Primer probe combination for detecting mycoplasma gallisepticum based on RPA-CRISPR / Cas13a and application

Abstract

The invention discloses a primer probe combination for detecting mycoplasma gallisepticum based on RPA-CRISPR / Cas13a and application, and belongs to the technical field of gene detection. The primer probe combination is composed of an upstream primer as shown in SEQ ID NO. 3, a downstream primer as shown in SEQ ID NO. 4 and a crRNA probe as shown in SEQ ID NO. 5. According to the designed primer probe combination, nucleic acid is amplified by utilizing an RPA amplification technology, a product is subjected to in-vitro transcription, finally, the in-vitro transcription product is guided by a crRNA probe, Cas13a enzyme digestion single-stranded RNA report sequence is utilized, detection is performed through a fluorescence signal, the mycoplasma gallisepticum can be rapidly detected specifically, the lowest detection limit can reach 0.1 copy / mu L, and the detection time is greatly shortened. The problems of insensitivity, long time, high cost and the like of the current detection method are solved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, in particular to a primer probe combination for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a and application thereof. BACKGROUND

[0002] Mycoplasma gallisepticum (MG) can infect various birds, including chickens, ducks, geese, pigeons, quails, turkeys, and sparrows, and is the most pathogenic and economically devastating avian mycoplasma. The disease caused by MG is usually referred to as chronic respiratory disease (CRD). MG infection causes chronic respiratory symptoms and is accompanied by mucosal catarrhal inflammation, and can also cause severe air sac inflammation. The clinical manifestations include cough, runny nose, tearing, dyspnea or open-mouth breathing, and severe cases can hear wet rales. MG infection can also cause a decrease in egg production and quality, a decrease in hatchability of breeding eggs, growth retardation in broilers, and low feed utilization. It can be horizontally and vertically transmitted, circulates within the flock, and is difficult to completely eliminate. In addition, infection with this pathogen can severely reduce the resistance of the population, leading to concurrent and secondary infection with multiple pathogens, and is considered an important predisposing factor for avian respiratory disease.

[0003] Currently, the prevention and control of MG mainly rely on vaccination and drug treatment, and the most effective method for preventing and controlling avian mycoplasma infection is to cultivate healthy breeding chicken flocks without the pathogen, thereby cutting off the transmission of avian mycoplasma at the source. In the purification process, detection technology is particularly important, therefore, early diagnosis of MG is a key link in the prevention and control of avian mycoplasmosis. The diagnosis of MG is mainly based on the isolation and identification of the pathogen, serology, and molecular biology methods. Due to the slow growth of mycoplasma, long isolation period, and low isolation rate, the isolated mycoplasma still needs further identification, which is not suitable for early diagnosis and cannot meet the needs of rapid clinical detection. Serological diagnosis is prone to non-specific agglutination, resulting in false positive results, and the hemagglutination inhibition test (HI) is not suitable for the early stage of infection, and there is no commercial HI antigen. Molecular biology methods mainly include PCR and fluorescent quantitative PCR, which have high requirements for laboratory conditions and professional skills of operators, require expensive professional temperature control equipment, and take a relatively long time, making the application outside the laboratory greatly limited.

[0004] In recent years, many methods for rapid detection of pathogenic microorganisms have been developed, mainly including loop-mediated isothermal amplification (LAMP) detection technology and recombinase polymerase amplification (RPA). These methods can be used as effective tools for point-of-care testing (POCT), and can be completed using small portable instruments with heating modules, which are suitable for more diverse detection scenarios and are the current research hotspot. However, LAMP requires 4-6 primers, and the target sequence and primer design have high requirements; RPA has a certain compatibility for base mismatches during amplification, which is easy to cause non-specific amplification; the use of these methods alone still has many drawbacks in practical application, and needs to be combined with other detection technologies to achieve better detection results. In recent years, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and its associated protein (Cas) system has shown great potential in virus detection field due to its rapid and accurate cutting ability. It has been reported that researchers have developed many high-sensitivity, high-specificity, low-time-consuming diagnostic platforms by combining Cas protein with signal amplification and conversion technology, providing a new way for pathogenic nucleic acid detection. Among them, one of the most widely used strategies is to first amplify the target sequence by RPA to obtain a large amount of detection template, and then use the CRISPR / Cas system for specific recognition to activate the Cas effector protein to cut the fluorescent probe in the reaction system, thereby realizing the detection of low-load samples. In the selection of Cas protein, Cas13a is the most popular due to its unique trans-cleavage activity and low restriction on target sequence. This new detection method based on RAA-CRISPR / Cas13a combines the advantages of two detection technologies, and has greater improvement in sensitivity and specificity than the use of RPA or CRISPR / Cas detection method alone, and has been applied in the rapid detection of some animal diseases and zoonotic pathogenic microorganisms. SUMMARY

