Transaminase mutant and application thereof in chiral amine synthesis
By mutating specific amino acid sites of Mycobacterium sp. transaminase, its catalytic activity was improved, solving the problem of low catalytic activity of transaminase and realizing efficient and environmentally friendly synthesis of chiral amines, especially the efficient synthesis of (R)-3-aminopiperidine.
Patent Information
- Application Number
- CN202511243693.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-02
- Publication Date
- 2025-10-21
Smart Images

Figure CN120818503A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering, specifically relates to the field of enzymatic synthesis of chiral amines, and more specifically relates to transaminase and mutants thereof used in the synthesis of chiral amines. Background Art
[0002] Chiral amines, a key class of chiral molecules, exhibit unique enantiomeric properties due to the presence of one or more chiral centers in their molecular structures. This property makes them valuable for applications in medicine, agriculture, and fine chemicals. Transaminases, highly efficient biocatalysts, can precisely synthesize chiral amines through asymmetric transamination reactions, a process that has attracted considerable attention for its green chemistry properties. Compared to traditional chemical synthesis methods, transaminase catalytic systems offer broad substrate compatibility, excellent stereoselectivity, mild reaction conditions, low production costs, and environmental friendliness, offering promising prospects.
[0003] Transaminases are an important class of pyridoxal 5'-phosphate-dependent enzymes that generate various chiral amines by transferring an amine group from an amino donor to a substrate. The entire catalytic cycle of transaminases consists of two half-reactions, with the cofactor PLP acting as a shuttle during the transamination process. Naturally occurring transaminases exhibit (R) or (S) selectivity, and both (R) and (S)-selective transaminases can aminate prochiral ketoamines to yield the corresponding products.
[0004] (R)-3-Aminopiperidine is a chiral small molecule. As an important pharmaceutical intermediate, optically pure 3-aminopiperidine has been used in the synthesis of various dipeptidyl peptidase IV (DPP-IV) inhibitors with therapeutic potential for type 2 diabetes, including linagliptin, alogliptin benzoate, and trelagliptin succinate. Due to its significant market advantages, the efficient synthesis of (R)-3-aminopiperidine has been a hot topic. Researchers have long sought more efficient, environmentally friendly, and low-cost synthetic methods. Currently, (R)-3-aminopiperidine can be prepared via chemical synthesis, chiral resolution, or biotransformation. However, chemical and chiral resolution methods often suffer from harsh reaction conditions, numerous byproducts, and significant environmental pollution, limiting their large-scale industrial application. Enzymatic synthesis, however, exhibits significant application potential due to its high specificity, mild reaction conditions, and environmental friendliness. Currently, there are few studies on the production of (R)-1-Boc-3-aminopiperidine using bioenzymatic methods. Wu et al. reported in Nature communications (2022;13(1):7458-) a screening method based on a microbial growth selection system for the directed evolution of R-type transaminase (AtTA) to synthesize (R)-Boc-3-aminopiperidine. After two rounds of evolution, the optimal mutant AtTA (RHC) was obtained, with an activity of 4.2 U / mg, which was 110 times higher than that of the wild type.
[0005] As a versatile biocatalyst, transaminases have a broad substrate reactivity spectrum. Enzymatic synthesis of aminopiperidines is simple, requires mild conditions, and produces highly stereoselective products, aligning with the principles of green chemistry. However, their low catalytic activity limits their application. The discovery and modification of highly active transaminases through protein engineering for the biosynthesis of chiral amines remains a major challenge in the green biomanufacturing of pharmaceutical chemicals. Summary of the Invention
[0006] To further improve the catalytic activity of transaminases in the synthesis of various chiral amine intermediates, the present invention provides a transaminase derived from Mycobacterium sp. and its mutants, which can be used in the synthesis of various chiral amine pharmaceutical intermediates, such as the catalytic preparation of precursor compounds of drugs such as alogliptin and sitagliptin.
[0007] The technical solution adopted by the present invention is: a transaminase, which comprises the full-length sequence of SEQ ID NO. 1 and is derived from Mycobacterium sp.
[0008] Preferably, the amino acid sequence of the transaminase derived from Mycobacterium sp. is shown in SEQ ID NO.1.
