SLIT2 and ZNF154 gene methylation detection primer probe set, kit and application in hepatocellular carcinoma detection

Abstract

The invention particularly discloses an SLIT2 and ZNF154 gene methylation detection primer probe set, a kit and application in hepatocellular carcinoma detection, the primer probe set does not need additional reference genes, methylation target spots and non-methylation target spots are detected at the same time, and compared with a reference gene method, the detection efficiency is greatly improved, and the detection cost is reduced. Result errors caused by common polyploidy effects of cancer cells are avoided; besides, on the premise that the system performance is guaranteed, amplicons are designed as short as possible to adapt to the characteristics of cfDNA short fragments, it is verified that when the primer probe combination is used for detecting SLIT2 and ZNF154 gene methylation, specificity is good, sensitivity is high, and the primer probe combination can be used as an effective supplement of imaging or tissue biopsy when used for diagnosing primary hepatocellular carcinoma.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of gene detection, in particular to a SLIT2 and ZNF154 gene methylation detection primer probe set, a kit and application in detection of hepatocellular carcinoma. BACKGROUND

[0002] Hepatocellular carcinoma (HCC) is one of the most common human tumors, and can be divided into primary and metastatic types. Primary liver cancer mainly includes three different pathological types: hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma (CCA), and mixed hepatocellular carcinoma-cholangiocarcinoma (cHCC-CCA). Hepatocellular carcinoma (HCC) accounts for about 75% of primary liver cancer.

[0003] Early diagnosis of HCC is crucial for early intervention and survival. Multiple studies have shown that early monitoring can improve overall survival, and international guidelines recommend that patients with cirrhosis should undergo HCC screening, as patients with cirrhosis have a 2-4% annual risk of developing HCC. The American Association for the Study of Liver Diseases (AASLD) classifies the following patients as high-risk patients for developing HCC: patients with cirrhosis (Child Pugh A and B), patients with cirrhosis (Child Pugh C waiting for liver transplantation), and patients without cirrhosis but with HBV.

[0004] The AASLD (American Association for the Study of Liver Diseases) currently recommends that high-risk patients undergo abdominal ultrasound monitoring every six months. However, less than one-fifth of high-risk patients undergo HCC screening. In addition, the sensitivity of abdominal ultrasound detection for early HCC is only 45%, and additional screening using the AFP biomarker may improve the detection rate of HCC, however, even with a combined approach, the sensitivity of detecting HCC is only 63%. The overall sensitivity of magnetic resonance imaging (MRI) and computed tomography (CT) for diagnosing HCC is 65% and 72%, respectively. However, for HCC smaller than 2 cm, the sensitivity of CT and MRI is only 48% and 62%, respectively, and for HCC smaller than 1 cm, the sensitivity of CT and MRI is even lower, and liver biopsy is still a reliable diagnostic tool for HCC, and percutaneous, ultrasound-guided liver biopsy is the most commonly used method. The main disadvantage of tissue biopsy is its invasiveness, and the most important risk is bleeding. Therefore, the clinical diagnosis of liver cancer is far from being met. Based on the concept of precision medicine, developing new blood-based diagnostics is a key strategy to improve early diagnosis of HCC.

[0005] DNA methylation is a form of DNA chemical modification, which plays an important role in the regulation of gene expression. It is the covalent binding of a methyl group to the 5th carbon of cytosine in the CpG dinucleotide of the genome, forming 5-methylcytosine (5mC) DNA. It can affect expression, gene and protein interaction without changing the DNA sequence. DNA methylation mainly occurs at the CpG site. Studies have shown that DNA methylation promotes the occurrence of cancer, and abnormal methylation of some tumor-related genes can occur in the early stages of tumor occurrence, which can be used as a specific marker for diagnosis and monitoring.

[0006] Plasma free DNA (cfDNA) is released into the blood circulation due to cell apoptosis. In cancer patients, a small amount of DNA can also be released into the blood circulation due to tumor cell necrosis or apoptosis, which is called ctDNA. Analysis of circulating tumor-derived DNA (ctDNA) can be used for early diagnosis of cancer. The emergence of new minimally invasive experimental methods, such as liquid biopsy, provides a good environment for the development and application of methylation-based biomarkers, making cfDNA methylation an innovative biomarker for cancer.