[0005] The purpose of the present application is to provide a primer probe combination for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a and application thereof, so as to solve the problems existing in the prior art. The primer probe combination is designed, the nucleic acid is amplified by using the RPA amplification technology, the product is in vitro transcribed, and finally the in vitro transcription product is cut by using the Cas13a enzyme under the guidance of the crRNA probe Single-stranded RNA reporter sequence is detected by fluorescence signal. The present application uses the RPA-CRISPR / Cas13a system to establish a new method for isothermal rapid detection of MG, reduces the requirements of traditional molecular biology detection methods for experimental equipment, operators and detection environment, enriches the POCT detection means of MG, and also provides a reference for the establishment of other bacterial rapid detection technology.

[0006] To achieve the above purpose, the present application provides the following scheme:

[0007] The present application provides a primer probe combination for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a, which is composed of an upstream primer as shown in SEQ ID NO. 3, a downstream primer as shown in SEQ ID NO. 4 and a crRNA probe as shown in SEQ ID NO. 5.

[0008] Further, the upstream primer and the downstream primer are designed based on the 918bp conserved region specific to mgc2 gene, and the sequence of the 918bp conserved region is shown in SEQ ID NO. 1; the crRNA probe is a RNA form that can guide the Cas13a protein to cut the transcription product of the target gene of Mycoplasma gallisepticum and the single-stranded RNA reporter sequence.

[0009] The present application also provides the application of the primer probe combination in any of the following:

[0010] (1) Application in the preparation of a kit for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a;

[0011] (2) Application in the preparation of a product for diagnosing chronic respiratory diseases.

[0012] The present application also provides a kit for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a, which comprises the primer probe combination.

[0013] Further, it further comprises recombinase polymerase, dNTP, T7 RNA polymerase, NTP Mix, RNAase inhibitor, single-stranded RNA reporter sequence, buffer, Cas protein.

[0014] Further, the single-stranded RNA reporter sequence contains at least one of UUU, AUU, UAU, UUA, AAU, AUA, UAA and AAA.

[0015] Further, the 5' end of the single-stranded RNA reporter sequence is modified with a fluorescent reporter group; the 3' end of the single-stranded RNA reporter sequence is modified with a fluorescent quencher group; the fluorescent reporter group comprises Atto 425, BODIPY FL, FAM, Oregon Green 488, TET, JOE, R6G, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, Cy5, Quasar 670 or Cy5.5; the fluorescent quencher group comprises BHQ1, BHQ2, BHQ3, BBQ650, MGB or Dabcyl.

[0016] The present application also provides the use of the kit in any one of the following:

[0017] (1) in the preparation of a product for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a.

[0018] (2) in the preparation of a product for diagnosing chronic respiratory diseases.

[0019] The present application also provides a method for detecting Mycoplasma gallisepticum in vitro for non-diagnostic purposes, comprising using the genomic DNA of the sample to be tested as a template and performing RPA-CRISPR / Cas13a reaction with the primer probe combination, and then irradiating with blue light after the reaction is completed; if fluorescence is observed, the sample to be tested contains Mycoplasma gallisepticum; if no fluorescence is observed, the sample to be tested does not contain Mycoplasma gallisepticum.

