulation and nitrogen fixation efficiency of a host plant, wherein the aforementioned plant growth-promoting recombinant bacteria are co-inoculated with rhizobia into the roots of the host plant.

[0024] In a specific embodiment of the present invention, the host plant described in the above technical solution is soybean.

[0025] This invention reveals that the plant growth-promoting bacteria strain THD10 significantly enhances the symbiotic nitrogen fixation ability of soybean rhizobium CCBAU45436 in both conventional and saline soil environments. Using transposon random insertion mutation technology, a mutant strain losing its symbiotic nitrogen fixation ability was screened. Further investigation confirmed that knockout of the key inositol metabolism gene iolE leads to the loss of growth-promoting ability, while overexpression of iolE significantly increases the nitrogenase activity of rhizobium, with a growth-promoting effect far exceeding that of the control group. This study is the first to reveal the molecular mechanism by which plant rhizosphere growth-promoting bacteria can directly regulate symbiotic nitrogen fixation through carbon source metabolism genes, providing a theoretical basis and application potential for improving the nitrogen fixation efficiency of rhizobium using iolE-engineered strains.

[0026] This invention reveals the molecular mechanism by which the iolE gene in the plant growth-promoting bacteria strain THD10 regulates symbiotic nitrogen fixation through the following research process:

[0027] (1) Gene screening and identification: ① Construct a random insertion mutant library of THD10 transposons; ② Establish an efficient screening system based on plant height, aboveground fresh weight and dry weight phenotypes, and use plant height, aboveground fresh weight and dry weight as phenotypes to screen for functional defect mutants; ③ Identify the key gene iolE by random PCR amplification and sequencing to locate the insertion site.

[0028] (2) Gene function verification: ① Construct iolE gene knockout strains and overexpression strains; ② Phenotypic analysis showed that the absence of iolE led to the loss of growth-promoting ability, while the engineered strains that overexpressed iolE significantly enhanced the nitrogenase activity of rhizobia and had a better growth-promoting effect than the wild type.

[0029] (3) Innovative discovery: For the first time, it was demonstrated that PGPR can directly regulate plant-rhizobium symbiotic nitrogen fixation through the inositol metabolism gene iolE, providing a new target for the study of microbial-plant interaction mechanism and the development of efficient nitrogen-fixing bacteria agents.

[0030] The beneficial effects of this invention are:

[0031] 1. The target gene iolE, which can be directionally modified, was discovered, providing a theoretical basis for the development of highly efficient genetically engineered bacterial agents;

[0032] 2. The method can be extended to other PGPR functional gene studies, promoting the development of agricultural microbial technology. Attached Figure Description

[0033] Figure 1 Flowchart for constructing THD10 mutant libraries using transposon random insertion method.

[0034] Figure 2Comparison of soybean plant growth between the THD10-1 and THD10-2 transposon insertion mutant candidate groups and the control group.

[0035] Figure 3 Plant height, aboveground fresh weight, and aboveground dry weight of soybean plants were measured in different treatment groups. Here, A represents plant height, B represents aboveground fresh weight, and C represents aboveground dry weight. One-way ANOVA was used to detect differences between treatments (same letter: P>0.05, different letter: P<0.05). Error bars represent the mean ± standard deviation.

[0036] Figure 4 Electrophoresis images of the PCR products of mutant strains THD10-1 and THD10-2.

[0037] Figure 5 The role of the THD10-2 transposon insertion gene and its encoded protein.

[0038] Figure 6 This is a PCR electrophoresis image of the iolE gene overexpressing strain THD10(pYC12-iolE).

[0039] Figure 7 The growth of soybean plants in different treatment groups.