[0009] Preferably, the nucleic acid sequence of the transaminase derived from Mycobacterium sp. is shown in SEQ ID NO. 2.
[0010] A transaminase mutant, characterized in that the transaminase mutant is obtained by single point mutation or combined mutation at positions 71, 166, and 145 of the amino acid sequence shown in SEQ ID NO. 1.
[0011] In order to further improve the synthesis efficiency of various chiral amines by the bioenzymatic method, the inventor team conducted in-depth research on transaminase and provided a new transaminase mutant. The transaminase mutant is obtained by single-point mutation or combined mutation at positions 71 and 166 of the transaminase. The obtained transaminase mutant can further improve the catalytic activity and substrate tolerance of the recombinant transaminase for the substrate.
[0012] Preferably, the mutation is at least one of the following (1) to (2):
[0013] (1) The histidine at position 71 is mutated to either arginine or lysine;
[0014] (2) Alanine at position 166 is mutated to either valine or isoleucine.
[0015] (3) Glycine at position 145 mutates to either phenylalanine or tryptophan;
[0016] Preferably, the transaminase mutant is the transaminase mutant Mu-H71R obtained by mutating the histidine at position 71 of the amino acid sequence shown in SEQ ID NO. 1 to arginine.
[0017] Preferably, the transaminase mutant is the transaminase mutant Mu-H71K obtained by mutating the histidine at position 71 of the amino acid sequence shown in SEQ ID NO. 1 to lysine.
[0018] Preferably, the novel transaminase mutant is the transaminase mutant Mu-G145F, in which the glycine at position 145 of the transaminase shown in the amino acid sequence of SEQ ID NO.1 is mutated to phenylalanine.
[0019] Preferably, the novel transaminase mutant is the transaminase mutant Mu-G145W, in which the glycine at position 145 of the transaminase shown in the amino acid sequence of SEQ ID NO.1 is mutated to tryptophan.
[0020] Preferably, the transaminase mutant is the transaminase mutant Mu-A166I obtained by mutating alanine at position 166 of the amino acid sequence shown in SEQ ID NO. 1 to isoleucine.
[0021] Preferably, the transaminase mutant is the transaminase mutant Mu-A166V obtained by mutating alanine at position 166 of the amino acid sequence shown in SEQ ID NO. 1 to valine.
[0022] Preferably, the transaminase mutant is a transaminase mutant Mu-H71R-A166I obtained by mutating the histidine at position 71 of the amino acid sequence shown in SEQ ID NO. 1 to arginine and the alanine at position 166 to isoleucine, whose amino acid sequence is shown in SEQ ID NO. 3, and whose nucleic acid sequence is preferably shown in SEQ ID NO. 4.
[0023] Preferably, the transaminase mutant is a transaminase mutant Mu-H71K-A166I obtained by mutating the histidine at position 71 of the amino acid sequence shown in SEQ ID NO. 1 to lysine and the alanine at position 166 to isoleucine, whose amino acid sequence is shown in SEQ ID NO. 5, and whose nucleic acid sequence is preferably shown in SEQ ID NO. 6.
[0024] The present invention also provides a gene encoding the transaminase or transaminase mutant. Due to the particularity of the nucleotide sequence, any variant of the polynucleotide shown in the present invention, as long as it has more than 90% homology with the aforementioned polynucleotide, falls within the scope of protection of the present invention. The variant of the polynucleotide refers to a polynucleotide sequence with one or more nucleotide changes. The variant of this polynucleotide can be a natural allelic variant or a non-natural variant, including a substitution variant, a deletion variant and an insertion variant. As is known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of a polynucleotide, but will not substantially change the function of the peptide protein it encodes.
[0025] The present invention also provides a recombinant vector containing the transaminase or transaminase mutant encoding gene. The recombinant vector comprises a polynucleotide operably linked to a control sequence suitable for directing expression in a host cell. Various conventional vectors in the art, such as various plasmids, phage or viral vectors, linked to the novel transaminase mutant nucleotide sequence of the present invention, should all fall within the scope of protection of the present invention. The recombinant vector preferably uses the plasmid pET-28a(+) as an expression vector, and the gene encoding the novel transaminase mutant is linked to the plasmid pET-28a(+).