[0020] The present application uses Cas protein to cut the target site of Mycoplasma gallisepticum under the guidance of crRNA probe, releases the FPS distal product after in vitro transcription of single-stranded RNA substrate, activates non-specific cutting of single-stranded RNA reporter sequence, and determines the result by observing fluorescence with the naked eye under the irradiation of blue flashlight.

[0021] Further, the reaction system of the RPA-CRISPR / Cas13a reaction is 2 μL of DNA template, 10 μM of upstream and downstream primers, 5 μL of 10× recombinase polymerase, 5 μL of 1× dNTP, 0.5 μL of T7 RNA polymerase, 1 μL of NTP Mix, 1 μL of RNase inhibitor, 1.6 μL of 10 nM crRNA probe, 1 μL of 0.5 μM single-stranded RNA reporter sequence, 40 μL of 1× buffer I, 20 μL of 100 nM Cas13a and 1× buffer II;

[0022] The components of the buffer I are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / mL bovine serum albumin and 280 mM magnesium acetate; and the components of the buffer II are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 and 100 g / mL bovine serum albumin.

[0023] Further, the reaction condition of the RPA-CRISPR / Cas13a reaction is constant temperature at 37℃, and the reaction is 60 min.

[0024] The present application discloses the following technical effects:

[0025] The present application selects the mgc2 gene of MG as a target gene for detection, designs a set of RPA primers and crRNA probes in combination with the conserved region of the gene, amplifies nucleic acids by using RPA amplification technology and carries out in vitro transcription, cuts the single-stranded RNA reporter sequence by using Cas13a enzyme under the guidance of the crRNA probe product, and detects by using the fluorescence signal, which can specifically and rapidly detect Mycoplasma gallisepticum, and the minimum detection limit can reach 0.1 copy / μL.

[0026] The present application can not only rapidly detect the result, but also solve the problems of current detection methods, such as insensitivity, long time and high cost. BRIEF DESCRIPTION OF DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0028] Figure 1 The fluorescence report result of the crRNA probe based on the in vitro transcription product of the optimal RPA primer;

[0029] Figure 2 The sample concentration detected by using the kit is 107 copies / μL, 10 5 copies / μL and 10 3 copies / μL of mgc2 gene recombinant plasmid and the blue light report results of the NC group (water);

[0030] Figure 3 The detection results of different sample genomic DNA detected by the kit prepared in Example 2, respectively; wherein, MG350: M. gallisepticum CVCC350 strain; MG352: M. gallisepticum CVCC352 strain; M. synoviae: M. synoviae CVCC2960; M. felis: M. felis isolated strain; E. coli: E. coli ATCC25922; S. typhimurium: S. typhimurium ATCC14028; E. faecalis: E. faecalis ATCC29212; S. suis: S. suis ATCC49619; S. aureus: S. aureus ATCC29213; NC: water;

[0031] Figure 4 The fluorescence signal results of M. gallisepticum mgc2 gene recombinant plasmid samples with different concentrations (10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 1 copy / μL and 0.1 copy / μL) and the NC group (water). DETAILED DESCRIPTION

[0032] The various illustrative embodiments of the present application will now be described in detail below. This detailed description is merely intended to teach a person skilled in the art further details about the various aspects and features of the present application and is not intended to limit the scope of the application. Therefore, specific structural and functional details disclosed herein are not to be interpreted as limiting, but merely as a basis for the claims and for teaching one skilled in the art to variously employ the present application.

[0033] It should be understood that the terms used in the present application are merely used to describe particular embodiments and are not intended to limit the present application. In addition, for the numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range within the range of any stated value or stated range, as well as between any other stated value or stated range, is also encompassed within the scope of the present application. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described therein. In the case of conflict between the present specification and any document incorporated herein by reference, the present specification will control.

[0035] Many modifications and variations of the present application described in the specific embodiments of the application can be made by those skilled in the art without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application. The specification and examples are illustrative only.

[0036] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", and the like are open-ended terms that are intended to permit but not limit the inclusion of elements or the number of elements, as well as the possibility that one or more other elements can be added or otherwise included.

