A primer probe combination, kit, system and detection method for simultaneously detecting bibersteinia porcinum and isospora suis and application thereof

Abstract

The application discloses a primer probe combination, a kit, a system, a detection method and application of the primer probe combination for simultaneously detecting Pasteurella multocida and Isospora suis. The primer probe combination comprises a first primer probe combination for detecting Pasteurella multocida and a second primer probe combination for detecting Isospora suis. The first primer probe combination comprises primer sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5 and a probe sequence as shown in SEQ ID NO: 6. The second primer probe combination comprises primer sequences as shown in SEQ ID NO: 19 and SEQ ID NO: 20 and a probe sequence as shown in SEQ ID NO: 14. The 11th nucleotide at the 3' end of the probe sequence of the first primer probe combination is a locked nucleic acid. The primer probe combination provided by the application has high sensitivity and good specificity, and can be effectively used for detecting Pasteurella multocida and Isospora suis.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, and particularly relates to a primer probe combination, a kit, a system, a detection method for simultaneously detecting Bordetella bronchiseptica and Isospora suis, and application thereof. BACKGROUND

[0002] With the improvement of the scale of the pig industry, the probability of disease occurrence in pig population increases, thus bringing new challenges to the prevention and control of various diseases of live pigs. Among them, the pig isospora disease is a protozoan disease caused by Isospora suis parasitizing the small intestinal epithelial cells of pigs, and the pig isospora is the main pathogen causing coccidiosis in suckling pigs and weaned piglets. It usually infects 5-14 day old piglets, and is characterized by severe yellow diarrhea and ineffective antibiotic treatment. Pig isospora disease mainly occurs in piglet groups in intensive pig farms, and has the strongest pathogenicity to piglets, mainly showing clinical symptoms such as diarrhea, reduced appetite and weight loss, and severe cases can lead to death. Adult pigs, multiparous sows or farrowing sows are mostly negative infections or worm hosts, and do not show clinical symptoms, but are the source of infection of the disease; Bordetella bronchiseptica (Bb) can cause non-progressive atrophic rhinitis (NPAR) and bronchopneumonia in pigs, and is also one of the important pathogenic factors of porcine respiratory disease complex (PRDC), which brings great loss to the pig industry. According to the current situation of pig disease epidemic, mixed infection of multiple pathogenic bacteria is a trend of disease development in pig farms at present. Therefore, it is urgent to provide related reagents for simultaneously detecting Bordetella bronchiseptica and pig isospora. SUMMARY

[0003] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes a primer probe combination for simultaneously detecting Bordetella bronchiseptica and pig isospora.

[0004] The present application also proposes a kit having the above primer probe combination.

[0005] The present application also proposes the application of the above primer probe combination or kit.

[0006] The present application also proposes a method for detecting Bordetella bronchiseptica and pig isospora for non-disease diagnosis purposes.

[0007] The present application also provides a system for detecting Bordetella bronchiseptica and pig isospora.

[0008] According to one aspect of the present application, a primer probe combination for simultaneously detecting B. pilosicoli and I. suis is provided, the primer probe combination comprising a first primer probe combination for detecting B. pilosicoli and a second primer probe combination for detecting I. suis;

[0009] The first primer probe combination comprises a primer sequence as shown in SEQ ID NO: 4, SEQ ID NO: 5 and a probe sequence as shown in SEQ ID NO: 6.

[0010] The second primer probe combination comprises a primer sequence as shown in SEQ ID NO: 19, SEQ ID NO: 20 and a probe sequence as shown in SEQ ID NO: 14.

[0011] The 11th nucleotide from the 3' end of the probe sequence of the first primer probe combination is a locked nucleic acid.

[0012] In some embodiments of the present application, the 5' end of the probe is labeled with a fluorescent group and the 3' end is labeled with a fluorescent quenching group.