[0040] Figure 8 Physiological indicators of soybean plants in different treatment groups are shown below. A represents plant height, B represents aboveground fresh weight, C represents aboveground dry weight, D represents nitrogenase activity, E represents underground fresh weight, F represents underground dry weight, G represents root nodule fresh weight, and H represents nodule number. One-way ANOVA was used to detect differences between treatments (same letter: P>0.05, different letter: P<0.05). Error bars represent mean ± standard deviation. Detailed Implementation

[0041] The present invention will be further illustrated below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0042] Example 1: Construction of a transposon mutant library

[0043] ① Single colonies of recipient strain THD10 (CGMCC NO: 29193) and donor strain SM10λpir (pSC123) were inoculated into LB medium (Chen Haili et al. Screening and function of genes regulating aphB in Vibrio cholerae. Acta Microbiologica Sinica, 2012, 52(2):256-261.), and cultured at 37℃ and 180 r / min in a constant temperature shaker until OD. 600 The value is 1.0. Transfer the bacterial culture into a sterile centrifuge tube, centrifuge at 10000 r / min at room temperature for 2 minutes, discard the supernatant, and resuspend the bacterial cells in an equal volume of LB medium. Repeat this step 3 times, and finally resuspend in 100 µL of sterile water.

[0044] The recipient bacterial strain THD10 involved in this experiment is an Enterobacter strain, classified as Enterobacter ludwigii. This strain was deposited on November 30, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the accession number CGMCC NO.29193.

[0045] ② Spread a sterile filter membrane with a pore size of 0.22 μm on LB solid medium without antibiotics. Take 80 µL each of the donor and recipient bacterial cultures and mix them on the filter membrane. Spot the remaining donor and recipient bacterial cultures onto separate filter membranes. After allowing the bacterial cultures to be absorbed, place the plates in a 37°C incubator and incubate upright for 24 hours.

[0046] ③ Use sterile forceps to remove the filter membranes containing the donor, recipient, and donor-recipient mixture, and place them into the corresponding centrifuge tubes containing 1 mL of LB medium. Shake on a shaker until the bacteria are completely mixed in the LB medium.

[0047] ④ Dilute the bacterial suspension serially and spread it on LB agar plates containing the corresponding antibiotics. Simultaneously spread donor and recipient bacterial suspensions as controls. Incubate overnight at 37°C. If neither the donor nor recipient bacteria grow, but the zygote grows normally, then zygote conjugation is successful.

[0048] The flowchart for constructing a THD10 mutant library using the transposon random insertion method is shown below. Figure 1 .

[0049] Example 2: Screening for soybean-rhizobium-growth-promoting bacteria interaction significantly reduced the growth-promoting effect in mutant strains.

[0050] ① Select soybean seeds that are undamaged, plump, and uniform in size, and place them in a sterile empty conical flask. Wash them three times with sterile water. Add 95% (v / v) ethanol until the soybean seeds are completely submerged, gently shake and soak for 10 minutes, then wash them six times with sterile water. Add 2% (v / v, volume dilution ratio) NaClO solution until the soybean seeds are completely submerged, gently shake and soak for 3 minutes, then wash them six times with sterile water.

[0051] ② Use sterile tweezers to separate soybean seeds and place them on water agar medium. Seal the seeds with sealing film, place them in a 28℃ incubator in the dark, and germinate until they sprout.

[0052] ③ Prepare Farhaeus nitrogen-free culture medium. The macroelements are prepared as a 100-fold concentrated stock solution: CaCl2 13.2 g / L, MgSO4·7H2O 12 g / L, KH2PO4 1 g / L, Na2HPO4·12H2O 33.23 g / L, C6H5FeO4 5 g / L; the microelements are prepared as a 1000-fold concentrated stock solution: ZnCl2 0.1 g / L, CuSO4·5H2O 0.156 g / L, H3BO3 0.1 g / L, MnCl2·4H2O 0.157 g / L, NaMoO4·2H2O 0.117 g / L. Each element should be diluted to a single concentration before use.

