Rickettsia pathogen nucleic acid detection quality control product and preparation method and application thereof

Abstract

The invention relates to the technical field of gene engineering and gene detection, particularly provides a rickettsia pathogen nucleic acid detection quality control product and a preparation method and application thereof, and comprises a recombinant artificial chromosome vector, an engineering bacterium and a preparation method and application scene thereof. The artificial chromosome engineering strain with low copy number is constructed by designing and preferably selecting seven kinds of rickettsia conserved target sequences, so that the technical problem that the existing quality control product cannot simulate pathogen wall breaking to release nucleic acid is solved. The quality control product has excellent stability and bionic simulation capability, is suitable for platforms such as multiple fluorescent PCR (Polymerase Chain Reaction) and the like, can evaluate detection sensitivity and specificity, can monitor nucleic acid extraction efficiency, and provides technical support for research, development and quality control of in-vitro diagnostic reagents.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and gene detection technology, and particularly relates to a rickettsia class pathogen nucleic acid detection quality control product and a preparation method and application thereof. BACKGROUND

[0002] Infectious diseases are extremely common in clinical practice, and laboratory auxiliary examination is crucial for the diagnosis and treatment of infectious diseases. Rickettsia class pathogens are a class of obligate intracellular parasitic gram-negative bacteria, including seven important pathogens such as Rickettsia prowazekii, Rickettsia mooseri, Orientia tsutsugamushi, Coxiella burnetii, Rickettsia siberica, Ehrlichia and Anaplasma phagocytophilum. These pathogens are transmitted by arthropod vectors and can cause a variety of serious diseases such as typhus, Q fever and tsutsugamushi disease. Due to the difficulty in culturing rickettsia and the cross-reaction of serological detection, nucleic acid detection has become the main diagnostic method.

[0003] In recent years, with the popularization of nucleic acid detection technology in pathogen diagnosis, the development of multi-pathogen combined nucleic acid detection quality control products has become a key focus of the National Medical Products Administration (NMPA). A number of approved joint quality control products (such as eight respiratory tract pathogen nucleic acid detection quality control products (national medical device registration 20223400608), lower respiratory tract pathogen nucleic acid detection quality control products (national medical device registration 20243402122) and new coronavirus / influenza virus / respiratory syncytial virus nucleic acid quality control products (national medical device registration 20253401044)) show that the role of complex nucleic acid detection quality control products in standardizing laboratory operations and improving the reliability of multiplex detection is increasingly prominent.

[0004] However, the nucleic acid detection of rickettsia class pathogens still faces the problem of disconnection between quality control products and clinical practice: the existing quality control products cannot fully simulate the sample extraction process, and the current commercial quality control products are mostly plasmid DNA or in vitro transcribed RNA. This type of naked nucleic acid cannot reflect the process of pathogen wall breaking and nucleic acid release in clinical samples in the nucleic acid extraction link, resulting in insufficient evaluation of extraction efficiency and possibly masking the risk of false negatives in actual detection. In addition, plasmid stability has many limitations and the concentration design is not reasonable, and conventional plasmid quality control products usually exist in high copy number (> 100 copies), which may cause sequence variation and topological heterogeneity after long-term subculture, resulting in quantitative result drift (such as the Ct value fluctuation exceeding the allowed range in external quality evaluation in some provincial CDC laboratories). At the same time, the difference between high copy number and low load pathogen in clinical samples (such as the acute phase blood sample load of Orientia tsutsugamushi is usually < 50 copies / μL) affects the clinical relevance of quality control.

[0005] On the other hand, the lack of a composite quality control system covering multiple pathogens is also a major challenge. Rickettsial pathogens include at least seven important pathogenic species (such as Rickettsia prowazekii / Rochetsia mossneri, Orientia tsutsugamushi, etc.), and there are serological cross-reactions. Existing single-pathogen quality control products (such as Rickettsia burnetii or tsutsugamushi single test kits) are difficult to meet the quality control requirements of multiplex PCR technology, resulting in deficiencies in laboratories' verification of detection specificity and cross-contamination control capabilities.

[0006] The results of national quality control assessments further confirm the urgency of development: external quality assessments of CDC laboratories nationwide show that the sensitivity pass rate for Rickettsia nucleic acid testing is only 50% to 62.5% (for example, the pass rate for P4-P6 template testing is only 50%), and Ct values ​​vary significantly between laboratories (with the maximum fluctuation exceeding 3 cycles). This is mainly attributed to the laboratories' reliance on non-standardized, homemade quality control materials, the lack of biomimetic quality control materials that can monitor the entire "extraction-amplification-analysis" process, and the lack of cross-validation methods in multiple tests.