[0026] The present invention also provides a genetically engineered bacterium containing a gene encoding the transaminase or transaminase mutant. The exogenous gene encoding the novel transaminase mutant is introduced into a host cell through genetic engineering techniques to construct a genetically engineered bacterium, which is then expressed to obtain the novel transaminase mutant of the present invention. The host cell can be a bacterium, fungus, plant cell, or animal cell, with Escherichia coli BL21 (DE3) being the preferred expression host.
[0027] The present invention also provides the use of the transaminase or transaminase mutant in the enzymatic synthesis of chiral amines. Specifically, the application can be to use a chiral ketone as a substrate and wet cells obtained after fermentation and culture of an engineered bacterium containing the transaminase or transaminase mutant encoding gene, an enzyme extracted from wet cells after ultrasonic disruption, or an immobilized enzyme as a catalyst to prepare the corresponding chiral amine through biocatalysis. The chiral ketone compound can be N-Boc-3-piperidone, which reacts to produce the corresponding chiral amine (R)-1-Boc-3-aminopiperidinone ( Figure 1 ).
[0028] Preferably, the application includes: using wet bacteria obtained after fermentation and culture of an engineered bacterium containing the transaminase or the transaminase mutant encoding gene, immobilized wet bacteria cells, enzyme extracted after ultrasonic disruption of wet bacteria, or immobilized enzyme as a catalyst, in the presence of an external amino donor and pyridoxal phosphate, with N-Boc-3-piperidone as a substrate and phosphate buffer as a reaction medium to form a reaction system, and separating and obtaining N-Boc-3-aminopiperidine after the reaction.
[0029] Preferably, the N-Boc-3-piperidone is dissolved in a cosolvent, which is at least one of dimethyl sulfoxide, acetonitrile, methanol, isopropanol, and anhydrous ethanol, and the volume concentration of the cosolvent is 10% to 30%.
[0030] Preferably, the pH of the reaction is 8-9.5.
[0031] Preferably, the reaction temperature is 40-50°C.
[0032] Preferably, the concentration of pyridoxal phosphate in the reaction system is 2.5-4 mM.
[0033] Preferably, the amino donor is isopropylamine, and the concentration of isopropylamine in the reaction system is 1.5-2.5 M.
[0034] Preferably, the catalyst is wet bacteria obtained by fermentation culture of an engineered bacterium containing the transaminase or transaminase mutant encoding gene, and the concentration of the wet bacteria in the reaction system is 100-150 g / L.
[0035] Preferably, the concentration of N-Boc-3-piperidone in the reaction system is 20-200 g / L.
[0036] Beneficial Effects of the Invention: The present invention provides a transaminase derived from Mycobacterium sp., which catalyzes the production of N-Boc-3-piperidone to N-Boc-3-aminopiperidine in a 1 mL reaction system, achieving a 24-hour conversion rate of 95% and a product ee value exceeding 99%. Furthermore, the present invention also provides a series of mutants of the transaminase, exhibiting relative enzyme activities ranging from 224% to 293%, further enhancing the transaminase's catalytic activity. Compared to the wild-type transaminase, the transaminase mutant Mu-H71R-A166I exhibits higher catalytic activity, achieving a 24-hour conversion rate exceeding 99% and a product ee value exceeding 99% at a substrate concentration of 20 g / L in a 10 mL reaction system. The present invention further optimizes the reaction conditions for the transaminase mutant to catalyze the production of (R)-N-Boc-3-aminopiperidine, achieving an optimal conversion rate of 90% after 36 hours under the optimal reaction conditions of a substrate concentration of 120 g / L in a 10 mL reaction system. This production technology has the advantages of high catalytic activity, easy fermentation, and environmental friendliness, and has good development and application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 The chemical formula is that N-Boc-3-piperidone is catalyzed by transaminase to generate (R)-1-Boc-3-aminopiperidine.
[0038] Figure 2 These are the results of the transaminase mutants catalyzing N-Boc-3-piperidone at different pH values in Example 8 of the present invention.
[0039] Figure 3 These are the results of the transaminase mutant catalyzing N-Boc-3-piperidone at different temperatures in Example 9 of the present invention.