[0053] ④ Preparation of slant culture medium and vermiculite culture system: For the slant culture medium, dispense 35 mL of Farhaeus nitrogen-free nutrient solution into 3 cm × 20 cm glass test tubes, add 0.35 g of agar powder to each tube, and seal with cotton plugs. After autoclaving, shake thoroughly and tilt to prepare. For the vermiculite culture system, add 2 / 3 volume of vermiculite to each glass test tube, add 40 mL of Farhaeus nitrogen-free nutrient solution to each tube, seal with cotton plugs, and sterilize at 121℃ for 20 min.

[0054] ⑤ Select soybean seeds with good germination and similar growth (root length approximately 3-4 cm). For slant culture medium, gently pick up soybean seeds with sterile forceps, place them at 2 / 3 of the slant medium with the root tip facing down, and tilt them. For vermiculite culture system, gently pick up soybean seeds with sterile forceps, place them 1 cm below the vermiculite with the root tip facing down, and gently cover them with vermiculite substrate. Before use in the greenhouse, conduct a sealed disinfection treatment, spraying three times with a 5% (v / v, volume dilution ratio) NaClO solution, spraying once with an insecticide, and hanging sticky insect traps. Set the temperature at 28℃-30℃, while maintaining humidity at 40%-60%. Set a light condition of 16 hours of light and 8 hours of darkness. During the cultivation period, use sterile forceps to remove the true leaves of soybean plants from the glass test tube opening in a timely manner, and replenish nutrient solution to the middle of the plant roots promptly.

[0055] ⑥ After the soybean plants have grown their first true leaves, conduct soybean re-inoculation experiments according to the treatments in Table 1. Culture the rhizobia and growth-promoting bacteria overnight, wash the bacterial solution twice with sterile water, and adjust the OD value to [value missing]. 600 =1.0, and then diluted 10 times to 10. 8 CFU / mL concentration. Inoculate the bacterial solution evenly onto the roots of soybean plants.

[0056] Table 1. Screening test groups for soybean-rhizobium-growth-promoting bacteria interaction

[0057]

[0058] ⑧ Soybean growth index detection: Four weeks after inoculation with rhizobia, the distance from the cotyledon to the top leaf of the plant was measured with a ruler and recorded as the plant height. The above-ground parts of the plants were cut and weighed using a balance, and the fresh weight of the above-ground parts was recorded. The plants were then placed in kraft paper bags, dried in a 60℃ oven, and weighed using an analytical balance, and the dry weight of the above-ground parts was recorded. The growth of soybean plants in different treatment groups is shown in the figure. Figure 2 .

[0059] ⑨ Two mutant strains, THD10-1 and THD10-2, with significantly reduced growth-promoting effects in various indicators were screened and selected as candidate strains. Compared with single inoculation with rhizobium CCBAU45436, co-inoculation with the wild-type THD10 strain significantly increased soybean plant height and aboveground dry weight by approximately 35% and 21% (P<0.05), respectively, while increasing aboveground fresh weight by approximately 13% (P>0.05). Inoculation with the candidate mutant strain THD10-1 showed no significant difference in plant height and aboveground fresh weight (P>0.05). Inoculation with the candidate mutant strain THD10-2 showed no significant increase in plant height, aboveground fresh weight, or aboveground dry weight (P>0.05). Figure 3 ).

[0060] Example 3: Identification of key mutant genes in strains with significantly reduced growth-promoting effects.

[0061] ① Extraction of genomic DNA from candidate strains: After overnight culture, the candidate strains were centrifuged at 12000 r / min for 3 min, and the bacterial cells were collected and the supernatant discarded. The cells were resuspended in 1 mL ddH2O and washed twice by centrifugation. The bacterial cells were resuspended in 270 μL 1×TE buffer, and lysed in an ice bath for 30 min with 15 μL lysozyme (50 mg / mL). Then, 20 μL 10% (w / v, g / 100 mL) SDS solution and 4 μL proteinase K (100 μg / mL) were added, and the mixture was incubated at 37℃ for 30 min. After adding 200 μL pre-chilled NaCl solution (5 mol / L) and mixing well, extraction was performed with 500 μL phenol:chloroform:isoamyl alcohol (25:24:1, v:v:v), centrifuged at 12000 r / min for 10 min, and 400 μL of the supernatant was used for a second organic phase extraction. Finally, 300 μL of supernatant was added to 240 μL of 1×TE buffer and 300 μL of isopropanol, precipitated at -70℃ for 30 min, and then centrifuged to collect DNA. The precipitate was washed three times with pre-cooled 75% ethanol, air-dried at room temperature, dissolved in 20 μL of ddH2O, and stored at 4℃ for later use.

