Application of ZmMIR319A gene in regulating heat tolerance of maize

Abstract

The application relates to the field of genetic engineering breeding and molecular breeding, and particularly discloses ZmMIR319A application in regulating corn heat tolerance. The application creates three different types of gene knockout mutants by using a gene editing technology to knockout corn ZmMIR319A , and simultaneously creates ZmMIR319A overexpression materials. Under normal growth temperature (25-28 DEG C) of corn, ZmMIR319A the knockout mutants and the overexpression materials do not show temperature sensitivity compared with wild types, but compared with the wild types, ZmMIR319A the mutants are more sensitive to high temperature stress, and ZmMIR319A the overexpression materials are less sensitive to high temperature stress, which indicates that ZmMIR319A ZmMIR319A the positive regulation of corn high temperature stress resistance. The application provides a reference for researching a corn high temperature stress resistance molecular mechanism and provides potential gene resources for cultivating excellent new germplasm of corn resistant to high temperature.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering breeding and molecular breeding, specifically relating to maize. ZmMIR319A Genes and their application in maize's tolerance to high temperature stress. Background Technology

[0002] In recent years, global warming has become a significant trend, and high-temperature stress has adverse effects on all stages of crop growth and development, especially on staple crops such as maize. Maize is most sensitive to high temperatures during the flowering period; temperatures exceeding 38°C directly affect pollen viability and fertilization, leading to a decrease in seed setting rate of approximately 15% (Hu Junpeng et al., 2025). Furthermore, high temperatures during the grain-filling period shorten the grain-filling time, resulting in a decrease in grain weight and quality (Yan Hengyu et al., 2024).

[0003] MicroRNAs (miRNAs) are a class of endogenous non-coding small RNA molecules, approximately 20–24 nucleotides in length. In plants, miRNA genes (MIRs) are transcribed by RNA polymerase II into primary transcripts (pri-miRNAs). These are then processed in the nucleus by protein complexes such as DCL1, HYL1, and SE into pre-miRNAs, ultimately forming mature miRNA / miRNA* double-stranded complexes (Park et al., 2002). After HEN1 methylation, this complex is transported to the cytoplasm via HASTY, where it binds to AGO proteins to form an RNA-induced silencing complex (RISC). This RISC negatively regulates gene expression at the posttranscriptional level by cleaving target mRNAs or inhibiting their translation (Vaucheret et al., 2004; Yang et al., 2006). Plant miRNAs and their target gene mRNAs are typically highly complementary, and their expression exhibits tissue specificity and spatiotemporal dynamics (Zhou et al., 2024; Song et al., 2024). Several conserved miRNA families have been identified in plants, including miR156, miR159, miR160, miR169, miR172, miR319, miR408, and miR528. These miRNAs are widely involved in plant growth and development by targeting specific transcription factors or functional genes (Qin et al., 2011; Dai et al., 2022; Zhou et al., 2024).

[0004] miRNAs are also important regulatory factors in plant responses to abiotic stresses such as drought, salt stress, extreme temperatures, and heavy metals. Under drought stress, miR156 and miR169 expression is upregulated, enhancing plant drought resistance by regulating SPL and NF-YA genes, respectively (Zhang et al., 2023; Wan et al., 2022). Studies have shown that Mdm-miR160 is a key factor in improving the drought resistance of apples (…).Malus pumila Mill. miR398 is a positive regulator of drought stress, enhancing plant drought tolerance by promoting root and rhizome development (Shen et al., 2021). Under salt stress, miR398 alleviates salt-induced oxidation by targeting the CSD gene and regulating the reactive oxygen species (ROS) scavenging system (Paque et al., 2016). Under heavy metal stress, miR156, miR395, and miR397 reduce the toxicity of metals such as Cd and Al by regulating metal transporter proteins and antioxidant enzyme genes (Shen et al., 2017; Huang et al., 2021). Under low-temperature stress, changes in the expression of miR319 and miR408 enhance the plant's cold resistance by regulating the TCP and LAC genes, respectively. For example, overexpression of OsamiR319a and Osa-miR319b in rice resulted in wider leaves, an increased number of longitudinal veinlets, and enhanced cold resistance (Yang et al., 2013); the expression levels of miR160a, miR166a, miR167h, and miR5175a in barley significantly increased after high-temperature stress, by downregulating auxin-responsive transcription factors. ARF17 , ARF13, ARF8 and ARF6 The expression of Sha-miR319d in barley enhances its tolerance to high temperatures (Kruszka et al., 2014); while in tomato Sha-miR319d, it enhances its tolerance to high temperatures by inhibiting... GAMYB-like1 The expression level of miRNA319 can regulate the plant's tolerance to low and high temperature stress (Shi et al., 2019). However, there are currently no reports on miRNA319 regulating the maize's response to high temperature stress.