[0040] Figure 4 These are the results of the transaminase mutant catalyzing N-Boc-3-piperidone at different substrate concentrations in Example 13 of the present invention. DETAILED DESCRIPTION
[0041] The following describes the embodiments of the present invention by specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. The various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the case of no conflict, the features in the following examples and embodiments can be combined with each other. In the embodiments of the present invention, unless otherwise specified, the methods used are all conventional methods, and the reagents used can be obtained from commercial sources.
[0042] Example 1: Preparation of transaminase
[0043] The coding sequence of the transaminase from Mycobacterium sp. (nucleic acid sequence shown in SEQ ID NO. 2) was ligated with the expression vector pET-28a to construct a heterologous expression recombinant plasmid containing the transaminase-encoding gene. The expression recombinant plasmid was then transformed into competent host E. coli BL21(DE3) cells to obtain the recombinant genetically engineered strain E. coli BL21(DE3) / pET28a(+)-Mu.
[0044] After thawing transaminase-engineered E. coli BL21(DE3) / pET28a(+)-Mu on ice, streak the culture onto a kanamycin-resistant LB plate and incubate at 37°C for 12 hours. Pick a single colony and inoculate it into a 10 mL LB tube containing a final concentration of 50 mg / L kanamycin. Incubate at 37°C, 180 rpm, and shake for 7–8 hours before use. Inoculate 2 mL of the culture from the tube into a 100 mL LB shake flask containing a final concentration of 50 mg / L kanamycin. Incubate at 37°C, 220 rpm, and shake for 2 hours. Add 100 µL of 0.1 M IPTG and incubate at 28°C, 220 rpm, and shake for 12–14 hours. Collect the cells by centrifugation at 8000 rpm for 10 minutes at 4°C and refrigerate at -20°C until use.
[0045] Example 2: Verification of catalytic activity and chirality of transaminase
[0046] 1 mL reaction system: Weigh 0.1 g of the wet cells prepared in Example 1 and resuspend in 500 µL of PB buffer (pH 9.5) containing 1 M isopropylamine and 1 mM PLP. Weigh 0.4 g of the substrate (N-Boc-3-piperidone) and dissolve it in DMSO to a volume of 10 mL. Add 500 µL of this to the reaction solution (the N-Boc-3-piperidone concentration in the reaction system is 20 g / L). The reaction temperature was controlled at 40°C and the reaction was allowed to proceed for 24 hours. Samples were collected for conversion analysis by HPLC. After the reaction, samples were extracted with ethyl acetate, concentrated by centrifugation, and redissolved in anhydrous ethanol. The chirality was analyzed by HPLC. The 24-hour conversion was 95%, and the product ee was greater than 99%.
[0047] The detection conditions for product quantitative analysis were as follows: C18 column (4.6 mm × 250 mm, 5.0 µm), mobile phase: 26% acetonitrile: 72% 10 mM ammonium acetate (pH adjusted to 4.5 with acetic acid), flow rate: 1 mL / min, UV absorption wavelength: 210 nm, injection volume: 5 µL.
[0048] Chiral detection conditions were as follows: Daicel Chiralpak AD-H column (4.6 × 250 mm, 5.0 µm), n-hexane: 0.1% ethylenediamineethanol = 90%: 10%, flow rate 1 mL / min, column temperature 30°C, detection wavelength 200 nm, injection volume 5 µL.
[0049] Example 3: Construction of transaminase mutants
[0050] The vector pET28a(+)-Mu prepared in Example 1 was used as a template and the site-directed mutagenesis primers described below (Table 1) were used to introduce mutations by PCR. The mutation sites are underlined.