[0007] Therefore, developing a combined quality control product that can simulate the sample nucleic acid release process, cover multiple pathogen targets and has better stability than plasmids is not only a technical necessity to improve the accuracy of laboratory diagnosis, but also a key breakthrough point in responding to NMPA's strategy to promote the standardization of multi-pathogen joint inspection and quality control. Summary of the Invention

[0008] The present invention provides a quality control product for nucleic acid detection of rickettsial pathogens, as well as its preparation method and application. Through bioinformatics analysis, the present invention designed and optimized conserved target sequences of seven important rickettsial pathogens. These sequences were integrated into an artificial chromosome system to construct an engineered strain. This engineered strain exhibits excellent stability and the ability to simulate clinical samples during nucleic acid extraction, amplification, and detection, resolving the technical issue of existing quality control products that cannot simulate the process of pathogen cell wall rupture and nucleic acid release during nucleic acid extraction.

[0009] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0010] A quality control product for nucleic acid detection of rickettsial pathogens, the quality control product being an engineered bacterium carrying a recombinant artificial chromosome vector, wherein the recombinant artificial chromosome vector comprises a combination of conserved fragments of target genes of the following seven rickettsial pathogens:

[0011] (1) the conserved fragment of the ompB gene of Rickettsia prowazekii, the nucleic acid sequence of which is shown as SEQ ID NO. 1, TTTCCGCAGGATTGGTAACTGCTTCCACGGCTACTATAGTAGCTGGTTTCTCTGGTGTAGCAATGGGTGCTGCTATGCAATATAATAGGACAACAAATGCAGCAGCTACAACCTTTGATGGTATAGGCTTTGATCAAGCTGCTGGTGCTAATATTCCTGTCGCTCCAAATTCAGTTATTACTGCTAATGCTAATAATCCT;

[0012] (2) the conserved fragment of the ompB gene of Rickettsia montanum, the nucleic acid sequence of which is shown as SEQ ID NO. 2, CAGCTACAACTGTTGATGGTGCAGGATTTGATCAAACTGGCGCTGGTGT TAATCTTCCTGTCGCTACAAATTCGGTTATTACTGCTAATTCTAATAATGCT ATTACTTTTAATACTCCAAACGG;

[0013] (3) the conserved fragment of the Tsa56 gene of Orientia tsutsugamushi, the nucleic acid sequence of which is shown as SEQ ID NO. 3, TTATGTTAATTGCTAGTGCAATGTCTGCGTTGTCGTTGCCATTTTCAGCTAGTGCAATAGAATTGGGGGAAGAAGGATTAGAGTGTGGTCCTTATGCTAAAGTTGGAGTTGTTGGAGGAATGATTACTGGCGTAGAATCTGCTCGCTTGGATCCAGCTGATGCTGAAGGC;

[0014] (4) the conserved fragment of the com1 gene of Coxiella burnetii, the nucleic acid sequence of which is shown as SEQ ID NO. 4, GCCAATCGCAATACGCTGCCAAAGTATCATTAGCAGCCGCTAAACAAGGAAAATATTATGCTTTCCACGACGCGCTGCTCAGTGTCGACGGCCAATTATCAGAACAAATCACCCTTCAAACCGCAGAAAA;

[0015] (5) The nucleic acid sequence of the conserved fragment of the ompA gene of the Rickettsia spotted fever group is shown as SEQ ID NO. 5, ATTTCAAAAAGCAATACAACAAGGTCTTAAAGCCGCTTTATTCACCA CCTCAACCGCAGCGATAATGCTGAGTAGTAGTGGGGCACTCGGTGTTGCT GCAGGTGTTATTGCTACTAATAATGATGCAGCATTTAGTAATGATGCTGC;

[0016] (6) The nucleic acid sequence of the conserved fragment of the 16S rRNA gene of Ehrlichia is shown as SEQ ID NO. 6, ATAGCGGAATTCCTAGTGTAGAGGTGAAATTCGTAGATATTAGGAGGAACACCAGTGGCGAAAGCGGCTATCTGGTTCGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGAGTGCTAAATGTGAGGAT;

[0017] (7) The nucleic acid sequence of the conserved fragment of the gltA gene of Anaplasma phagocytophilum is shown as SEQ ID NO. 7, TTTCTGCTTTAGCTGCTAATTACCACGCAAGTCGCATTGATCCGCTTAC AGGTGCTATCATCGCAATTGCGAAAGTACCCGGCATTGTTGCAAGTATTTAT AGGCACACTGCAAATCTAGATTTTATACAAGCTGACGCAAACTTAGAGT;

[0018]

[0019] Further, the size of the combined fragment is 1093 bp.