[0007] Among the many methylation detection methods, real-time fluorescence quantitative PCR is one of the main methods, but it cannot absolutely quantify the methylation molecules, and the selection of reference targets is also interfered by CNV variation, and the detection accuracy needs to be improved.

[0008] Therefore, it is necessary to develop a gene methylation detection primer probe set and kit for hepatocellular carcinoma detection, and to use digital PCR method to detect cfDNA methylation, which can be used as an effective supplement to imaging or tissue biopsy in the diagnosis of primary hepatocellular carcinoma. SUMMARY

[0009] The main purpose of the present application is to develop a product based on gene methylation detection for the auxiliary diagnosis of liver cancer, aiming at the lack of high-accuracy non-invasive auxiliary diagnosis technology for hepatocellular carcinoma in the current clinical first-line. Traditional imaging diagnosis, such as ultrasound and CT detection, can diagnose most patients, but some patients still cannot be diagnosed, leading to missed detection of these patients or unnecessary puncture surgery, which brings great economic and physical burden to the patients. The sensitivity of some non-invasive detection methods such as AFP is also poor. The present application provides a SLIT2 and ZNF154 gene methylation detection primer probe set, a detection kit and related applications in the detection of hepatocellular carcinoma, to realize specific, accurate, rapid and suitable for large-scale promotion of methylation gene detection, which can detect hepatocellular carcinoma in the early stage, and also can better distinguish between benign space-occupying lesions and liver cancer, thereby reducing unnecessary surgery or puncture risk.

[0010] In view of this, the scheme of the present application is: In a first aspect of the present application, a primer probe set for detecting gene methylation is provided, comprising a first primer probe set for detecting a SLIT2 gene and a second primer probe set for detecting a ZNF154 gene; the first primer probe set comprises a primer pair with a nucleotide sequence as shown in SEQ ID NO: 1-2, and a probe set with a nucleotide sequence as shown in SEQ ID NO: 3-4; the second primer set comprises a primer pair with a nucleotide sequence as shown in SEQ ID NO: 5-6, and a probe set with a nucleotide sequence as shown in SEQ ID NO: 7-8.

[0011] In a second aspect of the present application, a SLIT2 and ZNF154 gene methylation detection kit is provided, comprising the primer probe set described in the first aspect above.

[0012] Further, the probes in the kit are respectively provided with a fluorescent group at the 5' end and a quenching group at the 3' end.

[0013] Further, the kit further comprises at least one of a PCR amplification system, a positive quality control, a negative quality control, a reference dye, and purified water.

[0014] Preferably, the PCR amplification system comprises at least one of a DNA polymerase, dNTP, Mg 2+ , a PCR buffer system, a PCR enhancer, and a PCR stabilizer. Preferably, it contains Tris-KCl (10mM~500mM), (NH4)2SO4 (10mM~500mM), glycerol (1%~50%), BSA (0.001mg / mL~1mg / mL), betaine (0.1M~3M), and DMSO (0.1%~10%).

[0015] Further, the final concentration of each primer pair is 0.2μM, and the final concentration of each probe set is 0.1μM.

[0016] In a third aspect of the present application, the kit described in the second aspect is used in the preparation of a hepatocellular carcinoma detection product.

[0017] In a fourth aspect of the present application, a method for detecting SLIT2 and ZNF154 gene methylation for non-diagnostic purposes is provided, comprising the steps of: S1. Extracting cfDNA from the sample and performing bisulfite conversion; S2. Mixing the converted DNA, the primer probe set described in the first aspect, and the qPCR Probe Master Mix to prepare a ddPCR mixture; S3. Placing the ddPCR mixture in a digital PCR instrument to perform digital PCR amplification reaction; S4. The product after the PCR amplification reaction is subjected to multiplex fluorescence signal acquisition, and the methylation of SLIT2 and ZNF154 genes is judged according to the type of the fluorescence signal.

[0018] In the above detection method, the detection for non-diagnosis purposes includes the detection of samples that cannot be traced back to humans, such as the detection of gene methylation of a sample under laboratory conditions, and the detection result only represents the result of the sample itself, that is, the detection of the presence or absence of SLIT2 and ZNF154 gene methylation.

[0019] Further, in step S3, the ddPCR mixture is added to a digital PCR instrument, and the ddPCR mixture is made into 15000-20000 micro-reaction droplets.

[0020] Further, in step S3, the PCR amplification reaction program is as follows: 60℃ start heating micro-droplets for 5min, 95℃ hot start for 10min; 95℃ denaturation for 20s, 57℃ annealing for 40s, a total of 40 cycles.