[0051] Table 1. Primer list
[0052] Primers Sequence 5'-3' H71R-F <![CDATA[GACACCGGTTTCGGT AGA TCTGACCTGAC]]> H71K-F <![CDATA[GACACCGGTTTCGGT AAG TCTGACCTGAC]]> H71-R ACCGAAACCGGTGTCGAAGATAGAGATAC A166I-F <![CDATA[CTATCCCGTACCTGTGG ATT TTCCCGCCGG]]> A166V-F <![CDATA[CTATCCCGTACCTGTGG GTT TTCCCGCCGG]]> A166-R CCACAGGTACGGGATAGCGTAGATGTAAA G145F-F <![CDATA[GTGGTTACGGTAAACGTAAA TTT GAAAAA]]> G145W-F <![CDATA[GTGGTTACGGTAAACGTAAA TGG GAAAAA]]> G145-R TTTACGTTTACCGTAACCACGGGTAACGGT
[0053] The PCR reaction procedure was as follows: 95°C for 5 min, 98°C for 30 s, 56°C for 30 s, and 72°C for 3 min 40 s, repeated for 32 cycles; extension was continued at 72°C for 5 min. The PCR product was treated with DpnI at 37°C for 2 h, transformed into E. coli BL21 (DE3) recipient bacteria, and plated on LB solid plates containing a final concentration of 50 mg / L kanamycin resistance. After incubation at 37°C for 12 h, single colonies were randomly selected for sequencing analysis. Wet bacterial cells of each transaminase mutant Mu-H71R, Mu-H71K, Mu-A166I, and Mu-A166V were obtained according to the method in Example 1.
[0054] Furthermore, mutations were introduced by PCR using plasmid DNA containing the Mu-H71R and Mu-H71K genes as templates. The combined mutation primers are as follows, and the mutation sites are underlined:
[0055] H71-A166I-F: 5'-CTATCCCGTACCTGTGG ATT TTCCCGCCGG -3';
[0056] H71-A166I-R: 5'-CCACAGGTACGGGATAGCGTAGATGTAAA-3'.
[0057] The PCR reaction procedure was as follows: 95°C for 5 min, 98°C for 30 s, 56°C for 30 s, and 72°C for 3 min 30 s, repeated for 32 cycles; extension was continued at 72°C for 5 min. The PCR product was treated with DpnI at 37°C for 3 h to inactivate it, then transformed into E. coli BL21 (DE3) recipient bacteria and plated on LB solid plates containing a final concentration of 50 mg / L kanamycin resistance. After incubation at 37°C for 12 h, single colonies were randomly selected for sequencing analysis. Wet cells of the recombinant transaminase combination mutants Mu-H71K-A166I and Mu-H71R-A166I were obtained according to the method of Example 1.
[0058] Example 4: Screening of transaminase mutants
[0059] The transaminase obtained in Example 1 and the transaminase mutant obtained in Example 3 were subjected to enzyme activity assay analysis. A 1 mL reaction system was constructed according to the method described in Example 2. The reaction temperature was controlled at 40° C. and the reaction was carried out for 4 h. Samples were taken for HPLC detection of the conversion rate. Relative enzyme activity = (mutant conversion rate / wild-type conversion rate) * 100%.
[0060] The results are shown in Table 2. The stability of the transaminase was further improved by site-directed mutagenesis. After combined mutations at different mutation sites, the optimal mutant Mu-H71R-A166I was obtained.
[0061] Table 2. Comparison of relative enzyme activities
[0062] enzymes Relative enzyme activity (%) Wild type (Mu) 100.00 Mu-H71R 261.72 Mu-H71K 223.58 Mu-A166V 242.43 Mu-A166I 278.18 Mu-G145F 168.36 Mu-G145W 152.98 Mu-H71R-A166I 293.27 Mu-H71K-A166I 288.57
[0063] Example 5: Application of transaminase mutants in the preparation of (R)-N-Boc-3-aminopiperidine
[0064] Single-point mutants Mu-H71R and Mu-A166I, as well as the combined mutant Mu-H71R-A166I, with superior catalytic activity, were selected for use in the preparation of (R)-N-Boc-3-aminopiperidine. The specific preparation methods are as follows.
[0065] In a 10 mL reaction system, 1 g of wet cells prepared in Example 3 was resuspended in 5 mL of PB buffer (pH 9.5) containing 1 M isopropylamine and 1 mM PLP. 4 g of substrate (N-Boc-3-piperidone) was dissolved in DMSO to a final volume of 10 mL. 5 mL was then added to the reaction solution (should the N-Boc-3-piperidone concentration be 20 g / L). The reaction temperature was maintained at 40°C with a magnetic stirrer at 800 rpm. After 24 h of reaction, a 200 μL sample was collected, isolated, purified, and diluted 10-fold with 28% acetonitrile. The conversion was determined by HPLC. Results showed that after 24 h of catalysis with Mu-H71R, Mu-A166I, and Mu-H71R-A166I, the yield of (R)-N-Boc-3-aminopiperidine reached over 99%.