[0005] This invention utilizes CRISPR / Cas9 (Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9) gene editing technology to create three different mutation types. ZmMIR319A Gene knockout mutant ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 and created ZmMIR319A Overexpression materials ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3 Using an artificial climate chamber, the germination and growth of wild-type and [other types] in soil culture for 14 days were compared. ZmMIR319A The aforementioned knockout mutants and overexpression seedlings were subjected to a 45°C high-temperature stress treatment. After the high-temperature treatment, compared with the wild type, the above-mentioned... ZmMIR319A mutant ( ZmMIR319A- KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3It is quite sensitive to high temperature stress, showing significant leaf scorching symptoms, a significant increase in ROS content, and a decrease in the activity of ROS scavenging enzymes (catalase, superoxide dismutase, and peroxidase). ZmMIR319A Overexpression materials ( ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3 The corn showed decreased sensitivity to high-temperature stress, milder leaf scorching symptoms, significantly lower ROS content, and significantly increased activity of ROS-scavenging enzymes (catalase, superoxide dismutase, and peroxidase), indicating that it possesses the characteristics of a healthy corn plant. ZmMIR319A Genes play a crucial role in regulating the heat resistance of maize. This invention provides potential gene resources for the discovery of heat-resistant genes in maize and the breeding of new heat-resistant maize varieties. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to clarify ZmMIR319A Its application in regulating maize's resistance to high-temperature stress provides genetic resources and new germplasm for the breeding of new heat-tolerant maize varieties. The specific technical solution is as follows:

[0007] Maize inbred line X249 ZmMIR319A Sequence analysis, the ZmMIR319A The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the mature sequence of miR319 is shown in SEQ ID NO.2. Appropriate sites were selected for gene editing target design.

[0008] Constructing using CRISPR / Cas9 gene editing technology ZmMIR319A Gene-editing vectors were introduced into the callus tissue of the maize inbred line X249 using Agrobacterium-mediated transformation. After obtaining T0 generation transgenic plants, they were crossed with wild-type X249 to obtain F1 generation seeds. After self-pollination and genotyping to obtain homozygous non-transgenic gene-edited seeds, these seeds were germinated and grown in soil in an artificial climate chamber for 14 days, followed by high-temperature treatment at 45 °C. Changes in leaf scorching and the activity of ROS and their scavenging enzymes were investigated and detected.

[0009] Overexpression vectors were constructed and introduced into callus tissue of maize inbred line X249 using Agrobacterium-mediated transformation. After obtaining T2 generation homozygous positive seeds, the seeds were germinated and grown in soil in an artificial climate chamber for 14 days, followed by high-temperature treatment at 45 °C. The changes in leaf scorch and ROS and its scavenging enzyme activity were investigated and detected.

[0010] This invention utilizes CRISPR / Cas9 technology to study corn. ZmMIR319A Site-directed gene editing yielded three mutants with different editing types for this gene, all of which exhibited a phenotype with significantly increased sensitivity to high-temperature treatment. This led to the creation of maize... ZmMIR319AOverexpression materials showed a phenotype with significantly reduced sensitivity to high-temperature treatment. This suggests... ZmMIR319A It positively regulates the high-temperature tolerance of corn. Attached Figure Description

[0011] Figure 1 ,corn pCas9-ZmMIR319A Carrier design diagram.

[0012] Figure 2 , ZmMIR319A Knockout event gene sequence variation analysis. Base variation sites are indicated in blue. ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 The missing bases are indicated by a short blue line.

[0013] Figure 3 ,corn pUbi-ZmMIR319A Carrier map

[0014] Figure 4 ,corn ZmMIR319A The expression levels of overexpressing plants were compared. The second leaf of wild-type and overexpressing plants, which had germinated and grown for 14 days under normal conditions, was used for total RNA extraction and reverse transcription. ZmTubulin5 Genes were used as internal controls for quantitative PCR detection of precursors. ZmMIR319A The relative expression levels (compared to WT). An asterisk (*) in the bar chart indicates a significant difference in the t-test (P < 0.05). ZmMIR319A Overexpression plants ZmMIR319A-OE#1 , ZmMIR319A-OE# 2, ZmMIR319A-OE#3 These three homozygous lines were used for the heat resistance study of this invention.

[0015] Figure 5 ,corn ZmMIR319A Phenotypic and physiological analysis of knockout mutants under high-temperature stress. ab. wild-type (WT) and ZmMIR319A Knockout mutant ( ZmMIR319A-KO Phenotypic differences after 14 hours of high-temperature treatment at 45℃; c. Wild type and ZmMIR319A Differences in reactive oxygen species (ROS) content (NBT staining) in the first leaf of the knockout mutant after 3 hours of high-temperature treatment at 45°C; d. Wild type and ZmMIR319A Comparison of the activities of reactive oxygen species scavenging enzymes (catalase, superoxide dismutase, and peroxidase) in the second leaf after 3 hours of high-temperature treatment at 45℃ for knockout mutants. An asterisk (*) in the bar chart indicates a significant difference (P<0.05) in the t-test.

[0016] Figure 6 ,corn ZmMIR319A Phenotypic and physiological analysis of overexpression plants under high temperature stress. ab. wild-type (WT) and ZmMIR319A Overexpression plants ( ZmMIR319A-OEPhenotypic differences after 14 hours of high-temperature treatment at 45℃; c. Wild type and ZmMIR319A Differences in reactive oxygen species (NBT staining) content in the first leaf of overexpression plants after 3 hours of high-temperature treatment at 45℃; d. Wild-type and ZmMIR319A Comparison of the activities of reactive oxygen species scavenging enzymes (catalase, superoxide dismutase, and peroxidase) in the second leaf of overexpression plants after 3 hours of high-temperature treatment at 45℃. An asterisk (*) in the bar chart indicates a significant difference (P<0.05) in the t-test. Detailed Implementation

[0017] Example 1: Creation using the CRISPR / Cas9 method ZmMIR319A Mutant materials

[0018] To clarify ZmMIR319A The role of mutants in maize heat tolerance: This invention utilizes gene cloning and vector construction technologies to create mutants through gene editing. ZmMIR319A The mutant was investigated, and its function in maize was examined. This invention selected maize inbred line X249 as the recipient material for gene editing, based on... ZmMIR319A Based on the mature sequence (SEQ ID NO.2) information and the sequence information preceding the mature sequence, the target region MT1 for CRISPR / Cas9 gene editing was designed.