[0021] Compared with the prior art, the present application has the following advantages: The primer probe set for detecting the methylation of SLIT2 and ZNF154 genes of the present application does not require an additional internal reference gene, and the methylation target and the non-methylation target are detected at the same time, which avoids the result error caused by the common multiple effect of cancer cells compared with the internal reference gene method; in addition, under the premise of ensuring the performance of the system, the amplicon is designed to be as short as possible to adapt to the characteristics of cfDNA short fragments, and it has been verified that the use of the above primer probe combination for detecting the methylation of SLIT2 and ZNF154 genes has good specificity and high sensitivity; it can be used as an effective supplement to imaging or tissue biopsy in the diagnosis of primary hepatocellular carcinoma.

[0022] The detection kit of the present application can realize 4-fold fluorescence detection in combination with the Sinanfu digital PCR instrument, the primer probe is designed at the CpG site near the target gene or the target gene promoter, and for the CpG site to be detected, the probes for methylation and non-methylation are designed respectively, and are distinguished by different fluorescent labels, and the absolute quantification of the methylation and non-methylation molecules is used to accurately obtain the methylation ratio. Compared with the most common qPCR, the method has the following advantages: a) High sensitivity, the detection lower limit is as low as single-digit copies, so that low-level cancer signals can be captured; b) High precision, which can distinguish the small methylation ratio difference between cancer and normal people, and the result is more reliable; c) Various PCR inhibitors are excluded, and the applicability is more extensive. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor.

[0024] Figure 1 The primer probe design diagram of the SLIT2 gene methylation site of the present application.

[0025] Figure 2 The primer probe design diagram of the ZNF154 gene methylation site of the present application.

[0026] Figure 3 The 50% methylation sample example diagram (FAM and VIC) in the embodiments of the present application. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and beneficial technical effects of the present application more clear, the following will further detail the present application in combination with the drawings and specific embodiments. It should be understood that the specific embodiments described in the present specification are only for the purpose of explaining the present application, and are not intended to limit the present application.

[0028] In one embodiment, 30 methylation targets are preferred from millions of methylation sites through 500 clinical sample RRBS detection and public database. However, due to the large number of sites, the system has poor cost and practicability. Therefore, we prefer 12 targets from them, and through the detection of an additional 122 samples, we finally select 2 targets and determine the appropriate threshold. Although the performance of the double-target system is slightly worse than that of the 30-target system, it is still much higher than that of the traditional AFP protein detection. In addition, it can be combined with multiplex digital PCR technology to realize multiplex fluorescence detection. In the present embodiment, the targeted genes are SLIT2 and ZNF154 genes, and the primer and probe design is as shown in Figures 1-2 The red part is the target to be detected. The primer probe is designed near the CpG site of the target gene or the promoter of the target gene. The confirmation of the detection site is through the previous RRBS methylation detection of cancer patients and healthy population cohort, and the optimal differential methylation region (differential methylation regions, DMRs) is screened out. For the CpG site to be detected, the methylation and non-methylation probes are designed respectively, and are distinguished by different fluorescent labels. The absolute quantification of methylation and non-methylation molecules is used to accurately obtain the methylation ratio.

[0029] In the above embodiment, the primer probe combination of SLIT2 and ZNF154 genes does not require an additional internal reference gene, and the methylation target and the non-methylation target are detected at the same time, which avoids the result error caused by the common ploidy effect of cancer cells compared with the internal reference gene method. In addition, under the premise of ensuring the performance of the system, the amplicon is designed to be as short as possible to adapt to the characteristics of cfDNA short fragments. It has been verified that the use of the above primer probe combination for detecting the methylation of SLIT2 and ZNF154 genes has good specificity and high sensitivity.

[0030] Specifically, in the above embodiment, the primer probe combination of the SLIT2 and ZNF154 genes is shown in Table 1, and the probe is modified with fluorescein.

[0031] Table 1: 8 PCR amplification primers and fluorescein labeling characteristics of 2 sites

[0032] It should be noted that not all primer designs can achieve high sensitivity and specificity detection. There are two reasons for this. First, the same gene may have hundreds of CpG sites, and the detection efficiency of different CpG sites is different. Second, the detection efficiency of different genes is different. Increasing the number of detected genes can improve the sensitivity and specificity to some extent, but increasing the number of genes will greatly reduce the practicality of detection. In this embodiment, by screening the million-level methylation sites in the genome, the best CpG site and the best gene combination are selected to achieve high sensitivity and specificity, meet the clinical needs, and at the same time, good applicability is also considered.