[0037] Mycoplasma gallisepticum CVCC350, Mycoplasma gallisepticum CVCC352, Mycoplasma synoviae CVCC2960, Escherichia coli ATCC25922, Salmonella typhimurium ATCC14028, Enterococcus faecalis ATCC29212, Streptococcus suis ATCC49619, Staphylococcus aureus ATCC29213 used in the embodiments of the present application are standard strains purchased; Mycoplasma felis was isolated by the Veterinary Drug Residue Standard Laboratory of Huazhong Agricultural University and preserved in the China Center for Type Culture Collection with the preservation number CCTCC NO: M 20242126.

[0038] Example 1

[0039] 1. Preparation of single-stranded RNA reporter sequence

[0040] LwCas13a non-specifically cleaves single-stranded RNA with UU preference, and the single-stranded RNA reporter sequence (5'-3') is UUUUUU, 5' end Texas Red modification, 3' end BHQ2 modification, i.e. Texas Red-UUUUUU-BHQ2.

[0041] The single-stranded RNA reporter sequence is synthesized, purified and confirmed by a bioengineering synthesis related company.

[0042] 2. Screening and preparation of RPA primers

[0043] (1) Determination of candidate target sequences

[0044] Based on the mgc2 gene reference sequence of MG, combined with the gene sequences of Mycoplasma gallisepticum sequenced in the laboratory and the gene sequences of Mycoplasma gallisepticum searched in the National Center for Biotechnology Information (NCBI) gene library and aligned, the mgc2 gene target sequence is shown as SEQ ID NO. 1.

[0045] mgc2 gene reference sequence (SEQ ID NO. 1):

[0046] ATGTTTGGTCTTAAAAAGTTAAATTCTAAACTTGTTGGAGTTAGCTTTGTGTTCTCGGGTGCTATTGCTCTTGGAACTGGAGTTGGTCTAACCAGTGAACACAAATACGAACATTCACCTACACTTGTTTTACATGAAGGTGAAACTAACTCCGTTGGTCCAAGAAAGATTACCTCCGAACCCTGATTTTATCCAGTAGTGGGTGCAGGTGCTGGGTTGATTGTTGTTTCTTTACTCTTGGGTTTAGGGATTGGGATTCCGATCGCTAAGAAAAAAGAAAGAATGATGATCCAAGAACGTGAAGAACACCAAAAGATGGTTGAATCCCTTGGAATAATTGAAGAACAAAATAAAACAGAAGCGATTGAGCCAACTGCAGCAGTGCCAACTGAAGAAGTTAATACTCAAGAACCAACTCAACCAGCTGGTGTTAATGTAGCTAATAACCCTCAGATAGGGATCAATCAACCAGGATTTAATCAACCTCAGATTAATCCGCAATTTGGTCCTAATCCCCAACAAAGAATTAACCCACAGGGCTTTGGTGGCCCAATGCCACCTAACCAAATGGGAATGCGACCAGGGTTTAACCAAATGCCCCCACAAATGGGAGGAATGCCACCTAACCAAATGGGAATGCGACCAGGGTTTAACCAAATGCCCCCACAAATGGGAGGAATGCCACCAAGACCAAACTTCCCTAACCAAATGCCTAATATGAACCAACCAAGACCAGGTTTCAGACCACAACCTGGTGGTGGTGGGGTGCCGATGGGAAATAAAGCTGGAGGTGGGTTTAATCACCCAGGTGCACCAATGGGTCCAAACCGCATGAACTTCCCTAATCAAGGAATGAATCAGCCCCCACACATGGCAGGACCAAGAGCTGGTTTGCCACCACAAAATGGACCTAGATAA.

[0047] Conserved regions of the above genes were selected for further study.

[0048] (2) Screening and preparation of candidate RPA primers

[0049] Based on the conserved region sequence, the primer length is limited to 25-36bp and the product length is 80-300bp. Use primer design related software or websites for retrieval, select the three primer pairs with the highest scores, and add the T7 promoter sequence before the upstream primer to facilitate the subsequent in vitro transcription process. RPA primers are synthesized, purified, and confirmed by bioengineering synthesis related companies. Through RPA amplification experiments, the optimal RPA primers are determined based on the amplified band size and product content. The optimal RPA primer sequences are shown in SEQ ID NO. 3-4.