[0062] ② Two-round random primer PCR. The first round of PCR amplification used the candidate strain's genome as a template. The first 6 cycles were performed under non-strict conditions, and the subsequent 30 cycles were performed under strict conditions. The PCR program was as follows: 95℃, 5 min; 94℃, 30 s, 30℃, 0.5 min, 72℃, 1 min: 6 cycles; 94℃, 30 s, 55℃, 0.5 min, 72℃, 1 min: 30 cycles; 72℃, 5 min. The PCR primer sequences are shown in Table 2.

[0063] Table 2 Overlapping PCR Primer Sequences

[0064]

[0065] PCR reaction system: 2×PCR Taq master Mix 10 µL, pSC123-1 1 µL, ARB1 0.5 µL, ARB6 0.5 µL, DNA 1 µL, ddH2O 7.0 µL, Total volume 20 µL.

[0066] The second round of PCR was performed using the products from the first round of PCR as a template. The PCR program was as follows: 95℃, 5 min; 94℃, 30 s, 55℃, 0.5 min, 72℃, 1 min: 30 cycles; 72℃, 5 min; 12℃, 5 min.

[0067] The reaction system consisted of: 2×PCR Taq master Mix 25 µL, pSC123-2 2 µL, ARB2 2 µL, DNA from round 1 1 µL, ddH2O 20 µL, and a total volume of 50 µL.

[0068] ③ The second batch of products was subjected to electrophoretic detection. Figure 4 Samples with large and bright bands were selected for gel recovery and sequencing analysis, with pSC123-2 primers used for sequencing.

[0069] ④ The transposon insertion site was determined by homology alignment of the sequencing results in the NCBI database. Experimental results showed that the ipdC and iolE genes were inserted and inactivated in the mutant strains THD10-1 and THD10-2, respectively. The ipdC gene encodes indolepyruvate decarboxylase, a key enzyme catalyzing the decarboxylation of indole-3-pyruvate (IPyA) in the auxin indole-3-acetic acid (IAA) biosynthesis pathway. The iolE gene encodes myo-inosose-2 dehydratase, responsible for catalyzing the dehydration of 2-ketoinositol to 3-D-(3,4 / 5)-trihydroxycyclohexane-1,2-dione in the inositol metabolic pathway. Figure 5 Given that IAA is an important plant growth promoter, the successful screening of the ipdC gene further demonstrates the feasibility of the screening system used in this experiment.

[0070] Example 4: Construction of gene knockout strains

[0071] ① Obtain the flanking sequence of the iolE gene by PCR: Based on the genome sequence, primers for amplifying the iolE gene knockout within the frame were designed using Clone Manager software. The corresponding primer sequences are shown in Table 3.

[0072] Table 3 Primer sequences for the iolE gene knockout within the boxes.

[0073]

[0074] Using the THD10 genome as a template, homologous arm fragments of the iolE gene were amplified by PCR. Primers 1 (iolE-P1-SacI, forward upstream primer) and 2 (iolE-P2, reverse upstream primer) were used to amplify fragment 12 (the upstream sequence of the iolE gene), while primers 3 (iolE-P3, forward downstream primer) and 4 (iolE-P4-XbaI, reverse downstream primer) were used to amplify fragment 34 (the downstream sequence of the iolE gene). The PCR reaction system is as follows:

[0075]

[0076] PCR reaction conditions: pre-denaturation 95 ℃, 5 min; denaturation 94 ℃, 30 s; annealing 55 ℃, 30 s; extension 72 ℃, 50 s (30 cycles); end extension 72 ℃, 5 min; 12 ℃, 1 min.