[0033] In another embodiment, a method for rapid detection of liver cancer methylation genes SLIT2 and ZNF154 is provided, comprising: 1. Extraction and transformation of plasma free DNA (cfDNA); 2. Using the nucleic acid solution obtained in step 1 as a template, using probe primers to establish a digital PCR system for specific amplification of target nucleic acid sequences, and amplifying target genes SLIT2 and ZNF154; 3. Collecting multiple fluorescence signals of the product after PCR amplification reaction, and judging the methylation of SLIT2 and ZNF154 genes according to the type of fluorescence signal.

[0034] In the above embodiment, the SLIT2 gene target conversion sequence (chr4: 20255044-20255123 (hg19), SEQ ID NO: 9) is: GCCCTCCCCACAACAACCGGCCCCTGCATCTTAGCAGCCGTTGGAAGCCCCAGCTCTTTTACCGCCAAGTTCATCCTTGG The SLIT2 target sequence after transformation (CpG methylation, the underlined part is the target to be detected, SEQ ID NO: 10) is: GTTTTTTTTATAATAATCGGTTTTTGTATTTTAGTAGT CG TTGGAAGTTTTAGTTTTTTTATCGTTAAGTTTATTTTTGG The ZNF154 gene target sequence (chr19:58220790-58220856 (hg19), before transformation, hereinafter referred to as SEQ ID NO: 11) is: TAATATGCTGTCTGATTACGACCCATTTAAGAAAGGGCGAAGTCCCTCCACTGCCCTAGGACTTGGA The ZNF154 target sequence after transformation, hereinafter referred to as SEQ ID NO: 12 (CpG methylation, the underlined part is the target to be detected) is: TAATATGTTGTTTGATTACGATTTATTTAAGAAAGGG CG AAGTTTTTTTATTGTTTTAGGATTTGGA In the above examples, the methylation detection kit for detecting SLIT2 and ZNF154 specifically comprises the components shown in Table 2. The methylation positive control in the kit is a SLIT2 and ZNF154 methylation gene sequence plasmid, and the methylation negative control is a normal human genome transformed DNA sequence plasmid.

[0035] Table 2:

[0036] In one embodiment, free DNA is obtained from plasma, combined with digital PCR methylation detection. The plasma samples are derived from hepatocellular carcinoma patients and healthy people, a total of 122 cases. The collection of all human samples and clinical data complies with the principles of the Helsinki Declaration, and all participants sign a written informed consent for the use of their plasma samples. The blood sample is 10 mL of blood sample collected by venous blood before all participants are enrolled.

[0037] The sample type and number are shown in Table 3.

[0038] Table 3:

[0039] Sample information and detection results are shown in Table 4.

[0040] Table 4:

[0041] As can be seen from Table 4, the combined sensitivity of the two genes reaches 89%, and the specificity reaches 95% in the presence of interfering samples. Of the 20 cirrhosis samples, 16 are judged to be negative, thereby better compensating for existing detection means, such as the inability of conventional ultrasound to distinguish between liver cancer and other occupying lesions. This has important significance for timely detection of early lesions of cancer.

[0042] Embodiment

[0043] 1. Sample pretreatment

[0044] Before detection, sample DNA extraction and transformation are required. The plasma DNA extraction and sulfite transformation kit is used, and the sample is pretreated using the kit QIAamp Circulating Nucleic Acid Kit (Qiagen) and EZ DNA Methylation-Lightning Kit (ZYMO RESEARCH).

[0045] The volume of the plasma sample required by the kit should be greater than 2 ml, and pretreatment is performed according to the requirements of the plasma DNA extraction and sulfite transformation kit instructions. The pretreated plasma DNA can be directly used for detection by the kit.