[0066] Example 6: N-Boc-3-piperidone cosolvent screening
[0067] 0.1 g of the wet cells of Mu-H71R-A166I prepared in Example 3 was used to prepare a 1 mL reaction system according to the method described in Example 2. The substrate (N-Boc-3-piperidone) was dissolved in different cosolvents. After reacting at 40°C and 800 rpm for 1 h, the reaction was terminated by adding 200 µL of 1 M hydrochloric acid. Samples were collected and analyzed for conversion by HPLC. The results are shown in Table 3.
[0068] Table 3. Catalytic effects of different cosolvents
[0069] cosolvent Conversion rate (%) DMSO 57.86 Acetonitrile 20.09 Methanol 48.93 Isopropyl alcohol 23.72 n-hexane 1.45 Anhydrous ethanol 24.23 Ethyl acetate 2.9
[0070] The results showed that the conversion rate was the highest when DMSO was the co-solvent. In addition, methanol also had a high conversion rate when used as the co-solvent.
[0071] Example 7: Catalytic reaction of N-Boc-3-piperidone with different concentrations of DMSO
[0072] A 1 mL reaction system was prepared using 0.1 g of the wet cells of Mu-H71R-A166I prepared in Example 3, following the method described in Example 2. The substrate (N-Boc-3-piperidone) was dissolved in various concentrations of the cosolvent DMSO. The reaction was incubated at 40°C and 800 rpm for 1 h. The reaction was terminated by adding 200 µL of 1 M hydrochloric acid, and the conversion rate was determined by HPLC. The results are shown in Table 4.
[0073] Table 4. Catalytic effects at different DMSO concentrations
[0074] DMSO concentration (%) Conversion rate (%) 50 49.78 40 78.88 30 84.67 25 87.59 20 87.27 10 86.04
[0075] The results showed that the catalytic efficiency was highest when the co-solvent DMSO concentration was 25%. In addition, a high conversion rate was achieved when the concentration was in the range of 10% to 30%. Considering the solubility of the substrate, the substrate was dissolved in 25% DMSO in subsequent experiments.
[0076] Example 8: pH Optimization of N-Boc-3-Piperidone Reaction
[0077] 0.1 g of the wet cells Mu-H71R-A166I prepared in Example 3 was used to construct a 1 mL reaction system according to the method described in Example 2. The substrate (N-Boc-3-piperidone) was dissolved in 25% DMSO, and the pH of the PB buffer was varied. After reacting at 40°C and 800 rpm for 1 h, 200 μL of 1 M hydrochloric acid was added to terminate the reaction, and samples were collected for HPLC analysis of the conversion rate. The results are shown in Table 5. Figure 2 shown.
[0078] Table 5. Catalytic effects at different pH values
[0079] pH Conversion rate (%) 7.5 50.73 8 54.67 8.5 56.67 9 57.64 9.5 54.15 10 53.78 10.5 48.68 11 38.97
[0080] The results showed that the conversion rate of N-Boc-3-piperidone was the highest at pH 9, and the conversion rate was also high at pH = 8 to 9.5.
[0081] Example 9: Optimization of N-Boc-3-piperidone reaction temperature
[0082] 0.1 g of the wet cells Mu-H71R-A166I prepared in Example 3 was used to construct a 1 mL reaction system according to the method described in Example 2, wherein the substrate (N-Boc-3-piperidone) was dissolved in 25% DMSO and the pH of the PB buffer was 9. After reacting for 1 h at different temperatures and 800 rpm, 200 μL of 1 M hydrochloric acid was added to terminate the reaction, and samples were taken for HPLC analysis of the conversion rate. The results are shown in Table 6. Figure 3 shown.