[0013] In some embodiments of the present application, the probe sequence of the first primer probe combination and the probe sequence of the second primer probe combination have different fluorescent groups.

[0014] In some embodiments of the present application, the fluorescent group includes, but is not limited to, any one of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, VIC and TET.

[0015] In some embodiments of the present application, the fluorescent quenching group includes, but is not limited to, any one of super Quenther 1, super Quenther 2, Eclipse, BHQ, TAMRA, MGB and Dabcyl.

[0016] According to a second aspect of the present application, a kit containing the above primer probe combination is provided.

[0017] In some embodiments of the present application, the kit further comprises at least one of a PCR reaction solution, Taq DNA polymerase, MgCl2 solution, positive control and negative control.

[0018] In some embodiments of the present application, the PCR reaction solution comprises 2x PCR buffer.

[0019] In some embodiments of the present application, the positive control comprises nucleic acid molecules of B. pilosicoli and I. suis; or a carrier comprising the nucleic acid molecules.

[0020] In some embodiments of the present application, the positive control comprises a recombinant vector comprising a sequence as set forth in SEQ ID NO: 27, a recombinant vector comprising a sequence as set forth in SEQ ID NO: 28, and / or a combination of a recombinant vector comprising a sequence as set forth in SEQ ID NO: 27 and a recombinant vector comprising a sequence as set forth in SEQ ID NO: 28.

[0021] In a third aspect of the present application, the use of the primer probe combination and kit described above is provided, and the use is the use in the preparation of a product for detecting or assisting in the detection of B. piliformis and Isospora suis.

[0022] In some embodiments of the present application, the product is a kit or a chip.

[0023] In some embodiments of the present application, the use method of the product is as follows: using pig sample DNA to be tested as a template, the primer probe combination or kit described above is used for PCR amplification to obtain an amplification product; and the amplification product is analyzed.

[0024] In some embodiments of the present application, the reaction system used for the PCR amplification is as follows:

[0025] 2x PCR buffer 1x;

[0026] Upstream primer for detecting B. piliformis 0.05-0.5 pmol / µL;

[0027] Downstream primer for detecting B. piliformis 0.05-0.5 pmol / µL;

[0028] Probe for detecting B. piliformis 0.05-0.3 pmol / µL;

[0029] Upstream primer for detecting Isospora suis 0.1-0.6 pmol / µL;

[0030] Downstream primer for detecting Isospora suis 0.1-0.6 pmol / µL;

[0031] Probe for detecting Isospora suis 0.05-0.3 pmol / µL;

[0032] Taq DNA polymerase 0.2-0.5 U / µL;

[0033] MgCl2 solution 0.005-0.03 mol / L;

[0034] DNA to be tested 4-6 µL;

[0035] ddH2O is supplemented to 25 µL.

[0036] In some embodiments of the present application, the reaction system for the PCR amplification is as follows:

[0037] 2x PCR buffer 1x;

[0038] Upstream primer for detecting B. pilosicoli 0.3 pmol / µL;

[0039] Downstream primer for detecting B. pilosicoli 0.3 pmol / µL;

[0040] Probe for detecting B. pilosicoli 0.15 pmol / µL;

[0041] Upstream primer for detecting I. suis 0.4 pmol / µL;

[0042] Downstream primer for detecting I. suis 0.4 pmol / µL;

[0043] Probe for detecting I. suis 0.2 pmol / µL;

[0044] Taq DNA polymerase 0.4 U / µL;

[0045] MgCl2 solution 0.016 mol / L;

[0046] DNA of sample to be tested 4-6 µL;

[0047] ddH2O to make up to 25 µL.

[0048] In some embodiments of the present application, the reaction procedure for the PCR amplification is as follows: 94-96℃ for 1-3 min; then enter the cycle stage: 93-96℃ for 5-15 s, 55-62℃ for 25-35 s, 40-50 cycles, collect fluorescence data.