[0050] Upstream primer (SEQ ID NO.3): TAATACGACTCACTATAGGG AATAATTGAAGAACAAAATAAAACAGAAGC (the underlined portion is the T7 promoter sequence);

[0051] Downstream primer (SEQ ID NO. 4): CCTGTGGGTTAATTCTTTGTTGGGGA.

[0052] 3. Screening and preparation of crRNA probes

[0053] (1) Determination of candidate crRNA probe sequences

[0054] Under the guidance of crRNA, the CRISPR / Cas13a system recognizes RNA with a protospacer flanking site (PFS) sequence (the 3' end is composed of A, U, or C), and exhibits efficient cleavage of target RNA. The Cas13a protein consists of a crRNA recognition lobe (REC) and a nuclease lobe (NUC). This biloba structure gives Cas13a two types of RNA enzyme activity. Based on the special PFS sequence (composed of A, U, or C at the 3' end) identified by LwCas13a, a crRNA targeting the mgc2 gene was designed. A crRNA probe with a higher score was selected. The crRNA targeting sequence is shown in SEQ ID NO.2.

[0055] crRNA targeting sequence (SEQ ID NO.2):

[0056] AATAATTGAAGAACAAAATAAAACAGAAGC GATTGAGCCAACTGCAGCAGTGCCAACTGAAGAAGTTAATACTCAAGAACCAACTCAACCAGCTGGTGTTAATGTAGCTAATAACCTCAGATAGGGATCAATCAACCAGGATTTAATCAACCTCAGATTAATCCGCAATTTGGTCCTAA TCCCCAACAAAGAATTAACCCACAGG(The underlined part is the sequence that matches the RPA primer, and the bold part is the sequence that matches the crRNA probe).

[0057] (2) Preparation of candidate crRNA probes

[0058] A T7 promoter sequence was added before the DNA sequence corresponding to the crRNA probe, followed by its complementary sequence, which was slowly annealed to form a double-stranded DNA sequence. This was used as a template for in vitro transcription, and T7 RNA polymerase was added. The mixture was incubated at 37°C for 4 hours, and the DNA template was digested with DNase I. The crRNA probe was then recovered using an RNA purification kit.

[0059] (3) Screening of optimal crRNA probes

[0060] Using 2 μL of target gene double-stranded DNA at the same concentration as the substrate, 1.25 μL of crRNA probe and 1 μL of single-stranded RNA reporter sequence were added. The intensity of the fluorescent signal was compared to screen for crRNA probes with high specificity and sensitivity. The optimal crRNA probe sequence screened is shown in SEQ ID NO. 5.

[0061] crRNA probe sequence (SEQ ID NO. 5): GAUUUAGACUACCCCAAAAACGAAGGGGACUA AAACGUUGAUUAAAUCCUGGUUGAUUGAUCCC.

[0062] The results of the fluorescence reporter experiment of the crRNA probe based on the in vitro transcription product of the optimal RPA primer are as follows Figure 1 shown.

[0063] Example 2

[0064] 1. Preparation of a CRISPR / Cas13a-based kit for detecting Mycoplasma gallisepticum

[0065] 2.4 μL each of 10 μM RPA upstream and downstream primers, 5 μL of 10× recombinase polymerase, and 5 μL of 1× dNTP were lyophilized at the bottom of the PCR tube to obtain lyophilized reagent 1, and then vacuum-sealed in a tin foil bag for storage. When in use, 40 μL of buffer I was added to the PCR tube and reconstituted. 0.5 μL of T7 RNA polymerase, 1 μL of NTP Mix, 1 μL of RNase inhibitor, 1.6 μL of 10 nM crRNA probe, 1 μL of 0.5 μM single-stranded RNA reporter sequence, and 20 μL of 100 nM Cas13a protein were lyophilized in a vial. When in use, 20 μL of buffer II was added. After reconstitution, the transcription and detection solution was obtained. The above reagents and blue light flashlight were packaged in a packaging box to obtain a kit. The components of buffer I and buffer II are shown in Table 1.