[0083] Table 6. Catalytic effects at different temperatures
[0084] Temperature (℃) Conversion rate (%) 30 41.41 35 43.62 40 44.48 45 47.11 50 44.87 55 40.21
[0085] The results show that the conversion rate of N-Boc-3-piperidone is the highest when the reaction temperature is 45°C. In addition, the conversion rate is also relatively high when the temperature is between 40°C and 50°C.
[0086] Example 10: Optimization of N-Boc-3-piperidone PLP addition amount
[0087] 0.1 g of the wet cells of Mu-H71R-A166I prepared in Example 3 were resuspended in 500 µL of PB buffer (pH 9.0) containing 1 M isopropylamine and varying concentrations of PLP. 1 g of the substrate (N-Boc-3-piperidone) was dissolved in 25% DMSO to a volume of 10 mL. 500 µL of this solution was added to the reaction solution (the N-Boc-3-piperidone concentration in the reaction system was 50 g / L). The reaction was incubated at 45°C and 800 rpm for 30 min. The reaction was terminated by adding 200 µL of 1 M hydrochloric acid, and samples were collected for conversion analysis by HPLC. The results are shown in Table 7.
[0088] Table 7. Catalytic effects of different PLP additions
[0089] PLP (mM) Conversion rate (%) 0 20.99 0.5 32.01 1 33.61 1.5 36.06 2 36.24 2.5 39.41 3 40.20 3.5 41.52 4 43.71
[0090] The results showed that with the increase of PLP amount, the catalytic efficiency also gradually increased. The reaction efficiency was best when the addition amount of PLP was 4 mM, and a high conversion rate was achieved in the range of 2.5~4 mM. Considering the high cost of PLP, in order to balance the catalytic efficiency and the economy of industrial production, 2.5 mM was selected as the optimal PLP concentration, which effectively controlled the production cost while ensuring the reaction efficiency.
[0091] Example 11: Optimization of the amount of N-Boc-3-piperidone isopropylamine added
[0092] 0.1 g of the wet cells of Mu-H71R-A166I prepared in Example 3 were used to prepare a 1 mL reaction system according to the method described in Example 10. The substrate (N-Boc-3-piperidone) was dissolved in 25% DMSO, the pH of the PB buffer was 9, the PLP concentration was 2.5 mM, and the isopropylamine concentration was varied. After incubation at 45°C and 800 rpm for 30 min, the reaction was terminated by adding 200 µL of 1 M hydrochloric acid, and the sample was sampled for conversion analysis by HPLC. The results are shown in Table 8.
[0093] Table 8. Catalytic effect at different isopropylamine concentrations
[0094] Isopropylamine (M) Conversion rate (%) 0 0 1 44.52 1.5 51.10 2 52.84 2.5 49.02 3 45.39 3.5 40.54
[0095] The results showed that the conversion rate reached a maximum of 52.84% when the isopropylamine concentration was 2 M, and higher conversion rates were observed between 1.5 and 2.5 M.
[0096] Example 12: Different concentrations of optimal transaminase mutants catalyzing N-Boc-3-piperidone
[0097] Different masses of wet cells of Mu-H71R-A166I prepared in Example 3 were used to construct a 1 mL reaction system according to the method described in Example 10. The substrate (N-Boc-3-piperidone) was dissolved in 25% DMSO, the pH of the PB buffer was 9, the PLP concentration was 2.5 mM, and the isopropylamine concentration was 2 M. The reaction was carried out at 45°C and 800 rpm for 30 min. The reaction was terminated by adding 200 µL of 1 M hydrochloric acid, and the conversion rate was determined by HPLC. The results are shown in Table 9.
[0098] Table 9. Catalytic effects at different enzyme concentrations
[0099] Enzyme concentration (g / L) Conversion rate (%) 50 46.92 80 57.24 100 59.97 120 62.43 150 67.54
[0100] The results showed that when the transaminase concentration was in the range of 50~150 g / L, the conversion rate gradually increased with the increase of enzyme amount. At a concentration of 150 g / L, the conversion rate was 67.54%, and higher conversion rates were observed in the range of 100~150 g / L.