[0019] MT1 (SEQ ID NO.3): CTGTTTGTGGTTGGACTGAAGGG

[0020] 1, ZmMIR319A Construction of knockout vector

[0021] The gene editing vector of the present invention is pBUE411-ZmMIR319A-Cas9 The basic carrier of this carrier is pBUE411-Cas9 The intermediate carrier is pCBCmT1T2 This invention provides gRNA. The specific construction process involves designing target sites on primers, obtaining MT-sgRNA via PCR, and then ligating it into a basic vector via enzyme digestion. The details are as follows.

[0022] (1) Design of target gRNA. ZmMIR319A The conserved gene sequence was input into the website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR for target design. The sgRNA backbone sequence of this invention was obtained directly from the intermediate vector.

[0023] (2) MT-sgRNA was obtained by designing target sites on primers and performing PCR amplification. Primers ZmMIR319A-MT1-F (SEQ ID NO.4) and primers ZmMIR319A-MT1-R(SEQ ID NO.5) Amplification intermediate vector pCBCmT1T2 This is used to obtain sgRNA fragments containing the first and second targets. The PCR system and conditions are as follows: template DNA (intermediate vector) pCBCmT1T2 ≥30 ng / μL) 1.2 μL; Primer F / R: 1.2 μL each; Sterile ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The PCR temperature program was as follows: ① 98 ℃ for 2 min; ② 98 ℃ for 10 s; ③ 58 ℃ for 30 s; ④ 72 ℃ for 30 s; ⑤ Cycle 33 times from ② to ④; ⑥ 72 ℃ for 5 min; ⑦ 25 ℃ for 10 min. The PCR products were recovered after agarose gel electrophoresis.

[0024] The primer base sequences required for vector construction are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0025] SEQ ID NO.4:

[0026] 5'-ATATATGGTCTCTGGCGACTGTTTGTGGTTGGACTGAAGGGGTTTTAGAGCTAGAAATAGCAA -3';

[0027] SEQ ID NO.5:

[0028] 5'-ATTATTGGTCTCTAAACCTGTTTGTGGGTTGGACTGAATGCTTCTTGGTGCCGC-3';

[0029] (3) Construct the backbone vector by enzyme digestion and ligation. pBUE411-Cas9 Vectors and recovered target-carrying sgRNA fragments are used BsaI Digestion was performed, and T4 ligase was added to ligate the vector and sgRNA fragment. The enzyme digestion and ligation system is as follows:

[0030] sgRNA fragment: 2 μL

[0031] pBUE411-Cas9 vector (≥60 ng / μL): 2 μL

[0032] 10 x NEB Buffer: 1.5 μL

[0033] BsaI Endonuclease (product number: #R3733S): 1 μL

[0034] T4 ligase (product number: #M0202M): 1 μL

[0035] ddH2O: 6 μL.

[0036] Design drawing of the pCas9-ZmMIR319A carrier component for corn is shown below. Figure 1 As shown.

[0037] 2. Agrobacterium-mediated genetic transformation of maize

[0038] The transformation recipient is maize inbred line X249, carrying 1 [transformation receptor]. ZmMIR319A copy.

[0039] The above-constructed pCas9-ZmMIR319A The vector was transferred into Agrobacterium EHA105 via heat shock, identified by PCR, and the bacterial culture was stored at -80℃ with glycerol. Freshly peeled immature embryos of the inbred line X249, approximately 1.5 mm in diameter, were used as recipient material. The peeled corn embryos were placed in 2 mL plastic centrifuge tubes containing 1.8 mL of suspension for no more than 1 hour, with approximately 100 embryos per tube. The suspension was removed, and the embryos were washed twice with fresh suspension, leaving a small amount of suspension at the bottom of the tube to submerge the embryos. The tubes were then heat-shocked at 43℃ for 2 min, followed by an ice bath for 1 min. The remaining wash solution at the bottom of the tube was aspirated, and 1.0 mL of Agrobacterium infection solution was added. The tubes were gently shaken for 30 seconds and then incubated in the dark for 8 min. Next, the embryos and infection solution from the centrifuge tubes were poured onto a co-culture medium, shaken well, and excess infection solution was aspirated. All embryos were incubated with their scutes facing upwards at 23℃ in the dark for 3 days. After co-culture, the immature embryos were transferred to recovery medium using sterile forceps and cultured at 28 °C for 14 days, during which time any emerging shoots should be removed promptly. After recovery culture, the immature embryos were placed on 1.5 mg / L Bialaphos selection medium for three rounds of selection, each round lasting two weeks, and then transferred to 2 mg / L Bialaphos selection medium for two more rounds of selection, each round lasting two weeks. The resistant callus was transferred to propagation medium and cultured in the dark at 28 °C for two weeks. Subsequently, the propagated resistant callus was transferred to induction medium and cultured in the dark at 28 °C for two weeks. Then, it was transferred to differentiation medium and cultured under light at 25 °C and 5000 lux for two weeks. After the culture is completed, the differentiated seedlings are separated into individual seedlings and placed in a rooting medium. They are then cultured at 25 ℃ and 5000 lux light until they take root. The seedlings are then transferred to small nutrient pots for growth. Once they have survived, they are transplanted into a greenhouse and the offspring seeds are harvested after 3-4 months.