[0066] Table 1 Buffer I and Buffer II components

[0067]

[0068] 2. Detection of Mycoplasma gallisepticum using the kit

[0069] PCR amplification was performed using the extracted MG352 genome as a template and optimal RPA primers without promoter sequences (F: AATAATTGAAGAACAAAATAAAACAGAAGC (SEQ ID NO. 6); R: CCTGTGGGTTAATTCTTTGTTGGGGA (SEQ ID NO. 4).

[0070] Amplification system (20 μL in total): 2 μL of template, 10 μL of 2x Taq PCR Mix, 1 μL of each of the upper and lower primers, and 6 μL of ddH2O.

[0071] Amplification procedure: 5 min of pre-denaturation at 95°C; 30 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; and 6 min of re-extension at 72°C. After the reaction, 1% agarose gel electrophoresis was performed to detect the target fragment, which was then cut, recovered, and purified. The purified DNA was ligated with a pGEM-T vector, and the ligation product was placed at 4°C overnight. The ligation product was then transferred to competent E. coli DH5α by heat shock, and incubated at 37°C for 1 h. The bacterial solution was spread on an LB plate containing ampicillin (100 μg / mL) using a spreader, and incubated in a 37°C incubator overnight to obtain the cloned bacteria. A single colony was picked for PCR and sequencing, and the primers, amplification system, and amplification procedure were the same as above. The positive cloned bacteria with correct sequencing results were selected for extraction of the recombinant plasmid. After determination of the plasmid concentration and absorbance value (A260 / 280), the copy number of the recombinant plasmid was calculated and diluted to 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 1 copy / μL, and 0.1 copy / μL, and stored at -20°C.

[0072] The recombinant plasmid mgc2 was used as a sample, and the sample concentration was diluted to 10 7 copies / μL, 10 5 copies / μL, and 10 3copies / μL, the kit is used for detection, and the detection steps are as follows:

[0073] 40 μL of buffer I is added to the freeze-dried centrifuge tube for reconstitution;

[0074] 2 μL of the to-be-detected genomic DNA is taken and added to the reconstituted PCR tube, and then mixed uniformly by blowing;

[0075] 20 μL of buffer II is added to the freeze-dried centrifuge tube for reconstitution, which is a transcription and detection reconstitution solution, 7.6 μL of the transcription and detection reconstitution solution is taken and spotted on the tube cap of the PCR tube, and then the PCR tube cap is slowly covered;

[0076] It is placed in a constant temperature environment at 37°C, and reacts for 20 min;

[0077] Centrifugation makes the transcription and detection reconstitution solution enter the reaction system, and 37°C constant temperature reaction is carried out for 40 min;

[0078] The bottom of the PCR centrifuge tube is irradiated with a blue flashlight, and the fluorescence color is observed, and the fluorescence report result is as follows Figure 2 .

[0079] Example 3

[0080] 1. Specific detection

[0081] The genomic DNA of MG350, MG352, synovial mycoplasma, feline mycoplasma, Escherichia coli, Salmonella, Enterococcus, Streptococcus, and Staphylococcus aureus is used as a sample, and the kit is used for detection, and the specificity of the detection method is analyzed. The detection steps are as follows:

[0082] 40 μL of buffer I is added to the freeze-dried centrifuge tube for reconstitution;

[0083] 2 μL of the to-be-detected genomic DNA is taken and added to the reconstituted PCR tube, and then mixed uniformly by blowing;

[0084] 7.6 μL of the transcription and detection reconstitution solution is taken and spotted on the tube cap of the PCR tube, and then the PCR tube cap is slowly covered;

[0085] It is placed in a constant temperature environment at 37°C, and reacts for 20 min;

[0086] Centrifugation makes the transcription and detection reconstitution solution enter the reaction system, and 37°C constant temperature reaction is carried out for 40 min;

[0087] The bottom of the PCR centrifuge tube is irradiated with a blue flashlight, and the fluorescence color is observed, and the fluorescence report result is as follows

[0088] The specific detection result is as shown in Figure 3 Figure 3 ​It can be seen that the kit prepared in Example 2 of the present invention can successfully detect MG350 and MG352, while Mycoplasma synoviae, Mycoplasma felis, Escherichia coli, Salmonella, Enterococcus, Streptococcus, and Staphylococcus aureus have no fluorescent signals and cannot be detected, demonstrating that the detection method of the present invention has good specificity.