[0049] In some embodiments of the present application, the analysis of the amplification product comprises: statistics of the Ct value of the sample, result interpretation; the result interpretation is as follows:

[0050] Positive: if the fluorescence detection channel detects the fluorescence signal of the fluorescent group of the probe for detecting B. pilosicoli, corresponding to the detection Ct value ≤40, it is reported that the sample is B. pilosicoli positive;

[0051] If the fluorescence detection channel detects the fluorescence signal of the fluorescent group of the probe for detecting I. suis, corresponding to the detection Ct value ≤40, it is reported that the sample is I. suis positive;

[0052] Negative: if the fluorescence signal of the fluorescent group of the probe for detecting B. pilosicoli and I. suis is not detected in the fluorescence detection channel, no Ct value is detected, and the sample is reported as B. pilosicoli and I. suis negative.

[0053] In a fourth aspect of the present application, a method for detecting B. pilosicoli and I. suis for non-disease detection purposes is provided, comprising the following steps: using the above-mentioned primer probe combination or kit to perform PCR amplification on the DNA of the pig sample to be tested as a template to obtain an amplification product; and analyzing the amplification product.

[0054] In some embodiments of the present application, the reaction system used for the PCR amplification is as follows:

[0055] 2× PCR buffer 1×;

[0056] Upstream primer for detecting B. pilosicoli 0.05-0.5 pmol / µL;

[0057] Downstream primer for detecting B. pilosicoli 0.05-0.5 pmol / µL;

[0058] Probe for detecting B. pilosicoli 0.05-0.3 pmol / µL;

[0059] Upstream primer for detecting I. suis 0.1-0.6 pmol / µL;

[0060] Downstream primer for detecting I. suis 0.1-0.6 pmol / µL;

[0061] Probe for detecting I. suis 0.05-0.3 pmol / µL;

[0062] Taq DNA polymerase 0.2-0.5 U / µL;

[0063] MgCl2 solution 0.005-0.03 mol / L;

[0064] DNA of the sample to be tested 4-6 µL;

[0065] ddH2O to make up to 25 µL.

[0066] In some embodiments of the present application, the reaction system used for the PCR amplification is as follows:

[0067] 2× PCR buffer 1×;

[0068] Upstream primer for detecting B. pilosicoli 0.3 pmol / µL;

[0069] Downstream primer for detecting B. pilosicoli 0.3 pmol / µL;

[0070] Probe for detecting B. pilosicoli 0.15 pmol / µL;

[0071] Upstream primer for detecting I. suis 0.4 pmol / µL;

[0072] Downstream primer for detecting I. suis 0.4 pmol / µL;

[0073] Probe for detecting I. suis 0.2 pmol / µL;

[0074] Taq DNA polymerase 0.4 U / µL;

[0075] MgCl2 solution 0.016 mol / L;

[0076] DNA of sample to be tested 4-6 µL;

[0077] ddH2O to make up to 25 µL.

[0078] In some embodiments of the present application, the reaction procedure of the PCR amplification is: 94-96 ℃ for 1-3 min; then enter the cycle stage: 93-96 ℃ for 5-15 s, 55-62 ℃ for 25-35 s, 40-50 cycles, collect fluorescence data.

[0079] In some embodiments of the present application, the analysis of the amplification product comprises: statistics of the Ct value of the sample, result interpretation; the result interpretation is:

[0080] Positive: if the fluorescence detection channel detects the fluorescence signal of the fluorescent group of the probe for detecting B. pilosicoli, corresponding to the detection Ct value ≤40, it is reported that the sample is B. pilosicoli positive;

[0081] If the fluorescence detection channel detects the fluorescence signal of the fluorescent group of the probe for detecting I. suis, corresponding to the detection Ct value ≤40, it is reported that the sample is I. suis positive;

[0082] Negative: if the fluorescence detection channel does not detect the fluorescence signal of the fluorescent group of the probe for detecting B. pilosicoli and I. suis, no Ct value is detected, it is reported that the sample is B. pilosicoli and I. suis negative.