[0040] 3. Detection of knockout mutation results in T0 generation plants

[0041] To determine the knockout mutation results in the T0 generation plants, the following steps were taken:

[0042] This invention uses the CTAB method to extract DNA from maize leaves. The specific method is as follows: Cut seedling leaves approximately 2 cm in length and place them in a 2 mL centrifuge tube containing steel balls; immerse the centrifuge tube containing the leaves in liquid nitrogen for 5 minutes, then use a grinder to break up the leaf sample; add 700 μL of CTAB extraction buffer (containing 1%...) to the centrifuge tube. β (-mercaptoethanol), mix vigorously, preheat in a 65 ℃ water bath for 20-30 min (invert once during this period); after the centrifuge tube cools to room temperature, add 700 μL of chloroform:isoamyl alcohol (24:1) extraction solution, shake vigorously for 30 s, and let stand at room temperature for a while; centrifuge at 12000 rpm for 5 min at 4 ℃, and take 500 μL of supernatant into a new 1.5 mL centrifuge tube; add an equal volume of isopropanol to the centrifuge tube containing the supernatant, gently shake to mix, and let stand at room temperature for about 10 min; then place the centrifuge tube containing the sample in a 4 ℃ centrifuge, centrifuge at 12000 rpm for 10 min, gently aspirate the supernatant, discard the supernatant, and retain the precipitate; add 800 μL of 75% ethanol, wash the precipitate twice, centrifuge at 10000 rpm for 5 min, and discard the supernatant; place the sample to air dry at room temperature for 2-4 days. h, the DNA precipitate was obtained, and an appropriate amount of sterile water was added to dissolve it. The mixture was gently shaken to fully dissolve the DNA. The DNA sample was stored at -20 °C. The DNA concentration was detected using Nanodrop, and the sample was diluted to 10 ng / L for use as a PCR template.

[0043] Then according to ZmMIR319A Design PCR primers based on gene sequences.

[0044] Target: MT1; Product size: 636 bp; Primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7:

[0045] SEQ ID NO.6

[0046] ZmMIR319A-1 -TF: 5'- CGTTTGCGTTCACCTCTG-3';

[0047] SEQ ID NO.7

[0048] ZmMIR319A-1 -TR: 5'- GGTCCCCGAGCTCTATCG-3'.

[0049] Amplify using the following PCR parameters:

[0050] Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterile ddH2O, 7.5 μL 2x Taq mix (product number: 10103ES).

[0051] Reaction procedure: Conventional PCR: annealing at 58℃, extension for 30s, 32 cycles.

[0052] The PCR product was then recovered and ligated into a T vector for sequencing. By sequencing the DNA sequences of the target regions of multiple T0 generation independent positive transformation events, it was determined whether gene editing had occurred in the target regions.

[0053] Three mutation types were obtained using X249 as the recipient in transgenic plants. The sequences before and after editing are as follows: Figure 2 As shown, there are 3 corresponding ones. ZmMIR319A Allelic homozygous mutants: ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 Compared to wild type ZmMIR319A Mature sequence alignment shows that ZmMIR319A-KO#1 exist ZmMIR319A The mature sequence region of the gene contains a 9bp deletion; ZmMIR exist ​ The mature sequence region has a 3 bp deletion; ​ exist ​ The mature sequence region of the gene contains a 1 bp deletion. ​ ).

[0054] 4. Genotyping of F1 generation plants

[0055] Because maize T0 generation plants grown in greenhouses often exhibit uncoordinated development of female and male ears, this invention uses wild-type pollen from the maize inbred line X249 to propagate T0 generation plants and ensure the inheritance of the obtained gene-edited type. ​ and ZmMIR319A-KO#3 The T0 generation plants are pollinated to obtain F1 generation seeds, and the resulting plants are F1 generation plants.

[0056] The F1 generation plants included two segregation types, one of which was... Cas9 - Positive plants (transgenic plants), another type is Cas9 - Negative-negative plants (non-transgenic plants). To avoid continuous editing of the X249 wild-type allele introduced by hybridization pollination by sgRNA and Cas9, thus causing complexity in mutation types, it is necessary to select plants from the F1 generation that do not contain sgRNA or Cas9 through genotyping. Cas9Plants containing the T0 generation mutation, but with the genetic code, can produce non-transgenic F2 generation plants after self-pollination. The genotyping steps for F1 generation plants are as follows:

[0057] After extracting leaf DNA using the CTAB method described above, the first step is to utilize... Cas9 Gene-specific primers were used for PCR amplification, and the base sequences are shown in Cas9-F (SEQ ID NO.8) and Cas9-R (SEQ ID NO.9):

[0058] SEQ ID NO.8: 5'-CCCGGACAATAGCGATGT-3';

[0059] SEQ ID NO.9: 5'-GAGTGGGCCGACGTAGTA-3'.

[0060] The PCR reaction system was the same as above; the reaction procedure was as follows: standard PCR: annealing at 58℃, extension for 30 seconds, 32 cycles. After agarose gel electrophoresis, the PCR products were distinguished based on the results. Cas9 -positive plants and Cas9 -Negative plants.

[0061] Further targeting Cas9 - Negative plants, using the primers for the above-mentioned detection target. ZmMIR319A-1 -TF and ZmMIR319A-1 -TR was used for PCR amplification; after PCR product purification, it was ligated into the T vector and sequenced; the genetic information of the T0 generation mutation type was determined based on the sequencing results.