[0089] 2. Sensitivity detection

[0090] With 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 The sensitivity of the detection method of the present invention was analyzed using a kit with concentrations of recombinant plasmids of the M. gallisepticum mgc2 gene at concentrations of 1 copy / μL, 0.1 copy / μL, and 1 copy / μL as samples, and a negative control supplemented with water. The detection steps were the same as those in "1. Specificity Detection."

[0091] Sensitivity test results are as follows Figure 4 As shown by Figure 4 It can be seen that the kit prepared in Example 2 of the present invention was used to detect the recombinant plasmid of Mycoplasma gallisepticum mgc2. 7 ~10 -1 Fluorescence signals can be observed within the concentration range of copies / μL, and the minimum detection limit can reach 0.1 copy / μL, with high sensitivity.

[0092] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. A primer-probe combination for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a, characterized in that: It consists of an upstream primer as shown in SEQ ID NO.3, a downstream primer as shown in SEQ ID NO.4 and a crRNA probe as shown in SEQ ID NO.

5.

2. Use of the primer-probe combination according to claim 1 in any of the following: (1) Application in the preparation of a kit for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a; (2) Application in the preparation of products for diagnosing chronic respiratory diseases.

3. A kit for detecting Mycoplasma gallisepticum based on RPA-CRISPR / Cas13a, characterized in that: The method comprises the primer-probe combination according to claim 1.

4. The kit according to claim 3, wherein Also included are recombinase polymerase, dNTPs, T7 RNA polymerase, NTP Mix, RNase inhibitor, single-stranded RNA reporter sequence, buffer, and Cas protein.

5. The kit according to claim 4, wherein The single-stranded RNA reporter sequence contains at least one of UUU, AUU, UAU, UUA, AAU, AUA, UAA and AAA.

6. The kit according to claim 5, wherein The 5' end of the single-stranded RNA reporter sequence is modified with a fluorescent reporter group; and the 3' end of the single-stranded RNA reporter sequence is modified with a fluorescent quencher group.

7. Use of the kit according to any one of claims 3 to 6 in any one of the following: (1) Application in the preparation of products based on RPA-CRISPR / Cas13a for the detection of Mycoplasma gallisepticum; (2) Application in the preparation of products for diagnosing chronic respiratory diseases.

8. A method for detecting Mycoplasma gallisepticum in vitro for non-diagnostic purposes, characterized in that: The method comprises using the genomic DNA of a sample to be tested as a template, performing an RPA-CRISPR / Cas13a reaction using the primer-probe combination of claim 1, and irradiating with blue light after the reaction. If fluorescence is observed, the sample to be tested contains Mycoplasma gallisepticum; if no fluorescence is observed, the sample to be tested does not contain Mycoplasma gallisepticum.

9. The method according to claim 8, wherein The reaction system of the RPA-CRISPR / Cas13a reaction is 2 μL of DNA template, 2.4 μL of 10 μM upstream and downstream primers, 5 μL of 10× recombinase polymerase, 5 μL of 1× dNTP, 0.5 μL of T7 RNA polymerase, 1 μL of NTP Mix, 1 μL of RNase inhibitor, 1.6 μL of 10 nM crRNA probe, 1 μL of 0.5 μM single-stranded RNA reporter sequence, 40 μL of 1× buffer I, 100 nM Cas13a and 20 μL of 1× buffer II; The components of the buffer I are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / mL bovine serum albumin and 280 mM magnesium acetate; the components of the buffer II are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 and 100 g / mL bovine serum albumin.

10. The method according to claim 8, wherein The reaction conditions of the RPA-CRISPR / Cas13a reaction were a constant temperature of 37° C. and a reaction time of 60 min.

Images