[0083] According to the fifth aspect of the present application, a system for detecting B. pilosicoli and I. suis is provided, the system comprises:

[0084] an amplification module configured to perform PCR amplification on the genomic DNA of the pig sample to be tested by using the primer probe combination or the kit to obtain an amplification product;

[0085] a result evaluation module configured to detect the amplification product and evaluate whether the pig sample to be tested is infected with B. bovis and C. perfiux.

[0086] According to some embodiments of the present application, the system further comprises a DNA template extraction module configured to extract the genomic DNA of the sample to be tested.

[0087] According to some embodiments of the present application, at least the following advantages are provided: the primer probe combination for simultaneously detecting B. bovis and C. perfiux has high sensitivity and good specificity, and can be effectively used for detecting B. bovis and C. perfiux. BRIEF DESCRIPTION OF DRAWINGS

[0088] The present application will be further described below in conjunction with the drawings and examples, in which:

[0089] Figure 1 a detection result diagram of the primer probe combination 1 for detecting B. bovis in the embodiments of the present application;

[0090] Figure 2 a detection result diagram of the primer probe combination 2 for detecting B. bovis in the embodiments of the present application;

[0091] Figure 3 a detection result diagram of the primer probe combination 3 for detecting B. bovis in the embodiments of the present application;

[0092] Figure 4 a detection result diagram of the primer probe combination 4 for detecting B. bovis in the embodiments of the present application;

[0093] Figure 5 a detection result diagram of the primer probe combination 1 for detecting C. perfiux in the embodiments of the present application;

[0094] Figure 6 a detection result diagram of the primer probe combination 2 for detecting C. perfiux in the embodiments of the present application;

[0095] Figure 7 a detection result diagram of the primer probe combination 3 for detecting C. perfiux in the embodiments of the present application;

[0096] Figure 8 a detection result diagram of the primer probe combination 4 for detecting C. perfiux in the embodiments of the present application;

[0097] Figure 9 a detection result diagram of the primer probe combination 5 for detecting C. perfiux in the embodiments of the present application;

[0098] Figure 10 The detection result chart of the kit in the embodiment of the application for simultaneously detecting B. piliformis and C. suis is shown. DETAILED DESCRIPTION

[0099] The concept and technical effects of the application will be described below in combination with embodiments to fully understand the purpose, features and effects of the application. Obviously, the described embodiments are only some of the embodiments of the application, but not all the embodiments. Based on the embodiments of the application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the application.

[0100] Example 1: Design and verification of primer probe combination for simultaneously detecting B. piliformis and C. suis

[0101] In this embodiment, a primer probe combination for simultaneously detecting B. piliformis and C. suis is prepared, and the specific design and verification process is as follows:

[0102] 1. Design of primer probe

[0103] In the application, the gene sequences of B. piliformis and C. suis are compared and analyzed, and then the selected conservative gene regions are analyzed by using biological software Oligo 7.60 to determine whether suitable primer probes can be designed. After repeated analysis of the data, a plurality of primer probes are screened, and then the plurality of screened primer probes are comprehensively analyzed. Finally, primer probe groups 1-4 for detecting B. piliformis and primer probe group 1-5 for detecting C. suis are screened. The probes in the primer probe group for detecting B. piliformis are comprehensively analyzed, and a nucleotide is selected and replaced with a corresponding locked nucleic acid. The specific sequences are shown in Table 1. The sequences are synthesized by Bailingge Biotechnology (Shanghai) Co., Ltd.

[0104] Table 1

[0105]

[0106] In the table, +A represents adding a LNA-A locked nucleotide modification to the C base, and +T represents adding a LNA-T locked nucleotide modification to the C base.