[0020] Further, the construction method of the recombinant artificial chromosome vector comprises the following steps:

[0021] S1. Obtain the full-length sequences of the target genes of the seven rickettsial pathogens, use a multiple sequence alignment tool to remove insertion and deletion regions to determine the conserved fragments, and there is no homologous sequence between the selected seven rickettsial pathogens to ensure the genetic stability of the combined fragment, splice into the combined fragment as shown in SEQ ID NO. 8 by seamless ligation technology, and clone into a pUC57 vector;

[0022] S2. Obtain the target fragment by PCR amplification using specific primers Ric-F and Ric-R, the nucleic acid sequence of the specific primer Ric-F is as shown in SEQ ID NO. 9, specifically: TCCAGGGTCCTA GATCTGAATTCACTCTAAGTTTGCGTCAGCTT, and the nucleic acid sequence of the specific primer Ric-R is as shown in SEQ ID NO. 10, specifically: CTCTAGTACTTCTCGACAAGCTTT TTCCGCAGGATTGGTAACTG;

[0023] S3. Double enzyme cut the pBac-N-EGFP vector using EcoR I and Hind III restriction endonucleases;

[0024] S4. Use a homologous recombination kit to seamlessly connect the target fragment into the linearized vector;

[0025] S5. Transform the ligation product into competent cells E. coli DH5α, screen positive clones by broth PCR and verify by sequencing.

[0026] Further, the preparation method of the engineering bacteria carrying the recombinant artificial chromosome vector comprises the following steps:

[0027] S1. Transform the recombinant artificial chromosome vector into competent cells DH10Bac, and culture on LB fixed medium containing kanamycin, tetracycline, gentamicin, X-Gal and IPTG;

[0028] S2. Pick white monoclonal colonies and inoculate into LB liquid medium containing kanamycin, tetracycline, and gentamicin for expansion culture;

[0029] S3. The artificial chromosome DNA of the engineered bacteria was extracted and verified by PCR and sequencing analysis using specific primers pUC / M13-F and pUC / M13-R. The nucleic acid sequence of the specific primer pUC / M13-F is shown in SEQ ID NO.11, specifically CCCAGTCACGACGTTGTAAAACG, and the nucleic acid sequence of the specific primer pUC / M13-R is shown in SEQ ID NO.12, specifically AGCGGATA ACAATTTCACACAGG.

[0030] Furthermore, the preparation method of the quality control product comprises the following steps:

[0031] S1. The engineered bacteria were inactivated by heating at 60°C for 1 hour;

[0032] S2. The inactivated engineered bacteria were serially diluted with phosphate buffered saline to extract bacterial artificial chromosome DNA at different concentrations;

[0033] S3. Determine the nucleic acid concentration in the quality control sample by digital PCR quantitative analysis;

[0034] S4. Dilute the quality control product of known concentration to obtain the finished quality control product of the required concentration.

[0035] Furthermore, the quality control product can be used for quality control of nucleic acid detection of Rickettsial pathogens and added to the reaction system as a positive control; can be used to evaluate the sensitivity of nucleic acid detection kits; and can be used to monitor nucleic acid extraction efficiency.

[0036] Beneficial effects of the present invention:

[0037] (1) The present invention provides an artificial chromosome DNA containing conserved target sequences of pathogens including Rickettsia prowazekii, Rickettsia mozekii, Orientia tsutsugamushi, Coxiella burnetii, spotted fever group Rickettsia, Ehrlichia and Anaplasma phagocytophilum. By constructing an engineered strain, a bionic simulation of the nucleic acid extraction process of the quality control product is achieved, solving the technical problem that the existing quality control products cannot simulate the process of pathogen cell wall breaking and releasing nucleic acids.

[0038] (2) The present invention adopts a low-copy number artificial chromosome system, and the target fragment exists stably at a copy number of 1–2 in the engineered bacteria, avoiding the template concentration fluctuation problem caused by the high copy number of traditional plasmids and improving the reliability of the detection results.

[0039] (3) The engineered strain of the present invention has excellent nuclease tolerance and can effectively resist nuclease digestion, thereby ensuring the stability of quality control products in complex environments.

[0040] (4) The engineered strain of the application can be amplified and frozen at low cost and stably, facilitating commercial production and transportation, and providing technical support for the research and development, registration and quality control system construction of in vitro diagnostic reagents. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 The pBac-Ric plasmid vector map constructed for Example 2 is annotated only with elements relevant to the present application.

[0042] Figure 2 Results of the nuclease resistance of the R. prowazekii target detection quality control product and the plasmid in Example 6.

[0043] Figure 3 Results of the nuclease resistance of the R. mooseri target detection quality control product and the plasmid in Example 6.

[0044] Figure 4 Results of the monitoring ability of the R. prowazekii target verification quality control product on the nucleic acid extraction process in Example 7.

[0045] Figure 5 Results of the monitoring ability of the R. mooseri target verification quality control product on the nucleic acid extraction process in Example 7.