[0062] 5. Genotyping of F2 generation plants

[0063] The above does not contain Cas9 Gene editing can be obtained by self-pollinating F1 plants containing the T0 generation mutation type (F2) and then genotyping them to obtain homozygous, non-transgenic gene-edited seeds, which are mutants with a homozygous genetic background.

[0064] The F2 offspring obtained by self-pollination of F1 plants exhibit three segregation types: AA, Aa, and aa. We need to select homozygous, non-transgenic, gene-edited plants from the F2 generation through genotyping. These plants will then undergo further heat tolerance testing. Furthermore, self-pollination of these plants will yield homozygous, non-transgenic, gene-edited seeds. The genotyping steps for the F2 generation are as follows.

[0065] After extracting leaf DNA from F2 generation plants using the CTAB method described above, the aforementioned primers were used. ZmMIR319A-T-F and ZmMIR319A-T-R Perform one round of PCR amplification, and then use specific primers to amplify the products. ZmMIR319A-T2-F andZmMIR319A- T2-R Two rounds of PCR amplification were performed. After amplification, the PCR products were subjected to non-denaturing PAGE electrophoresis (gel concentration: 12%; voltage: 150 V; time: 2.5 h) for genotyping. Homozygous gene-edited plants were self-pollinated to obtain homozygous non-transgenic gene-edited seeds. The base sequence is as follows: ZmMIR319A-T2-F (SEQ ID NO.10) and ZmMIR319A-T2-R As shown in SEQ ID NO.11:

[0066] SEQ ID NO.10: 5'-AATCAAGCTCTACGCTGTT-3';

[0067] SEQ ID NO. 11: 5'-AAGCGTTTGAGCAAACAA-3'.

[0068] Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL one-round PCR product, 5.5 μL sterile ddH2O, 7.5 μL 2X M5 HiPer PAGE Taq PCR mix (Polymer Biotechnology Co., Ltd., catalog number: 10103ES);

[0069] Reaction procedure: Conventional PCR: annealing at 58℃, extension for 30s, 32 cycles.

[0070] PCR products were subjected to non-denaturing PAGE electrophoresis, followed by silver nitrate staining for banding. Genotyping was performed based on band size. Homozygous gene-edited plants were then subjected to further heat tolerance testing.

[0071] Example 2: Corn ZmMIR319A Construction of overexpression vectors and phenotypic screening of transgenic plants

[0072] 1. ZmMIR319A Construction of overexpression vectors

[0073] (1) Acquisition and amplification of the target gene. The precursor sequence pri-miR319A of maize miR319A was obtained from the public database miRBase. Based on the miR319A precursor sequence, specific primers ZmMIR319A-OE-F (SEQ ID NO.12) and ZmMIR319A-OE-R (SEQ ID NO.13) were designed. PCR amplification was performed using high-fidelity DNA polymerase to obtain the target gene. ZmMIR319APrecursor fragments. The PCR system and conditions were as follows: template DNA (X249 genomic DNA) 1.2 μL; Primer F / R: 1.2 μL each; sterile ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The PCR temperature program was as follows: ① 98℃ for 2 min; ② 98℃ for 10 s; ③ 58℃ for 30 s; ④ 72℃ for 30 s; ⑤ Cycle 33 times from ② to ④; ⑥ 72℃ for 5 min; ⑦ 25℃ for 10 min. The PCR products were recovered after agarose gel electrophoresis.

[0074] The primer base sequences required for vector construction are shown in SEQ ID NO.12 and SEQ ID NO.13.

[0075] ZmMIR319A-OE-F(SEQ ID NO.12):TGTTACTTCTGCAGCCCGGGGGTTCA GTTTTCTCTGGAA

[0076] ZmMIR319A-OE-R (SEQ ID NO.13): CAAGCGTTTGAGCAAACAAAAG

[0077] (2) The expression vector was constructed into the backbone vector by enzyme digestion and ligation. The plant expression vector pBI121-Ubi containing the maize ubiquitin promoter was selected to drive Z. mMIR319A High-efficiency expression was achieved. The vector was double-digested with restriction endonucleases XmaI and SmaI, and the linearized vector fragment was recovered. This prepared the vector for the insertion of the miR319A precursor. Recombinant ligase was added to ligate the vector and the target fragment. The 5 μL digestion and ligation system was as follows: pri-miR319A fragment: 2 μL, pBI121-Ubi vector (≥60 ng / μL): 2 μL, DNA recombinant ligase (product number: 7E682G2): 1 μL.

[0078] The ligation product was transformed into competent Escherichia coli (DH5α), and positive clones were screened on a medium containing the antibiotic kanamycin. Plasmids were extracted and sequenced to confirm Z. mMIR319A Correct insertion of the precursor. Constructed corn. pUbi -ZmMIR319A vector spectrum as follows Figure 3 As shown.

[0079] 2. Agrobacterium-mediated genetic transformation of maize

[0080] The transformation recipient was maize inbred line X249, carrying one copy of ZmMIR319A.