[0107] 2. Optimization of primer probe group

[0108] The primer probe groups of different groups designed in step (1) (primer probe group 1-4 for detecting B. piliformis and primer probe group 1-5 for detecting C. suis) are used for experiments, respectively, to screen the optimal primer probe group.

[0109] Synthesis of standard plasmid: pUC57 was used as a cloning vector, and recombinant plasmids containing SC target conservative sequences and Bb target conservative sequences were synthesized, respectively. The plasmids were submitted to Shenguo Bioengineering Co., Ltd. for artificial synthesis.

[0110] SC target conservative sequence 320bp:

[0111] CCGATAGGTCTAGGTAATCTTGTGAGTATGCATCGTGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATGCCTAGTAGGCGCAAGTCAGCAGCTTGCGCCGATTACGTCCCTGCCCTTTGTACACACCGCCCGTTGCTCCTACCGATTGAGTGTTCCGGTGAATTATTCGGACCGTTTTGTGGCGCGTTCGTGCCCGAGATGGAAAGTTTTGTGAACCTTAACACTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCCTGCAGCGGAAGCTTGGAAGCCGAATTCCA (SEQ ID NO: 27).

[0112] Bb target conservative sequence 320bp:

[0113] GCTACCCAGGGCCGATTGGGACTTGTTCAGGTTGTTCTGGGCAACCAGCGACAAGTAGTTGGTATTGATGACTGCAGCCATGTTGAGGCTCCCAAGAGAGAAAGGCTTCTTCAAACCGGGCAGCTAGGCCGCCCATCTGTAACATCGGACTTTCGCTTGCACAGCGCCGCGATTTCCTTTGTTGCCTGGATTACGGCAGGTTTGCGACGGACTTAAGCAAAAAAAGTGAAGTTCGGAAATGTGCGGGGGAATCTGGCTGCAAAGGGCATGTTCCTGCGGGGACAGGCGCCCGTGCGGTGCGGGCGGGACGGGGCAGGCGC (SEQ ID NO: 28).

[0114] The preparation steps of the detection template are as follows: (1) The original plasmid (specifically, a plasmid containing *Isospora suis* or *Bordetella septicemia*) is about 4 µg / tube (dry powder state), add 400 µL of 0.01% TE-SDS, shake to mix, and the liquid is used as the original plasmid (concentration is 1×10⁻⁶). -2 (2) Take 10 µL of the original plasmid and add 990 µL of 0.01% TE-SDS, label it as 10-2; (3) Take 10 µL of plasmid with a concentration of 10-2 and add 990 µL of 0.01% TE-SDS, label it as 10-4; (4) Take 100 µL of plasmid with a concentration of 10-4 and add 900 µL of 0.01% TE-SDS, label it as 10-5; (5) Take 100 µL of plasmid with a concentration of 10-5 and add 900 µL of 0.01% TE-SDS, label it as 10-5. (6) Take 100µL of plasmid with a concentration of 10-6, add 900µL of 0.01% TE-SDS, and label it as 10-7; (7) Take 100µL of plasmid with a concentration of 10-7, add 900µL of 0.01% TE-SDS, and label it as 10-8; (8) Take 100µL of plasmid with a concentration of 10-8, add 900µL of 0.01% TE-SDS, and label it as 10-9 (concentration is 1×10). -11 µg / µL).

[0115] Select plasmid templates of 10⁻⁴, 10⁻⁵, 10⁻⁶, 10⁻⁷, and 10⁻⁸ (spot one well each with plasmid concentrations of 10⁻⁴ and 10⁻⁵; spot two replicates each with plasmid concentrations of 10⁻⁶, 10⁻⁷, and 10⁻⁸), and use the following reaction system and procedure to detect Bordetella septicemia.

[0116] Select plasmid templates of 10⁻⁵, 10⁻⁶, 10⁻⁷, 10⁻⁸, and 10⁻⁹ (spot one well each with plasmid concentrations of 10⁻⁵ and 10⁻⁶, and two replicates each with plasmid concentrations of 10⁻⁷, 10⁻⁸, and 10⁻⁹), and use the following reaction system and procedure to detect *Isospora suis*.