[0046] Figure 6 Results of the stability of the R. prowazekii target detection quality control product in Example 8.

[0047] Figure 7 Results of the stability of the R. mooseri target detection quality control product in Example 8.

[0048] Figure 8 Curve of specific amplification of different dilution gradients of the R. prowazekii target detection quality control product in Example 9.

[0049] Figure 9 Results of linearity and amplification efficiency of the R. prowazekii target detection quality control product in Example 9.

[0050] Figure 10 Curve of specific amplification of different dilution gradients of the R. mooseri target detection quality control product in Example 9.

[0051] Figure 11 Results of linearity and amplification efficiency of the R. mooseri target detection quality control product in Example 9.

[0052] Figure 12 Results of the repeatability of the R. prowazekii target detection quality control product in Example 10.

[0053] Figure 13 Results of the repeatability of the R. mooseri target detection quality control product in Example 10. DETAILED DESCRIPTION

[0054] In order for those skilled in the art to better understand the technical solutions in the present application, the present application will be further described in detail below in conjunction with embodiments.

[0055] Example 1: Determination and synthesis of target gene conserved fragments

[0056] The full-length sequences of target genes of seven rickettsial pathogens were obtained, and multiple sequence alignment was performed using MAFFT and Clustal Omega software, and the obviously inserted and deleted regions were removed to ensure the accuracy and conservation of the alignment. It should be noted that in the characteristic conserved region, cross with host or other non-target pathogen sequences should be avoided.

[0057] Taking the R. prowazekii ompB gene as an example, a conserved region with a length of 142 bp (SEQ ID NO. 1) was obtained by aligning the ompB gene sequences from 20 different strains. Similarly, the conserved fragments of the other six pathogens (SEQ ID NO. 2-7) were determined. The seven fragments were spliced in order to obtain a combined fragment with a total length of 1093 bp (SEQ ID NO. 8). The full gene synthesis was commissioned to Jinersi Biotechnology Co., Ltd., and cloned into the pUC57 vector to obtain a conventional pUC plasmid containing the R. prowazekii ompB gene, the R. typhi ompB gene, the O. tsutsugamushi Tsa56 gene, the C. burnetii com1 gene, the R. sibirica ompA gene, the E. chaffeensis 16S rRNA gene, and the A. phagocytophilum gltA gene conserved sequence target fragment, named pUC57-Ric.

[0058] Example 2: Construction of pBac-Ric plasmid vector containing the combined fragment

[0059] 1. PCR amplification and purification recovery of the combined fragment

[0060] Specific primers Ric-F and Ric-R (see Table 1 for primer sequences) were designed for the construction of the plasmid vector pBac-Ric. The synthesized combined fragment was obtained by PCR amplification using the specific primer Ric-F, as shown in SEQ ID NO. 8. The PCR reaction system is shown in Table 2. The PCR reaction program is shown in Table 3. After the reaction, the amplification product was subjected to agarose electrophoresis, and the Takara gel recovery kit was used to purify and recover the target fragment.

[0061] Table 1 Nucleic acid sequences of amplification primers of the combined fragment

[0062]

[0063] Table 2 PCR reaction system

[0064]

[0065] Table 3 PCR reaction program

[0066]

[0067] 2. Preparation of linear vector pBac-N-EGFP

[0068] The plasmid pBac-N-EGFP was treated with restriction endonuclease Hind III and EcoR I, and the enzyme reaction system is shown in Table 4, and the enzyme reaction program is shown in Table 5. The linear vector pBac-N-EGFP was recovered and purified using a Takara gel recovery kit, and was used for fragment ligation.

[0069] Table 4 Enzyme reaction system

[0070] Component Amount pBacl-N-EGFP plasmid 1.5 μg Restriction endonuclease EcoR I 1.0 μL Restriction endonuclease Hind III 1.0 μL 10 x M buffer 5.0 μL ddH2O Added to 50 μL

[0071] Table 5 Enzyme reaction program

[0072] Temperature Time 37℃ 3h

[0073] 3. Ligation of linear vector and target fragment

[0074] Homologous recombination kit of Takara was used HD Cloning Plus was used to seamlessly ligate the target fragment (SEQ ID NO. 8) to the linear vector pBac-N-EGFP. The 10 μL reaction system is shown in Table 6, and the ligation was performed at 50°C for 15 minutes.

[0075] Table 6 Ligation reaction system

[0076] Component Amount 5 x In-Fusion HD Enzyme Premix 2 μL Target fragment 50-100 ng Linear carrier pBac-N-EGFP 50-100 ng

[0077] 4. Transformation

[0078] The ligation product was added to the competent cells E. coli DH5a of Takara, and was mixed slightly. After being placed in ice for 30 minutes, it was placed in a 42°C water bath for 45 seconds, then immediately removed and placed on ice for 2 minutes, 700 μL of SOC liquid medium (previously incubated at 37°C) was added, and the mixture was incubated at 37°C for 1 hour (180 rpm), and an appropriate amount was spread on an LB plate containing 100 μg / mL ampicillin, and finally the plate was placed at 37°C for inverted culture overnight.