[0077] Fragments 12 and 34 of the iolE gene obtained by PCR were purified and recovered by ethanol cryoprecipitation.

[0078] ② Overlapping PCR to obtain homologous arms of the iolE gene: Using purified fragments 12 and 34 as templates, fragment 14 was amplified. The PCR system is as follows:

[0079]

[0080] Overlapping PCR reaction conditions:

[0081] (a) Pre-denaturation at 95℃ for 3 min;

[0082] (b) 95℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 1 min, cycled 30 times;

[0083] (c) Extend the tip at 72°C for 3 min;

[0084] (d) The reaction was stopped at 12℃ for 3 min;

[0085] ③ Construction of recombinant plasmid pJQ200SK-iolE: The purified 14 fragment and the vector pJQ200SK were double-digested with enzymes, and the digestion products were recovered after incubating in a water bath at 37℃ for 30 min. Double digestion reaction system:

[0086]

[0087] The purified enzyme digestion product was ligated with the vector and incubated overnight at 22°C. Enzyme ligation reaction system:

[0088]

[0089] The enzyme-ligated product was chemically transformed and plated on LB agar plates (Gen 20 μg / mL, X-gal 100 μg / mL), and incubated overnight at 37°C. Afterwards, white colonies were selected and streaked onto the same plates to reconfirm the blue-white pattern. Then, PCR was performed on the colonies using the vector primers pJQ200SK-F / R to verify whether the fragment was ligated into the vector.

[0090]

[0091] PCR reaction conditions: pre-denaturation 95℃, 5 min; denaturation 94℃, 30 s; annealing 55℃, 30 s; extension 72℃, 90 s (30 cycles); end extension 72℃, 5 min; 12℃, 1 min.

[0092] The positive strains were sequenced to ensure that there were no gene mutations. Finally, the correctly sequenced recombinant plasmid pJQ200SK-iolE was transformed into E. coli SM10λpir competent cells. After PCR verification, the correctly verified SM10λpir cells containing the recombinant plasmid were preserved in a -70 ℃ freezer with 25% glycerol.

[0093] ④ Obtaining iolE homologous exchange deletion strains: SM10λpir (pJQ200SK-iolE) was conjugated with THD10. The resulting conjugates were streaked onto LB agar plates containing 20 μg / mL Gen and 100 μg / mL Amp for single exchanger purification. Subsequently, single colonies were picked and streaked densely on antibiotic-free LB agar plates and incubated at 37°C for 12 h for double exchange. The bacterial colony was scraped and streaked in three zones on 10% sucrose LB agar plates. After incubation at 22°C for 36–48 h, Amp-sensitive strains were screened by streaking with LB agar plates containing 20 μg / mL Gen and 100 μg / mL Amp, and PCR verification was performed to obtain iolE gene deletion strains.

[0094] Example 5: Construction of overexpression strains

[0095] Primers for amplifying the full sequence of the iolE gene were designed based on the genomic sequence of THD10. The primer sequences are shown in Table 4.

[0096] Table 4 Primer sequences for amplifying the full-length iolE gene sequence

[0097]

[0098] ① Using total genomic DNA of THD10 as a template, the full sequence fragment of the iolE gene was amplified, the PCR product was recovered by ethanol freeze-precipitation, and the PCR product was digested with the vector pYC12 together with enzymes.