[0117] The reaction systems used for screening Bordetella septicemia are shown in Table 2, and the reaction systems used for screening Isospora suis are shown in Table 3.

[0118] Table 2

[0119]

[0120] Table 3

[0121]

[0122] The fluorescent PCR reaction procedures for detecting Bordetella septicemia and Isospora suis are shown in Table 4.

[0123] Table 4

[0124]

[0125] Table 5

[0126]

[0127] Table 6

[0128]

[0129] The screening results of the primer probe set for detecting B. piliformis are shown in Table 5 and Figures 1-4 As can be seen therefrom, the primer probe sets 1-4 all have good detection effects, and from the Ct values and detection rates of low-concentration samples, the primer probe set 2 is more superior than the primer probe sets 1, 3-4, and therefore, the primer probe set 2 is selected for subsequent experiments.

[0130] The screening results of the primer probe set for detecting I. suis are shown in Table 6 and Figures 5-9 As can be seen therefrom, the primer probe sets 1-5 all have good detection effects, and from the Ct values and detection rates of low-concentration samples, the primer probe set 4 is more superior than the primer probe sets 1-3, 5, and therefore, the primer probe set 4 is selected for subsequent experiments.

[0131] Example 2: A kit for simultaneously detecting B. piliformis and I. suis

[0132] The present example provides a kit for simultaneously detecting B. piliformis and I. suis, which contains the primer probe set 4 for detecting I. suis prepared in Example 1 at a concentration of 50 pmol / µL, the primer probe set 2 for detecting B. piliformis at a concentration of 50 pmol / µL, the internal standard YI primer probe set at a concentration of 50 pmol / µL, Taq DNA polymerase at a concentration of 5 U / µL, MgCl2 solution at a concentration of 1 mol / L, 2× PCR buffer, negative control and positive control.

[0133] The fluorescence PCR reaction system for detection by the kit is shown in Table 7 below.

[0134] Table 7

[0135]

[0136] The fluorescence PCR reaction procedure is shown in Table 8 below.

[0137] Table 8

[0138]

[0139] Sample result determination criteria:

[0140] FAM detection Ct value ≤ 40, and HEX / VIC channel Ct value ≤ 35 is reported as B. pilosicoli positive;

[0141] CY5 detection Ct value ≤ 40, and HEX / VIC channel Ct value ≤ 35 is reported as I. suis positive;

[0142] FAM and CY5 channel detection no Ct value, and the internal standard (HEX / VIC channel) detection Ct value ≤ 35, reported as B. pilosicoli and I. suis negative;

[0143] FAM or CY5 channel detection 40 < Ct value ≤ 45, and the internal standard (HEX / VIC channel) detection Ct value ≤ 35, reported as B. pilosicoli and I. suis suspicious, recheck is recommended, and the recheck result is used as the final result (re-extract nucleic acid and re-detect PCR) ;

[0144] FAM or CY5 channel detection no Ct value and the internal standard (HEX / VIC channel) detection no Ct value or Ct value > 35, then the detection result of the sample is invalid, the reason should be found and excluded, and the sample should be re-detected or re-sampled for experiment.

[0145] The results of simultaneous detection of B. pilosicoli Bb and I. suis using the above kit are shown in the following table 1. Figure 10 As shown in the figure, accurate detection can be achieved.

[0146] Example 3 Optimization of kit system

[0147] In this example, the amount of primer probe set in the kit in example 2, the amount of MgCl2 solution, and the reaction program of fluorescence PCR reaction using the kit were optimized.