[0079] 5. Identification of positive plasmid

[0080] Four single colonies were picked and subjected to PCR with specific primers Ric-F and Ric-R (see Table 1 for primer sequences), and the PCR reaction system is shown in Table 7, and the PCR reaction procedure is shown in Table 8. After the reaction, a small amount of the amplification product was subjected to agarose gel electrophoresis detection, and the single colonies with the target band were screened. The positive clones in the bacterial liquid PCR were subjected to plasmid extraction and sequencing analysis, and the measured sequence was the same as the designed conserved sequence, and was named as pBac-Ric plasmid vector, and the map is shown in Figure 1

[0081] Table 7 PCR reaction system

[0082]

[0083] Table 8 PCR reaction procedure

[0084]

[0085] Example 3 Construction and verification of the engineering bacteria carrying the recombinant artificial chromosome vector

[0086] 1. Construction of the engineering bacteria carrying the recombinant artificial chromosome vector

[0087] 100 ng of pBac-Ric plasmid was added to the competent cells DH10Bac, and placed on ice for 30 min. Then, the cells were subjected to heat shock at 42°C for 80 s, and immediately placed on ice for 3 min. Then, 700 μL of LB medium was added, and the cells were cultured at 37°C for 4 h with constant shaking at 200 rpm. Then, 200 μL of the bacterial liquid after the culture was uniformly coated on LB solid medium containing 50 μg / mL of kanamycin, 7 μg / mL of tetracycline, 10 μg / mL of gentamicin, 40 μg / mL of X-Gal, and 40 μg / mL of IPTG. The plate was inverted and cultured in a 37°C constant temperature incubator for 48 h.

[0088] The positive white single colonies were picked into 4 mL of LB liquid medium containing 50 μg / mL of kanamycin, 7 μg / mL of tetracycline, and 10 μg / mL of gentamicin, and cultured at 37°C for 20 h with constant shaking at 200 rpm. The artificial chromosome DNA (i.e., the DNA containing the ompB gene of Rickettsia prowazekii, the ompB gene of Rickettsia montanum, the Tsa56 gene of Orientia tsutsugamushi, the com1 gene of Coxiella burnetii, the ompA gene of Rickettsia siberica, the 16S rRNA gene of Ehrlichia, and the gltA gene of Anaplasma phagocytophilum) of the engineering bacteria was extracted using the Omega BAC / PAC large basic plasmid extraction kit.

[0089] 2. PCR verification of the artificial chromosome of the engineering bacteria

[0090] ​1 μg of the artificial chromosome DNA of the engineered bacteria was taken as a template, and specific primers pUC / M13-F and pUC / M13-R were used for PCR verification and sequencing (the primer sequences are shown in Table 9). After PCR identification and sequencing alignment, no error was found, and the next step was performed. The PCR verification system is shown in Table 10, and the PCR amplification reaction conditions are shown in Table 11.

[0091] After the reaction, a small amount of the amplification product was taken for agarose gel electrophoresis detection, and the results showed that the target band size was correct, and contained the target gene and part of the vector junction region sequence. The PCR product with correct band size was taken for sequencing, and the sequence was the same as the designed conservative sequence, indicating that the engineered bacteria carrying the artificial chromosome were successfully constructed.

[0092] Table 9 Primer sequences

[0093]

[0094] Table 10 PCR reaction system

[0095]

[0096] Table 11 PCR reaction conditions

[0097]

[0098] Example 4 Strain preservation of the engineered bacteria carrying the artificial chromosome and its use method

[0099] 1. Strain preservation of the engineered bacteria carrying the artificial chromosome:

[0100] Preparation of the strain preservation solution: glycerol and LB liquid medium were sterilized by dispensing, so that the LB medium was prepared to a final concentration of LB medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, and glycerol was diluted 1:1.

[0101] 500 μL of the bacterial solution was taken for preservation, 500 μL of the diluted glycerol was added, mixed uniformly, placed in a 1.5 mL EP tube, labeled with strain number, strain name, preservation date, and operator information, and then the glycerol bacterial backup was stored in a -80°C refrigerator.

[0102] 2. Use method of the engineered bacteria carrying the artificial chromosome:

[0103] Take out the glycerol bacteria, rewarm at room temperature until melted; take out a small amount of bacterial liquid for coating, culture in LB fixed medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, 40 μg / mL IPTG, and invert the plate in a 37°C constant temperature incubator for 48h. Pick positive white monoclonal colonies into 4mL LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 37°C 200rpm culture for 20h, and the bacterial liquid is used for extracting artificial chromosome DNA for subsequent quality control product test experiments.