[0081] The above-constructed pUbi The ZmMIR319A vector was transferred into Agrobacterium EHA105 via heat shock, identified by PCR, and the bacterial culture was stored at -80°C with glycerol. Freshly peeled immature embryos of the inbred line X249, approximately 1.5 mm in diameter, were used as recipient material. The peeled corn embryos were placed in 2 mL plastic centrifuge tubes containing 1.8 mL of suspension and left for no more than 1 hour. Approximately 100 immature embryos were placed in each tube. The suspension was removed, and the immature embryos were washed twice with fresh suspension, leaving a small amount of suspension at the bottom of the tube to submerge the embryos. The tubes were then heat-shocked at 43°C for 2 min, followed by an ice bath for 1 min. The remaining wash solution at the bottom of the tube was aspirated, and 1.0 mL of Agrobacterium infection solution was added. The tubes were gently shaken for 30 seconds and then incubated in the dark for 8 min. Next, the immature embryos and infection solution were poured onto a co-culture medium, shaken well, and excess infection solution was aspirated. All immature embryos were placed with their scutes facing upwards and co-cultured in the dark at 23°C for 3 days. After co-culture, the immature embryos were transferred to recovery medium using sterile forceps and cultured at 28 ℃ for 14 days, during which time any emerging shoots on the embryos should be removed promptly. After recovery culture, the immature embryos were placed on a selection medium containing 1.5 mg / L Bialaphos for three rounds of selection, each round lasting two weeks, and then transferred to a selection medium containing 2 mg / L Bialaphos for two more rounds of selection, each round lasting two weeks. The resistant callus was transferred to propagation medium and cultured in the dark at 28 ℃ for two weeks. Subsequently, the propagated resistant callus was transferred to induction medium and cultured in the dark at 28 ℃ for two weeks. Then, it was transferred to differentiation medium and cultured under light at 25 ℃ and 5000 lux for two weeks. After culture, the differentiated seedlings were separated into individual seedlings and placed in rooting medium, and cultured under light at 25 ℃ and 5000 lux until rooting. The seedlings were then transferred to small nutrient pots for growth, and after survival, they were transplanted into a greenhouse.

[0082] 3. T0 generation ZmMIR319A Detection of Overexpression Plant Results

[0083] To determine whether the T0 generation plants were positive seedlings, we used the Basta resistance gene to screen for positive seedlings. The specific method is as follows:

[0084] A 0.1% concentration of Basta solution is prepared and evenly applied to the leaves of T0 generation plants to screen for positive events. Significant phenotypic differences typically begin to appear within 3-7 days after application. Plants that successfully express the bar / pat gene show green, healthy leaves after application, or only slight, temporary chlorosis / scorching (especially under higher concentrations or strong light), but recover quickly.

[0085] T0 generation positive plants (heterozygous) were self-pollinated to obtain T1 generation seeds (due to segregation, T1 generation seeds included homozygous, heterozygous, and wild-type seeds). Twenty of these T1 generation seeds were then sown and self-pollinated to harvest T2 generation seeds. These 20 seed samples were then sown to produce 50 plants. The Basta resistance gene screening method described above was used to select positive seedlings. T2 generation seeds from all 50 positive plants were identified as homozygous transgenic seeds; otherwise, they were identified as heterozygous transgenic seeds or wild-type seeds. The selected T2 generation homozygous transgenic seeds were then sown and subjected to heat tolerance experiments.

[0086] To compare the differences in ZmMIR319A precursor transcript levels among different overexpressing plants, the second leaf was harvested 14 days after sowing wild-type and T2 generation transgenic homozygous seeds from the aforementioned different lines. Total RNA extraction and cDNA reverse transcription were performed on wild-type and transgenic plants according to the manufacturer's instructions using a total RNA extraction kit (Beijing Tiangen Biotech Co., Ltd., catalog number DP419) and a cDNA reverse transcription kit (Beijing Tiangen Biotech Co., Ltd., catalog number KR118). The ZmMIR319A precursor transcript levels were compared among different plants using a SYBR Green quantitative real-time assay kit (Beijing Tiangen Biotech Co., Ltd., catalog number FP205), with the maize ZmTubulin5 gene as an internal control, according to the kit instructions. The primer sequences for ZmMIR319A precursor transcript detection are shown in SEQ ID NO.14 and SEQ ID NO.15, and the primer sequences for ZmTubulin5 gene detection are shown in SEQ ID NO.16 and SEQ ID NO.17.

[0087] Pri-ZmMIR319A-F(SEQ ID NO.14): ACCATGGACAGGTCTGGTCT

[0088] Pri-ZmMIR319A-R(SEQ ID NO.15): AGCGTTTGAGCAAACAAAAGGG

[0089] ZmTubilin5-F(SEQ ID NO.1:6):GCCGTTGCCGAGGTGTTC

[0090] ZmTubilin5-R(SEQ ID NO.17): GTCCTTCTCAAGAGCAGCCAAGT

[0091] Quantitative detection results as follows Figure 4 As shown, select ZmMIR319AThe ZmMIR319A-OE#1, ZmMIR319A-OE#2, and ZmMIR319A-OE#3 cells with the highest expression levels were then subjected to further heat resistance experiments.

[0092] Example 3 Corn ZmMIR319A Phenotypic observation and physiological comparison of knockout mutants and overexpression plants under high temperature treatment

[0093] Cultivation of corn materials

[0094] Choose wild-type X249 with plump, uniformly sized kernels. ZmMIR319A mutant ( ZmMIR319A-KO# 1. ZmMIR319A-KO#2, ZmMIR319A-KO#3 Seeds and overexpression ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3 The seeds were sown in small pots measuring 20 cm x 20 cm and germinated and grew normally for 14 days (until the second leaf was fully expanded) in an artificial climate chamber (16 hours of light / 8 hours of darkness, temperature 25℃, humidity 50%, light intensity 1000µE).