[0148] 1. Optimization of primer and probe amount of primer probe set for detecting B. pilosicoli Bb

[0149] The following table 9 shows the fluorescence quantitative PCR reaction system used for screening the amount of primer and probe. The reaction program is consistent with example 2. The template used for screening is the recombinant plasmid containing B. pilosicoli nucleic acid prepared in example 1, with 10-5 and 10-6 concentrations each point one hole, 10-7, 10-8 and 10-9 concentrations each point 2 holes.

[0150] Table 9

[0151]

[0152] The results are shown in Table 10, from which it can be seen that group 4 has the best effect, so the addition amount of group 4 is selected for detecting B. melitensis, and therefore the final concentration of the primer of the primer probe group for detecting B. melitensis is 0.4 pmol / µL and the final concentration of the probe is 0.2 pmol / µL.

[0153] Table 10

[0154]

[0155] 2. Optimization of the amount of primer and probe of the primer probe group for detecting Isospora suis SC

[0156] The amount of primer and probe was screened using the fluorescent quantitative PCR reaction system shown in Table 11. The reaction procedure was consistent with that of Example 2. The template used for screening was the recombinant plasmid containing the nucleic acid of I. suis prepared in Example 1, with 10-5 and 10-6 concentrations each point one hole, 10-7; 10-8 and 10-9 concentrations each point 2 complex holes.

[0157] Table 11

[0158]

[0159] The results are shown in Table 12, from which it can be seen that group 3 has the best effect, so the addition amount of group 3 is selected for detecting I. suis, and therefore the final concentration of the primer of the primer probe group for detecting I. suis is 0.3 pmol / µL and the final concentration of the probe is 0.15 pmol / µL.

[0160] Table 12

[0161]

[0162] 3. Screening of reaction procedure

[0163] The detection procedures to be screened are shown in Tables 13-15, respectively. The template used for detection was the recombinant plasmid containing the nucleic acid of B. melitensis and I. suis prepared in Example 1, respectively, with an addition volume ratio of 1:1, and the fluorescent quantitative PCR reaction system was consistent with that of Example 2.

[0164] Table 13 Reaction procedure 1

[0165]

[0166] Table 14 Reaction procedure 2

[0167]

[0168] Table 15 Reaction procedure 3

[0169]

[0170] Table 16

[0171]

[0172] The results are shown in Table 16. From the table, it can be seen that the annealing temperature of program 3 is changed to 60℃, which promotes the FAM channel to move forward by about 0.5 CT, and has no effect on the CY5 channel, so program 3 is selected for amplification.

[0173] Example 4 Sensitivity test

[0174] The kit prepared in Example 2 and the use method of the kit were used for sensitivity detection. The templates used for detection were recombinant plasmids containing B. piliformis nucleic acid and pig isospora nucleic acid prepared in Example 1, and the volume ratio of addition was 1:1.

[0175] Preparation of gradient DNA template:

[0176] The preparation steps of the detection template are as follows: (1) about 4 µg of the original plasmid per tube (dry powder state), add 400 µL of 0.01% TE-SDS, shake and mix, and then the liquid is used as the original plasmid (concentration of 1×10 -2 µg / µL); (2) take 10 µL of the above original plasmid, add 990 µL of 0.01% TE-SDS, and mark as 10-2; (3) take 10 µL of the concentration 10-2 plasmid, add 990 µL of 0.01% TE-SDS, and mark as 10-4; (4) take 100 µL of the concentration 10-4 plasmid, add 900 µL of 0.01% TE-SDS, and mark as 10-5; (5) take 100 µL of the concentration 10-5 plasmid, add 900 µL of 0.01% TE-SDS, and mark as 10-6; (6) take 100 µL of the concentration 10-6 plasmid, add 900 µL of 0.01% TE-SDS, and mark as 10-7; (7) take 100 µL of the concentration 10-7 plasmid, add 900 µL of 0.01% TE-SDS, and mark as 10-8; (8) take 100 µL of the concentration 10-8 plasmid, add 900 µL of 0.01% TE-SDS, and mark as 10-9 (concentration of 1×10 -11 µg / µL); (9) take 500 µL of the concentration 10-9 plasmid, add 500 µL of 0.01% TE-SDS, and mark as 10-9-1:1 (i.e. concentration of 5×10 -12 µg / µL); (10) take 200 µL of the concentration 10-9 plasmid, add 800 µL of 0.01% TE-SDS, and mark as 10-9-1:4 (i.e. concentration of 2×10 -12 µg / µL).