[0099] ② The enzyme-digested PCR product and pYC12 vector were recovered and ligated into enzymes in the correct proportions. The ligated product was then transferred to DH5αλpir competent cells and cultured at 37°C with shaking for 1 h before being plated onto LB agar plates containing Gen 20 μg / mL and X-gal. White single colonies were selected using blue-white screening for secondary streaking verification, and colony PCR was performed using the vector primers pYC12-F / R (primer sequences are shown in Table 5). PCR-positive clones were sequenced to ensure gene sequence accuracy. Positive strains were sequenced to ensure no gene mutations occurred. Finally, the correctly sequenced recombinant plasmid pYC12-iolE was transferred to E. coli SM10λpir competent cells. SM10λpir (pYC12-iolE) and wild-type THD10 were conjugated and plated onto LB agar plates containing Gen 20 μg / mL and Amp 100 μg / mL. The THD10(pYC12-iolE) strain was obtained and used for overexpression experiments. The PCR electrophoresis image is shown below. Figure 6 For specific PCR, enzyme digestion, and enzyme ligation systems, please refer to Example 4.

[0100] Table 5 Primer sequences for pYC12 vector

[0101]

[0102] Example 6: Validation of the effects of iolE gene mutants and overexpression strains

[0103] The verification process is the same as in Example 2, and the test treatment groups are shown in Table 6.

[0104] Table 6. Validation of the effects of iolE gene mutants and overexpression strains in treatment groups.

[0105]

[0106] Note: ΔiolE is a strain with the THD10-iolE gene deletion, and THD10(pYC12-iolE) is a strain with the THD10-iolE gene overexpression.

[0107] ①Verification of growth indicators: Plant growth in different treatment groups was observed. Figure 7 The steps are the same as in Example 2.

[0108] The results show that ( Figure 8Compared with co-inoculation with rhizobium CCBAU45436 and THD10, co-inoculation with rhizobium CCBAU45436 and ΔiolE resulted in a significant decrease in soybean plant height, aboveground fresh weight, and aboveground dry weight by approximately 26%, 33%, and 27%, respectively (P<0.05). Root fresh weight and root dry weight also decreased by approximately 27% and 34%, respectively (P<0.05).

[0109] Compared with co-inoculation with rhizobium CCBAU45436 and THD10, co-inoculation with rhizobium CCBAU45436 and THD10 (pYC12-iolE) significantly increased soybean plant height, aboveground fresh weight, and aboveground dry weight by approximately 21%, 42%, and 10%, respectively (P<0.05). Root fresh weight and root dry weight also significantly increased by approximately 10% and 25%, respectively (P<0.05).

[0110] Compared with co-inoculation with rhizobium CCBAU45436 and ΔiolE, co-inoculation with rhizobium CCBAU45436 and THD10(pYC12-iolE) significantly increased soybean plant height, aboveground fresh weight, and aboveground dry weight by approximately 63%, 113%, and 52%, respectively (P<0.05). Root fresh weight and root dry weight also significantly increased by approximately 51% and 89%, respectively (P<0.05).

[0111] ② Detection of nitrogenase activity in soybean root nodules: The nitrogenase activity in root nodules was determined using the acetylene reduction method four weeks after inoculation with rhizobia. Soybean plants were removed from the test tube culture medium, and the surface moisture of the roots was removed with absorbent paper. The plant roots were cut and placed in a 20 mL headspace vial. A small amount of solid nitrogen-free culture medium was added to the vial to maintain the moisture required for the root nodules. The cap was tightened to prevent air leakage. 2 mL of air was drawn from the headspace vial using a 2 mL syringe, while 2 mL of high-purity acetylene gas was injected. The vial was quickly sealed with sealing film to prevent gas leakage. The headspace vial was then inverted and incubated at 28℃ for 2 hours. After the reaction is complete, shake the headspace vial to ensure even distribution of the reactant gases. Use a 1 mL syringe to extract 1 mL of air from the sealed 2 mL headspace vial, simultaneously injecting 1 mL of reactant gas. Quickly seal the vial with sealing film. During detection, shake the headspace vial to ensure even distribution of the gas components. Use a 100 μL syringe to take 100 μL of the analyte gas and inject it into an Aglient 7890A gas chromatograph to detect the peak height and peak area of ​​acetylene and ethylene (Gas chromatograph operating requirements: Gas flow rate: N2—30 mL / min, H2—30 mL / min, air—300 mL / min; Detection temperature: 100℃; Column temperature: 100℃). After the sample reaction is complete, remove the root nodules from the root system with tweezers and count the number of nodules. Weigh them using an analytical balance and record the fresh weight of the nodules. Place them in an EP tube, dry them in a 60℃ oven, and weigh them again using an analytical balance to record the dry weight of the nodules. The formula for calculating nitrogenase activity is as follows:

[0112]

[0113] K—Ethylene peak area / Acetylene peak area

[0114] T—Absolute temperature

[0115] X—Room temperature during measurement

[0116] y—Atmospheric pressure during measurement

[0117] z—Acetylene injection volume (2 mL in this experiment)

[0118] W—Dry weight / fresh weight of the test sample (mg / g)

[0119] t—nitrogenase reaction time (2 h in this experiment)

[0120] 760—Standard Atmospheres

[0121] 22.4–1 gram of gas at standard atmospheric pressure at absolute temperature

[0122] The results show that ( Figure 8Compared with co-inoculation with rhizobium CCBAU45436 and THD10, co-inoculation with rhizobium CCBAU45436 and ΔiolE reduced the number of nodules and nitrogenase activity of soybean plants by approximately 21% and 18%, respectively, with no significant difference (P>0.05), while reducing the fresh weight of nodules of soybean plants by approximately 25%, with a significant difference (P<0.05).

[0123] Compared with co-inoculation with rhizobium CCBAU45436 and THD10, co-inoculation with rhizobium CCBAU45436 and THD10 (pYC12-iolE) increased the nodule fresh weight and nitrogenase activity of soybean plants by approximately 35% and 23%, respectively, with significant differences (P<0.05), while reducing the number of nodules by approximately 11%, with no significant difference (P>0.05).

[0124] Compared with co-inoculation with rhizobium CCBAU45436 and ΔiolE, co-inoculation with rhizobium CCBAU45436 and THD10(pYC12-iolE) increased the nodule fresh weight and nitrogenase activity of soybean plants by approximately 81% and 50%, respectively, with significant differences (P<0.05), while the nodule number of soybean plants increased by approximately 13%, with no significant difference (P>0.05).

[0125] iolE gene sequence (SEQ ID NO.1)

[0126] atgagtgtgcaattaggcattaacccgctgacatggacgaacgacgatctgccttcactcggcgcggagacgccgctggatacctgtctgagcgaagggaaagaggccggttttgccggtttcgaactgggcaataaattcccgcgtgaggcgcgcctgcttggccccattttgcagcgccacgatctgcagctggtctccggctggtattcagggcgtctgctggagcgtagcgtggaggaggagattgcctccgtgcagtcacacctgacgctgctgcgcgaactgggggctaaggtgctggtattcgccgaagtgagcggctgtattcacggcgagcaacagacgccggttcatcttcgcccgcgcttcccgcacgcgcgctggcaagagtacggcgagaagctgaccgcttttgcccgctacacgcagcagcagggggtgcagattgcctaccatcaccatatgggaacggtcattgagtccgctgaagatgtcgataacctgatgacccataccggtgaagaggtgggcctgctgctggacacgggccatctgacctttgccggggctgatccgctggcggtggcccagcgctgggcatcgcgcattaaccatgttcactgcaaagacgtgcgcgccgacgtgctggcggacgtcaaaaaccgcaaaaccagcttccttgatgcggtgctgagtggggtcttcaccgtaccgggtgacggctgcgtggactatccgcccatcatgcggctgctgaaggcgcaggattatcacggctggctggtggtggaggcagagcaggatcctgctatcgctcacccgctgacctacgcccgtctggggtataacaacctgagccgtctggtgcgcgacgccgggcttatctga

[0127] Amino acid sequence of the iolE gene (SEQ ID NO.2)