[0101] Example 13: Optimal transaminase mutants catalyze the conversion of N-Boc-3-piperidone to N-Boc-3-piperidone at different concentrations
[0102] 1 g of the wet bacteria Mu-H71R-A166I prepared in Example 3 was used to construct a 10 mL reaction system, in which different masses of substrate (N-Boc-3-piperidone) were weighed and dissolved in 25% DMSO. The pH of the PB buffer was 9, the PLP concentration was 2.5 mM, and the isopropylamine concentration was 2 M. The reaction was carried out at 45°C and 800 rpm for 48 h. Samples were taken at regular intervals and 200 μL of 1 M hydrochloric acid was added to terminate the reaction. The samples were then taken and the conversion rate was determined by HPLC. The results are shown in Figure 2. Figure 4 shown.
[0103] The results showed that under the optimal reaction conditions of 25% DMSO, 2.5 mM PLP, 2 M isopropylamine, pH = 9, and 45°C, the optimal conversion rate of 90% was achieved after 36 h of reaction with 120 g / L substrate.
[0104] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection of the present invention.
Claims
1. A transaminase, characterized in that The transaminase comprises the full-length sequence of SEQ ID NO. 1 and is derived from Mycobacterium sp.
2. A transaminase mutant, characterized in that: The transaminase mutant is obtained by performing single point mutation or combined mutation at positions 71, 166, and 145 of the amino acid sequence shown in SEQ ID NO.
1.
3. The transaminase mutant according to claim 2, characterized in that The mutation is at least one of the following (1) to (2): (1) The histidine at position 71 is mutated to either arginine or lysine; (2) Alanine at position 166 is mutated to either valine or isoleucine; (3) Glycine at position 145 mutates to either phenylalanine or tryptophan.
4. The transaminase mutant according to claim 2, wherein The transaminase mutant is obtained by mutating the histidine at position 71 to arginine and the alanine at position 166 to isoleucine in the amino acid sequence shown in SEQ ID NO. 1; or The transaminase mutant is obtained by mutating the histidine at position 71 to lysine and the alanine at position 166 to isoleucine in the amino acid sequence shown in SEQ ID NO.
1.
5. A gene encoding the transaminase according to claim 1 or the transaminase mutant according to any one of claims 2 to 4.
6. A recombinant vector comprising the gene encoding the transaminase or transaminase mutant according to claim 5.
7. A genetically engineered bacterium containing the gene encoding the transaminase or transaminase mutant according to claim 5.
8. Use of the transaminase according to claim 1 or the transaminase mutant according to any one of claims 2 to 4 in enzymatic synthesis of chiral amines.
9. The use according to claim 8, characterized in that The application includes: using wet bacteria obtained after fermentation and culture of an engineered bacterium containing the transaminase or the transaminase mutant encoding gene, immobilized wet bacteria cells, enzymes extracted after ultrasonic disruption of wet bacteria, or immobilized enzymes as catalysts, with N-Boc-3-piperidone as a substrate and phosphate buffer as a reaction medium under the conditions of external addition of an amino donor and pyridoxal phosphate, to form a reaction system, and separating and obtaining N-Boc-3-aminopiperidine after the reaction.
10. The use according to claim 9, characterized in that Include one of the following: (a) the N-Boc-3-piperidone is dissolved in a cosolvent, wherein the cosolvent is at least one of dimethyl sulfoxide, acetonitrile, methanol, isopropanol, and anhydrous ethanol, and the volume concentration of the cosolvent is 10% to 30%; (b) the pH of the reaction is 8 to 9.5; (c) the reaction temperature is 40-50° C.; (d) the concentration of pyridoxal phosphate in the reaction system is 2.5 to 4 mM; (e) the amino donor is isopropylamine, and the concentration of isopropylamine in the reaction system is 1.5 to 2.5 M; (f) The catalyst is a wet cell obtained by fermentation of an engineered bacterium containing a gene encoding the transaminase or the transaminase mutant, and the concentration of the wet cell in the reaction system is 100-150 g / L; (g) The concentration of N-Boc-3-piperidone in the reaction system is 20-200 g / L.
Citation Information
Cited By
Transaminase mutant, recombinant genetically engineered bacterium and application of recombinant genetically engineered bacterium in catalytic synthesis of (R)-1-Boc-3-aminopiperidine
CN121737071A