[0104] Example 5 Preparation of rickettsia quality control raw materials and finished products

[0105] 1. Heat inactivation of engineered bacteria carrying artificial chromosomes

[0106] Put the centrifuge tube containing the engineered bacteria into a 60°C water bath. Make sure it is well sealed to avoid leakage of the contents during heating. After heating for 1 hour, take out the inactivated culture as the engineered bacteria quality control raw material.

[0107] 2. Preparation of bacterial artificial chromosome DNA extraction

[0108] The rickettsia engineered bacteria quality control raw material was diluted by 10 times gradient dilution with phosphate buffer saline diluent, to obtain 1.00E+09 to 1.00E+01 copies / mL of engineered bacteria. The MagaBio plus viral DNA / RNA purification kit (Hangzhou Bio-Science Co., Ltd., Catalog No. BSC86S1E) was used to extract nucleic acids from the above diluted rickettsia engineered bacteria quality control. According to the instructions of the kit, the purified nucleic acid solution was finally obtained.

[0109] 3. Digital PCR (ddPCR) quantitative analysis

[0110] The above extracted nucleic acid was used as a template to determine the copy number of nucleic acid by digital PCR, as follows. The PCR reaction system was prepared and transferred to a digital PCR instrument for testing. The ddPCR reaction system is shown in Table 12, and the ddPCR reaction conditions are shown in Table 13. The absolute concentration of the target nucleic acid in the sample was directly obtained, and the nucleic acid concentration in the rickettsia quality control was calculated.

[0111] Table 12 ddPCR reaction system

[0112] Component Amount PCR reaction solution 19 μL Enzyme mixture 1 μL Sample 5 μL

[0113] Table 13 ddPCR reaction conditions

[0114]

[0115] 4. Rickettsia quality control product preparation

[0116] The Rickettsia quality control product is prepared by diluting the Rickettsia quality control raw material with a known concentration to obtain the desired different concentrations of Rickettsia engineering bacteria quality control product.

[0117] Example 6 Rickettsia quality control nucleic acid enzyme resistance verification

[0118] The engineering bacteria quality control product prepared in Example 5 and the Rickettsia conventional plasmid (hereinafter referred to as plasmid) in Example 1 (both are E8 copies / mL) were respectively treated with DNase I (Thermo #EN0521) at 37°C for 30 min (the working concentration is 0.1 U per ng of nucleic acid), and then inactivated at 70°C for 10 min, and at the same time, no treatment was used as a control, and each group was repeated twice in parallel. Then the samples in each group were accumulated and diluted 100 times, and then Q-PCR detection was performed, the Q-PCR reaction system is shown in Table 14, the Q-PCR reaction conditions are shown in Table 15, and the primers and probes are shown in Table 16, and each sample was detected twice. The results are shown in Figure 2 、 Figure 3 Table 17, Table 18, the Q-PCR detection results of the Rickettsia quality control product before and after DNase I digestion have no difference, while the results of the plasmid before and after DNase I digestion have a large difference, indicating that the Rickettsia engineering bacteria quality control product prepared by the application has superior nucleic acid enzyme resistance, which is much higher than the conventional plasmid.

[0119] Table 14 ddPCR reaction conditions

[0120] Component Amount PCR reaction solution 19 μL Enzyme mixture 1 μL Sample 5 μL

[0121] Table 15 Q-PCR reaction conditions

[0122]

[0123] Table 16 Primer and probe sequence table of Rickettsia prowazekii and Rickettsia mooseri target points

[0124]

[0125] Table 17 Rickettsia quality control and plasmid nucleic acid enzyme treatment result data table 1

[0126]

[0127] Note: NoCt means no detection; an increase in CT value indicates that the template is degraded by the nucleic acid enzyme.

[0128] Table 18 Rickettsia quality control and plasmid nucleic acid enzyme treatment result data table 2

[0129]

[0130] Note: NoCt means no detection; an increase in CT value indicates that the template is degraded by nucleases.

[0131] Example 7 Proficiency Verification of Rickettsia Quality Control for Nucleic Acid Extraction Monitoring

[0132] The Rickettsia quality control products with a concentration of 5.00E+06 copies / mL and 5.00E+03 copies / mL and the pUC57-Ric plasmid were subjected to nucleic acid extraction and non-extraction comparison tests (QPCR reaction conditions were the same as in Example 6). The results are shown in Tables 19, 20, Figure 4 、 Figure 5 As shown, the Rickettsia engineered bacteria quality control product must be subjected to nucleic acid extraction to be detected, and cannot be detected without nucleic acid extraction, while the plasmid can be detected regardless of whether nucleic acid extraction is performed and the Ct value does not differ, indicating that the Rickettsia engineered bacteria quality control product prepared by the present invention can effectively monitor the nucleic acid extraction link, while conventional plasmids do not have this effect.