[0128] MSVQLGINPLTWTNDDLPSLGAETPLDTCLSEGKEAGFAGFELGNKFPREARLLGPILQRHDLQLVSGWYSGRLLERSVEEEIASVQSHLTLLRELGAKVLVFAEVSGCIHGEQQTPVHLRPRFPHARWQEYGEKLTAFARYTQQQGVQIAYHHHMGTVIESAEDVDNLMTHTGEEVGLLLDTGHLTFAGADPLAVAQRWASRINHVHCKDVRADVLADVKNRKTSFLDAVLSGVFTVPGDGCVDYPPIMRLLKAQDYHGWLVVEAEQDPAIAHPLTYARLGYNNLSRLVRDAGLI*。

Claims

1. A nucleotide sequence as set forth in SEQ ID NO. 1 iolE gene or the iolE protein encoded by the gene is used in at least one of (al)-(a3): (a1) improving the plant growth-promoting bacteria's ability to promote symbiotic nitrogen fixation; (a2) improving the plant growth-promoting bacteria's ability to assist rhizobium to enhance the efficiency of soybean nodule formation and nitrogen fixation; (a3) constructing plant growth-promoting bacteria recombinant bacteria with improved ability to promote symbiotic nitrogen fixation; The target gene is overexpressed in the target plant growth-promoting bacteria by genetic engineering methods iolE The target gene is overexpressed in the target plant growth-promoting bacteria by genetic engineering methods iolE The target gene is overexpressed in the target plant growth-promoting bacteria by genetic engineering methods iolE The target gene is overexpressed in the target plant growth-promoting bacteria by genetic engineering methods The plant growth promoting bacteria is Enterobacter ludwigii (ATCC 14931) Enterobacter ludwigii).

2. Use according to claim 1, characterized in that, The iolE The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. A biological material comprising the gene as claimed in claim 1 iolE application of the biological material of the gene in at least one of (al) - (a3) : (a1) improving the plant growth-promoting bacteria's ability to promote symbiotic nitrogen fixation; (a2) improving the plant growth-promoting bacteria's ability to assist rhizobium to enhance the efficiency of soybean nodule formation and nitrogen fixation; (a3) constructing plant growth-promoting bacteria recombinant bacteria with improved ability to promote symbiotic nitrogen fixation; The method comprises the following steps: iolE The target gene is a gene, and the target plant is a plant iolE The gene is a gene, and the target plant is a plant iolE The gene is a gene, and the target plant is a plant The plant growth promoting bacteria is Enterobacter ludwigii (ATCC 14931) Enterobacter ludwigii) ; The biological material comprising the iolE The biological material comprising the gene is at least one of (b1) to (b4): (b1 ) a vector comprising the expression cassette of (b); and iolE a gene; (b2) a recombinant vector comprising the nucleic acid molecule of (bl) or (b2); or iolE (b3) a recombinant vector comprising the nucleic acid molecule of (bl) or (b2); or (b4) a recombinant vector comprising the nucleic acid molecule of (bl) or (b2); or (b5 (b3) a recombinant microorganism comprising the nucleic acid of (b1) or (b2), or iolE (b3) a recombinant microorganism comprising the nucleic acid of (b1) or (b2), or (b4) a transgenic cell line containing said iolE a transgenic cell line containing (bl) said expression cassette, or a transgenic cell line containing (b2) said recombinant vector.

4. A method of enhancing nodulation and nitrogen fixation efficiency in soybean, characterized by, Co-inoculating the plant growth-promoting bacteria recombinant bacteria and rhizobium to the soybean roots; The plant growth promoting bacteria recombinant bacteria are obtained by overexpressing the target plant growth promoting bacteria iolE The gene is constructed, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1; the target plant growth promoting bacteria is Enterobacter ludwigii (E. ludwigii) iolE The gene is constructed, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1; the target plant growth promoting bacteria is Enterobacter ludwigii (E. ludwigii) Enterobacter ludwigii) .

Images