[0177] The reagent kit prepared in Example 2 and the method for using the reagent kit were used to perform sensitivity detection using the gradient DNA template described above.

[0178] Table 17

[0179]

[0180] The results are shown in Table 17. As can be seen from the table, the reagent kit prepared in Example 2 has a sensitivity of 5 x 10 -13 μg / μL.

[0181] Example 5 Specificity Test

[0182] The reagent kit prepared in Example 2 and the method for using the reagent kit were used to perform specificity detection.

[0183] Sample source:

[0184] The genome of porcine reproductive and respiratory syndrome virus in pig serum was extracted, and cDNA was synthesized by reverse transcription using a random primer. The genome of African swine fever virus, porcine circovirus type 2, and porcine pseudorabies virus samples was extracted, and diluted with 1 x TE buffer to 40 ng / μL for sample detection.

[0185] Table 18

[0186]

[0187] The results are shown in Table 18. As can be seen from the table, the reagent kit prepared in Example 2 has good specificity.

[0188] The embodiments of the present application are described in detail above with reference to the accompanying drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the scope of knowledge of those skilled in the art without departing from the spirit of the present application. Furthermore, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. The application of a primer-probe combination for simultaneously detecting Bordetella septicemia and Isocoridia suis in the preparation of products for detecting or assisting in the detection of Bordetella septicemia and Isocoridia suis, characterized in that, The primer-probe combination includes a first primer-probe set for detecting Bordetella septicemia and a second primer-probe set for detecting Isospora suis. The first primer-probe set includes primer sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5 and probe sequences as shown in SEQ ID NO: 6; The second primer-probe set includes primer sequences as shown in SEQ ID NO: 19 and SEQ ID NO: 20 and probe sequences as shown in SEQ ID NO: 14; The 11th nucleotide from the 5' end of the probe sequence of the first primer-probe set is a locked nucleic acid.

2. The application according to claim 1, characterized in that, The probe is labeled with a fluorescent group at its 5' end and a fluorescence quenching group at its 3' end; The fluorescent groups include, but are not limited to, any one of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, VIC and TET; The fluorescence quenching groups include, but are not limited to, any one of Eclipse, BHQ, TAMRA, MGB, and Dabcyl.

3. A reagent kit, characterized in that, The kit comprises the primer-probe combination as described in any one of claims 1-2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes at least one of the following: PCR reaction solution, Taq DNA polymerase, MgCl2 solution, positive control, and negative control.

5. The reagent kit according to claim 4, characterized in that, The positive control includes a recombinant vector containing the sequence shown in SEQ ID NO: 27 or a recombinant vector containing the sequence shown in SEQ ID NO:

28.

6. The reagent kit according to claim 4, characterized in that, The positive control comprises a combination of a recombinant vector containing the sequence shown in SEQ ID NO: 27 and a recombinant vector containing the sequence shown in SEQ ID NO:

28.

7. The use of the kit according to any one of claims 3-6 in the preparation of products for the detection or auxiliary detection of Bordetella septicemia and Isospora suis.

8. A system for detecting Bordetella septicemia and Isospora suis, characterized in that, The system includes: An amplification module is used to perform PCR amplification on the genomic DNA of a pig sample to be tested using the primer and probe combination described in any one of claims 1-2 or the kit described in any one of claims 3-6 to obtain amplification products; The result evaluation module is used to detect the amplification products and evaluate whether the pig sample to be tested is infected with Bordetella septicemia and Isospora suis.

Images