[0095] 2. Observation of plant heat tolerance phenotype

[0096] Select wild-type plants with uniform growth. ZmMIR319A The mutants and overexpressing plants were placed in a preheated 45 °C artificial climate chamber (16 hours light / 8 hours dark, temperature 45 °C, humidity 50%, light intensity 1000 µE) for 14 hours of heat stress treatment. Afterwards, they were removed and returned to an artificial climate chamber with normal growth temperature (16 hours light / 8 hours dark, temperature 25 °C, humidity 50%, light intensity 1000 µE) to recover growth. Three days later, the overall plant was photographed to observe the scorching effect, and the first, second, and third intact leaves were photographed to observe the leaf scorching effect. Simultaneously, corresponding materials that had not undergone high-temperature treatment were used as controls for phenotypic photography.

[0097] To investigate changes in physiological indicators, wild-type plants with uniform growth were selected. ZmMIR319A Mutants and overexpressing plants were subjected to heat stress for 3 hours in a preheated 45 °C artificial climate chamber (16 hours light / 8 hours darkness, temperature 45 °C, humidity 50%, light intensity 1000 µE). Afterwards, the first leaf was taken and stained with NBT staining solution. The second leaf was then removed, ground with liquid nitrogen, and the activities of catalase, superoxide dismutase, and peroxidase were detected by colorimetric method using a multi-functional microplate reader. Corresponding materials that had not undergone high-temperature treatment served as controls. Statistical analysis used Student's t-test to compare significant differences between the mutants and the wild-type control. An asterisk (*) above the bar chart indicates a significant difference (P < 0.05) between the mutants and the wild-type control.

[0098] Phenotypic studies revealed that, compared to the wild type, after heat treatment at 45 °C for 14 hours... ZmMIR319A-KO#1, ZmMIR319A-KO#2, ZmMIR319A-KO#3 The leaves of these plants showed significant differences in morphology and physiological characteristics, specifically manifested as wilting, curling, and water loss. ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3 The phenotype is the opposite ( Figure 5 a, b; Figure 6 (a, b). Further comparison of NBT staining results after heat treatment at 45 ℃ for 3 hours showed no significant difference in WT NBT staining results between the untreated group and ZmMIR319A-KO#1, ZmMIR319A-KO#2, ZmMIR319A-KO#3, and ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3. The heat-treated group... ZmMIR319A- KO#1, ZmMIR319A-KO#2, ZmMIR319A-KO#3 The blue area exhibited by NBT staining in the material was significantly larger than that in the wild-type material. ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3 The material was significantly smaller than the wild type, indicating that after heat stress... ZmMIR319A The mutant had the highest level of reactive oxygen species (ROS) in response to stress, while the overexpressing plant had the lowest level of ROS. Figure 5 c); Figure 6 c). And compared to wild-type, ZmMIR319A Differences in the activities of ROS-scavenging enzymes, including catalase, superoxide dismutase, and peroxidase, in the leaves of mutant and overexpressing plants were found compared to the wild type. ZmMIR319A The activities of catalase, superoxide dismutase, and peroxidase were all significantly reduced in the mutant organism. Figure 5 d), and ZmMIR319A The activities of catalase, superoxide dismutase, and peroxidase were significantly increased in overexpression plants. Figure 6 d), indicating that under thermal stress... ZmMIR319A The mutant has a weaker ability to clear ROS in vivo, while ZmMIR319A The overexpressing plants have a stronger ability to scavenge ROS in the body.

[0099] Therefore, through overexpression ZmMIR319AThe obtained material exhibits strong tolerance to high-temperature stress, demonstrating significant advantages in maize cultivation under high-temperature conditions. This discovery possesses both significant practical value and theoretical innovation. In production, it provides crucial genetic resources for breeding new heat-resistant maize varieties, with the potential for direct application in molecular breeding to cultivate crops capable of withstanding extreme heat, thereby ensuring food security and stable yields against the backdrop of global climate change, and even expanding suitable maize planting areas. Theoretically, this research breaks through the traditional understanding of the miR319 family's functions, revealing for the first time its core role in plant heat stress responses and discovering a novel miRNA-mediated heat stress regulatory pathway. This greatly deepens our understanding of the complexity of plant stress resistance molecular networks and provides a new strategy for systematically improving complex crop traits by manipulating "master switch" regulatory factors, pointing to a new direction for future stress-resistance breeding.

[0100] References:

[0101] Huang SL, Zhou JJ, Gao L, Tang YL. Plant miR397 and its functions. Funct Plant Biol. 2021, 48:361-370.

[0102] Kruszka K, Pacak A, Swidabarteczka A, Nuc P, Alaba S, Wroblewska Z,Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z. Transcriptionally and post-transcriptionally regulated microRNAs in heat stress response in barley,J Exp Bot. 2014, 65(20): 6123-6135.

[0103] Park W, Li JJ, Song RT, Messing J, Chen XM. CARPEL FACTORY, a dicerhomolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana . Curr Biol. 2002, 12, 1484-1495.

[0104] Paque S, Weijers D. Auxin: the plant molecule that influences almostanything. BMC Biol. 2016,14(1):67.

[0105] Shen C, Huang YY, He CT, Zhou Q, Chen JX, Tan X, Mubeen S, Yuan JG,Yang ZY. Comparative analysis of cadmium responsive microRNAs in roots of twoIpomoea aquatica Forsk cultivars with different cadmium accumulationcapacities, Plant Physiol. Bioch. 2017, 111: 329-339.