[0133] Table 19 Rickettsia quality control products and plasmid extraction monitoring capability verification results data table 1

[0134]

[0135] Note: NoCt means not detected.

[0136] Table 20 Rickettsia quality control products and plasmid extraction monitoring capability verification results data table 2

[0137]

[0138] Note: NoCt means not detected.

[0139] Example 8 Stability Test of Engineering Bacteria Quality Control

[0140] With reference to the standard JJF1343-2022 "Assessment of the value, uniformity and stability of reference materials", the stability was tested at 4°C, 25°C and 37°C at two time points, 0 days and 3 days respectively. Two units were extracted at each temperature at each time point and tested by Q-PCR (QPCR reaction conditions were the same as in Example 6). Each unit was tested twice. The test results are shown in Table 21, Table 22, Figure 6 、 Figure 7 As shown, there were no significant differences in the test results of the Rickettsia quality control after storage at different temperatures; however, the Ct of the plasmid decreased after storage at 4°C, and gradually increased after storage at 25°C and 37°C. This shows that the Rickettsia engineered bacteria quality control prepared by the present invention has outstanding and excellent stability, while conventional plasmids have poor stability.

[0141] Table 21 Statistical results of Ct values of storage stability of rickettsia quality control and plasmid Table 1

[0142]

[0143] Note: No Ct represents no detection; large Ct value represents low detection efficiency.

[0144] Table 22 Statistical results of Ct values of storage stability of rickettsia quality control and plasmid Table 2

[0145]

[0146] Note: No Ct represents no detection; large Ct value represents low detection efficiency.

[0147] Example 9 Linearity and amplification efficiency of rickettsia quality control

[0148] The rickettsia quality control and the pUC57-Ric plasmid were diluted by 10 times at a starting concentration of 1E+09 copies / mL to obtain a series of gradient dilution products. After nucleic acid extraction, Q-PCR detection was performed (QPCR reaction conditions were the same as in Example 6), and each concentration was repeated twice. The results are shown in Table 23, Figure 8 , Figure 9 , Figure 10 , Figure 11 According to the “Performance Evaluation Requirements for Quantitative Methods of Nucleic Acid Target Sequences in Biotechnology qPCR and dPCR” (GB / T 42077-2022), the linear correlation coefficient and amplification efficiency of the rickettsia quality control meet the standard (R2> 0.99, and the amplification efficiency E is within the range of 0.9-1.1), while the amplification efficiency E of the plasmid is 1.31, which is obviously beyond the standard range. It shows that the rickettsia quality control prepared by the application has good linearity and amplification efficiency, and is more suitable for quality control or quantitative detection research of rickettsia nucleic acid detection than conventional plasmids.

[0149] Table 23 Test results of gradient dilution of rickettsia quality control

[0150]

[0151] Example 10 Reproducibility test of rickettsia quality control

[0152] After nucleic acid extraction of the rickettsia quality control with a concentration of 5.00E+03 copies / mL, 16 parallel qPCR detections were performed using primers and probes targeting Rickettsia prowazekii and Rickettsia mooseri (see Example 6 for details). The detection results are shown in Table 24, Figure 12 , Figure 13The Ct values of each repeat test of the quality control product are consistent, and the coefficient of variation (CV) of the Ct values of the repeat test is not greater than 5%. The above results show that the developed rickettsia quality control product has good repeatability when used for detection, and can meet the quality control requirements of nucleic acid detection.

[0153] Table 24 repeatability test results of rickettsia quality control product

[0154]

[0155] In summary, the rickettsia engineering bacteria quality control product prepared by the present application has significant technical advantages compared with conventional plasmids, and can provide more reliable quality control for nucleic acid detection. The quality control product exhibits strong nuclease resistance, and the detection results are not affected after DNase I treatment, effectively avoiding the risk of false negative caused by nucleic acid degradation, while the conventional plasmid is easily destroyed by enzymolysis under the same conditions. Its unique design makes it necessary to be detected after nucleic acid extraction, thereby being able to monitor the effectiveness of the nucleic acid extraction link throughout the operation, ensuring the standardization of the process from sample processing to amplification, while the conventional plasmid cannot realize this key quality control function. In terms of stability, the quality control product maintains stable detection performance under different temperature conditions and is not affected by the storage environment, overcoming the detection deviation problem of conventional plasmids with temperature fluctuations. In addition, the quality control product has excellent amplification performance, the linear correlation coefficient and amplification efficiency meet the ideal standard, and the detection repeatability is good, with a variation coefficient controlled within 5%, providing a precise and reliable standard reference for quantitative detection. These advantages make it an ideal quality control tool for rickettsia class pathogens nucleic acid detection, which can effectively improve the accuracy and reliability of clinical diagnosis and scientific research detection, and meet the high-standard quality control requirements.