[0046] 2. Sample detection

[0047] 1) Take out the kit stored at -15 to -25℃ in the dark, and equilibrate the kit components to room temperature; 2) Take out the corresponding number of 96-well plates or PCR reaction tubes; 3) Calculate and remove the corresponding amount of reagents according to the number of reactions performed in the experiment, and the number of reactions is the number of tests plus 1 positive control and 1 negative control. The remaining reagents are stored at -15 to -25℃ in the dark; 4) Prepare the reaction system according to the following scheme

[0048] 5) The template solution refers to the pretreated sample mixture solution in 1, the methylation positive control, the methylation negative control, and the blank control; 6) Seal the 96-well plate or cover the PCR reaction tube, shake uniformly, centrifuge at 2000 rpm for 10 seconds, tear off the cover and place it in the Thinker DQ24 digital PCR instrument; 7) PCR amplification was performed under the following conditions:

[0049] Note: The exposure time was set as follows:

[0050] 3. Result analysis

[0051] 1) Result quality control: the total number of droplets was more than 18000. The purpose genes detected in the results of this kit were as follows:

[0052] 2) Threshold setting: analyze the 2D map of positive and negative controls, divide the 50% methylation 2D map into four regions, move the threshold line, and make the oval signal region where the positive and negative control signals overlap completely in the lower left region. An example of a 50% methylation sample is shown in Figure 3 (FAM and VIC).

[0053] 3) Analyze other sample thresholds, and the software automatically calculates the methylation ratio.

[0054] 4. Quality control

[0055] The kit contains positive and negative controls. These controls should be added in each reaction to detect whether the reaction is successful and to ensure the effectiveness of the reaction. The methylation ratio of the positive and negative controls should be within the effective range, as shown in the table below. If the ratio is outside the effective range, the test results are invalid.

[0056]

[0057] 5. Result interpretation

[0058] The judgment of PCR results is shown in the table below:

[0059] The present application is not limited to the description and embodiments described in the specification, and therefore additional solutions and modifications can be easily implemented by those skilled in the art, and the present application is not limited to specific details, representative designs, and illustrative examples shown and described herein, without departing from the spirit and scope of the general concept defined by the claims and their equivalents.

Claims

1. A gene methylation detection primer probe set, characterized in that: The invention comprises a first probe-primer set for detecting the SLIT2 gene and a second primer-probe set for detecting the ZNF154 gene; the first primer-probe set comprises a primer pair having nucleotide sequences as shown in SEQ ID NOs: 1-2, and a probe set having nucleotide sequences as shown in SEQ ID NOs: 3-4; the second primer set comprises a primer pair having nucleotide sequences as shown in SEQ ID NOs: 5-6, and a probe set having nucleotide sequences as shown in SEQ ID NOs: 7-8.

2. SLIT2 and ZNF154 gene methylation detection kit, characterized in that, Comprising the primer probe set according to claim 1.

3. The kit according to claim 2, wherein In the primer probe set, each probe has a fluorescent group at its 5' end and a quenching group at its 3' end.

4. The kit according to claim 2, wherein The kit further comprises at least one of a PCR amplification system, a positive quality control product, a negative quality control product, a reference dye, and purified water.

5. The kit according to claim 4, characterized in that The PCR amplification system includes DNA polymerase, dNTP, Mg 2+ , at least one of a PCR buffer system, a PCR enhancer, and a PCR stabilizer.

6. The kit according to claim 2, wherein The final concentration of each primer pair was 0.2 μM, and the final concentration of each probe set was 0.1 μM.

7. Use of the kit according to any one of claims 2 to 6 in preparing a product for detecting hepatocellular carcinoma.

8. A method for detecting SLIT2 and ZNF154 gene methylation for non-diagnostic purposes, characterized in that the steps include: S1. Extract cfDNA from samples and perform sulfite conversion; S2. Mixing the converted DNA, the primer probe set according to claim 1, and the qPCR Probe Master Mix to prepare a ddPCR mixture; S3. Place the ddPCR mixture in a digital PCR instrument to perform a digital PCR amplification reaction; S4. Collect multiple fluorescent signals from the products after PCR amplification reaction, and determine the methylation status of SLIT2 and ZNF154 genes based on the type of fluorescent signals.

9. The detection method according to claim 8, characterized in that In step S3, the ddPCR mixture is added to a digital PCR instrument, and the ddPCR mixture is prepared into 15,000-20,000 micro-reaction droplets.

10. The detection method according to claim 8, characterized in that In step S3, the PCR amplification reaction procedure is as follows: start heating the droplets at 60°C for 5 minutes, hot start at 95°C for 10 minutes; denaturation at 95°C for 20 seconds, annealing at 57°C for 40 seconds, for a total of 40 cycles.

Images