[0106] Shen XX, He JQ, Ping YK, Guo JX, Hou N, Cao FG, Li XW, Geng DL, WangSC, Chen PX. The positive feedback regulatory loop of miR160-Auxin ResponseFactor 17-HYPONASTIC LEAVES 1 mediates drought tolerance in apple trees.Plant Physiol. 2021, 188(3):1686-1708.

[0107] Shi X, Jiang F, Wen J, Wu Z. Overexpression of Solanum habrochaitesmicroRNA319d (sha-miR319d) confers chilling and heat stress tolerance intomato (S. lycopersicum). BMC Plant Biol. 2019, 19(1):214.

[0108] Vaucheret H, Vazquez F, Crété P, Bartel DP. The action of ARGONAUTE1in the miRNA pathway and its regulation by the miRNA pathway are crucial forplant development. Genes Dev. 2004,18(10):1187-1197.

[0109] Wan J, Meng S, Wang Q, Zhao J, Qiu X, Wang L, Li J, Lin Y, Mu L, DangK, Xie Q, Tang J, Ding D, Zhang Z. Suppression of microRNA168 enhances salttolerance in rice (Oryza sativa L.). BMC Plant Biol. 2022, 22(1):563.

[0110] Yang CH, Li DY, Mao DH, Liu X, Ji CJ, Li XB, Zhao XF, Cheng ZK, ChenCY, Zhu LH. Overexpression of microRNA319 impacts leaf morphogenesis andleads to enhanced cold tolerance in rice ( Oryza sativa L.). Plant CellEnviron. 2013, 36(12): 2207-2218.

[0111] Yang Z, Ebright YW, Yu B, Chen X. HEN1 recognizes 21-24 nt small RNAduplexes and deposits a methyl group onto the 2' OH of the 3' terminalnucleotide. Nucleic Acids Res. 2006,34(2):667-675.

[0112] Zhang Y, Xiao T, Yi F, Yu J. SimiR396d targets SiGRF1 to regulatedrought tolerance and root growth in foxtail millet. Plant Sci. 2023, 326:111492.

[0113] Dai Qian, Song Jianghua. Research progress on plant miRNA participation in abiotic stress response. Molecular Plant Breeding, 2022: https: / / kns.cnki.net / kcms / detail / 46.1068.S.20221014.1940.022.html.

[0114] Hu Junpeng, Wang Wenjiang, Li Tingting. Effects of high temperature stress on crop growth and research progress on high temperature tolerance technology. Northwest Agriculture Journal, 2025: 34(6):973-979.

[0115] Qin Cheng, Zhang Zhiming, Liu Hongjun, Gao Jian, Rong Tingzhao, Pan Guangtang. Research progress on miRNAs regulating plant flower development. Journal of Agricultural Biotechnology, 2011: 19(5): 938-952.

[0116] Song Zihe, Zhen Yan. Research progress on miRNAs related to plant drought and salt stress responses. Journal of Nanjing Forestry University (Natural Science Edition), 2024: 48(4): 1-11.

[0117] Yan Hengyu, Li Chaoxia, Li Yubin. Effects of high temperature on maize growth and progress in screening heat-tolerant maize in China. Acta Botanica Sinica, 2024: 59 (6): 1007-1023.

[0118] Zhou Wenjie, Zhang Wenhan, Jia Wei, Xu Zicheng, Huang Wuxing. Research progress on plant miRNA response to abiotic stress. Acta Botanica Sinica, 2024: 59 (5): 810-833.

Claims

1. ZmMIR319A Application of genes in regulating heat tolerance in maize; characterized by, Knockout in corn ZmMIR319A This leads to increased sensitivity of corn to high-temperature environments and overexpression ZmMIR319A This subsequently led to a decrease in the plant's sensitivity to high-temperature stress; ZmMIR319A The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the sequence of the mature miRNA319 it encodes is shown in SEQ ID NO.2; ZmMIR319A It also includes the nucleotide sequence of SEQ ID NO.1 that has been substituted with one or more nucleotides but encodes the same mature sequence as SEQ ID NO.

2.

2. A method for creating a high-temperature resistant mutant of maize, characterized in that, By using transgenic technology to increase the expression of the ZmMIR319A gene as described in claim 1, heat-resistant maize materials can be obtained.

3. A method for creating a high-temperature-sensitive mutant of maize, characterized in that, By using CRISPR / Cas9 gene editing technology to knock out the ZmMIR319A gene as described in claim 1, high-temperature sensitive maize material can be obtained.

4. The method according to claim 3, characterized in that, The CRISPR / Cas9 gene editing technology used to design a CRISPR / Cas9 vector targeting the maize ZmMIR319A gene has MT1 as its target site, and its DNA sequence is shown in SEQ ID NO.

3.

5. Obtained using the method of claim 4 ZmMIR319A Mutant genes ZmMIR319A-KO#1 ZmMIR319A-KO#2 and ZmMIR319A-KO#3 Its characteristics are: Compared to the mature miRNA319 sequence of claim 1, ZmMIR319A-KO#1 The mature sequence encoded by ZmMIR319A-KO#2 is missing 9 bp at positions 1-9; the mature sequence encoded by ZmMIR319A-KO#2 is missing 3 bp at positions 6-8; the mature sequence encoded by ZmMIR319A-KO#3 is missing the "C" base at position 6.

Images