Claims

1. A quality control product for nucleic acid detection of Rickettsial pathogens, characterized in that: The quality control product is an engineered bacterium carrying a recombinant artificial chromosome vector. The recombinant artificial chromosome is designed to contain a combination of conserved fragments of characteristic target genes of seven rickettsial pathogens. There is no homologous sequence between the seven selected rickettsial pathogens to ensure the genetic stability of the combination fragment. The sequences of the conserved fragments of each characteristic target gene and the combination fragment are as follows: (1) a conserved fragment of the ompB gene of Rickettsia prowazekii, the nucleic acid sequence of which is shown in SEQ ID NO.1; (2) a conserved fragment of the ompB gene of Rickettsia moorei, the nucleic acid sequence of which is shown in SEQ ID NO. 2; (3) a conserved fragment of the Tsa56 gene of Orientia tsutsugamushi, the nucleic acid sequence of which is shown in SEQ ID NO.3; (4) a conserved fragment of the Coxiella burnetii com1 gene, the nucleic acid sequence of which is shown in SEQ ID NO. 4; (5) a conserved fragment of the ompA gene of spotted fever group rickettsiae, the nucleic acid sequence of which is shown in SEQ ID NO.5; (6) a conserved fragment of the 16S rRNA gene of Ehrlichia, the nucleic acid sequence of which is shown in SEQ ID NO.6; (7) a conserved fragment of the gltA gene of Anaplasma phagocytophilum, the nucleic acid sequence of which is shown in SEQ ID NO.7; The nucleic acid sequence of the combined fragment is shown in SEQ ID NO.

8.

2. A quality control product for nucleic acid detection of rickettsial pathogens according to claim 1, characterized in that: The size of the combined fragment is 1093 bp.

3. A quality control product for nucleic acid detection of rickettsial pathogens according to claim 1, characterized in that: The method for constructing the recombinant artificial chromosome vector comprises the following steps: S1. Obtain the full-length sequences of the target genes of the seven rickettsial pathogens, remove insertions and deletions using a multiple sequence alignment tool to identify conserved fragments, splice them into a combined fragment as shown in SEQ ID NO. 8 using seamless ligation technology, and clone them into the pUC57 vector; S2. The target fragment was obtained by PCR amplification using specific primers Ric-F and Ric-R, wherein the nucleic acid sequence of the specific primer Ric-F is shown in SEQ ID NO.9, and the nucleic acid sequence of the specific primer Ric-R is shown in SEQ ID NO.10; S3. Double digest the pBac-N-EGFP vector with EcoR I and Hind III restriction enzymes; S4. Use a homologous recombination kit to seamlessly ligate the target fragment into the linearized vector; S5. Transform the ligation product into competent E. coli DH5α cells, screen positive clones by bacterial liquid PCR and verify by sequencing.

4. A quality control product for nucleic acid detection of Rickettsial pathogens according to claim 1, characterized in that: The method for preparing the engineered bacteria carrying the recombinant artificial chromosome vector comprises the following steps: S1. The recombinant artificial chromosome vector was transformed into competent cells DH10Bac and cultured in LB fixed medium containing kanamycin, tetracycline, gentamicin, X-Gal and IPTG; S2. Pick a white monoclonal colony and inoculate it into LB liquid medium containing kanamycin, tetracycline, and gentamicin for expansion; S3. The artificial chromosome DNA of the engineered bacteria was extracted and verified by PCR and sequencing analysis using specific primers pUC / M13-F and pUC / M13-R. The nucleic acid sequence of the specific primer pUC / M13-F is shown in SEQ ID NO.11, and the nucleic acid sequence of the specific primer pUC / M13-R is shown in SEQ ID NO.

12.

5. A quality control product for nucleic acid detection of Rickettsial pathogens according to claim 1, characterized in that: The preparation method of the quality control product comprises the following steps: S1. The engineered bacteria were inactivated by heating at 60°C for 1 hour; S2. The inactivated engineered bacteria were serially diluted with phosphate buffered saline to extract bacterial artificial chromosome DNA at different concentrations; S3. Determine the nucleic acid concentration in the quality control sample by digital PCR quantitative analysis; S4. Dilute the quality control product of known concentration to obtain the finished quality control product of the required concentration.

6. Use of the quality control product according to any one of claims 1 to 5 in the detection of nucleic acid of rickettsial pathogens, characterized in that: It can be used for quality control of nucleic acid detection of Rickettsial pathogens and added to the reaction system as a positive control; it can be used to evaluate the sensitivity and accuracy of nucleic acid detection kits; Can be used to monitor nucleic acid extraction efficiency.

Images