Pseudomonas putida purf gene knockout strain and application thereof

By knocking out the purF gene in *Pseudomonas putida*, a purF knockout strain was constructed, which solved the deficiencies of *Pseudomonas putida* in riboflavin production and fish probiotic functions, and achieved increased riboflavin production and regulation of iron balance in fish under iron-deficient conditions.

CN120536471BActive Publication Date: 2025-11-04SOUTHERN MARINE SCIENCE & ENGINEERING GUANGDONG LABORATORY (ZHANJIANG)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511038250.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-28
Publication Date
2025-11-04
Estimated Expiration
2045-07-28

AI Technical Summary

Technical Problem

In the existing technology, research on Pseudomonas aeruginosa in the field of riboflavin production is relatively limited, especially in the development of its probiotic function in fish, and the yield and adaptability of riboflavin under iron-deficient conditions are insufficient.

Method used

By knocking out or inhibiting the purF gene of *Pseudomonas putida*, a purF knockout strain was constructed to enhance its riboflavin synthesis, biofilm formation, and adhesion capabilities. This strain was then used to prepare microbial preparations to improve iron balance in fish.

Benefits of technology

It significantly improved the riboflavin production and intracellular iron level of *Pseudomonas putida* under iron-deficient conditions, enhanced its adhesion and biofilm formation capabilities, improved iron metabolism in fish, and provided a new resource of non-pathogenic strains for iron balance regulation in fish.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536471B_ABST
    Figure CN120536471B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of bioengineering technology and discloses a strain of *Pseudomonas putida*. purF Gene knockout strains and their applications are disclosed in detail. purF Gene reagents or inhibitors purF The application of gene expression reagents in enhancing the ability of *Pseudomonas putida* to synthesize riboflavin. This invention discloses for the first time the method of enhancing the ability of *Pseudomonas putida* to synthesize riboflavin by knocking out or inhibiting gene expression in *Pseudomonas putida*. purF Genes or their expression can significantly enhance the iron deficiency adaptation, adhesion and biofilm formation of *Pseudomonas putida*, and can also regulate the expression of iron balance-related genes in fish hosts, thereby increasing the iron content in fish host tissues.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to a Pseudomonas putida purF Gene knockout strain and application thereof. BACKGROUND

[0002] Purine is a precursor of important molecules such as nucleic acid, ATP and riboflavin, and its synthesis pathway is highly conserved. purF The fifth step is to transfer a formyl group (-CHO) to an intermediate product AIR (5-aminoimidazole ribonucleotide) to generate CAIR (5-aminoimidazole-4-carboxamide ribonucleotide). The current core strategy for improving riboflavin production is still focused on optimizing the metabolic pathways of conventional industrial strains such as Bacillus subtilis, and overexpressing purF key genes is one of the important methods for improving precursor supply, while other species such as Pseudomonas have limited research in the field of riboflavin production.

[0003] Pseudomonas putida belongs to the genus Pseudomonas (Pseudomonas) Pseudomonas , is a gram-negative bacillus with flagella, strong metabolic capacity and strong adaptability. In the prior art, research on Pseudomonas is mostly focused on its application in the prevention and treatment of infectious diseases, environmental management, plant growth promotion, and the like, and research and development of its probiotic function for animals, especially fish, is relatively lacking. Therefore, there is an urgent need for a Pseudomonas putida mutant strain with simple construction method, good genetic stability and strong adaptability under iron deficiency conditions to break through the bottleneck of the prior art. SUMMARY

[0004] The first aspect of the present application aims to provide a reagent for knocking out purF a gene or a reagent for inhibiting purF gene expression to improve the ability of Pseudomonas putida to synthesize riboflavin.

[0005] The second aspect of the present application aims to provide a Pseudomonas putida purF knockout strain.

[0006] The third aspect of the present application aims to provide a microbial preparation.

[0007] The fourth aspect of the present application aims to provide the application of the Pseudomonas putida purF knockout strain of the second aspect of the present application or the microbial preparation of the third aspect of the present application.

[0008] The fifth aspect of this invention aims to provide a method for improving the iron balance regulation ability of fish.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] The first aspect of the invention provides knockout purF Gene reagents or inhibitors purF The application of gene expression reagents in any one of (1) to (6):

[0011] (1) Enhance the ability of *Pseudomonas putida* to synthesize riboflavin;

[0012] (2) To prepare products that enhance the ability of *Pseudomonas putida* to synthesize riboflavin;

[0013] (3) Enhance the biofilm formation ability of *Pseudomonas putida*;

[0014] (4) Prepare products that enhance the biofilm formation ability of *Pseudomonas putida*;

[0015] (5) Enhances the adhesion of *Pseudomonas putida* to animal mucus;

[0016] (6) Prepare products that enhance the adhesion of *Pseudomonas putida* to animal mucus;

[0017] The purF The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0018] In some embodiments of the present invention, the improvement of the ability of *Pseudomonas putida* to synthesize riboflavin in (1) to (2) includes improving the ability of *Pseudomonas putida* to synthesize riboflavin under iron-deficient conditions.

[0019] In some embodiments of the present invention, the animals mentioned in (5) to (6) include any one of the following: grass carp, silver carp, bighead carp, common carp, crucian carp, bream, sturgeon, eel, grouper, large yellow croaker, flounder, sea bass, golden pomfret, zebrafish, etc.

[0020] A second aspect of the present invention provides a *Pseudomonas putida* bacterium. purF The knockout strain, *Pseudomonas putida* purF The genome of the knockout strain does not contain purF Gene.

[0021] In some embodiments of the present invention, the purF The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0022] In some embodiments of the present invention, the *Pseudomonas putida* purF The knockout strain is preserved in Wuhan University (China Center for Type Culture Collection) in Wuchang District, Wuhan City, Hubei Province, and the preservation number is CCTCC NO: M 2025894, and the preservation time is April 25, 2025.

[0023] In a third aspect of the present application, a microbial preparation is provided, comprising the Pseudomonas putida of the second aspect of the present application purF The knockout strain.

[0024] The active ingredient of the microbial preparation can be the Pseudomonas putida described above purF The knockout strain, the Pseudomonas putida described above purF The culture (such as fermentation metabolites) of the knockout strain, and the active ingredient of the microbial preparation can also contain other biological components or non-biological components, and other active ingredients of the microbial preparation can be determined by those skilled in the art according to the effect of the microbial preparation.

[0025] The term "culture" refers to a general term for a liquid or solid product (all substances in the culture container, fermentation product) that grows a microbial population after artificial inoculation and culture. That is, the product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites or other components produced during the culture process.

[0026] In the microbial preparation described above, the microbial preparation contains a carrier in addition to the active ingredient. The carrier can be a carrier commonly used in the field (such as microorganisms, agriculture) and biologically inert. The carrier can be a solid carrier or a liquid carrier; the solid carrier can be a mineral material, a plant material or a high molecular compound; the mineral material can be at least one of clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica and diatomite; the plant material can be at least one of bagasse powder, corn powder, bean powder and starch; the high molecular compound can be polyvinyl alcohol and / or polyglycol; the liquid carrier can be an organic solvent or water; the organic solvent can be decane and / or dodecane.

[0027] In the microbial preparation described above, the dosage form of the microbial preparation can be various dosage forms, such as liquid, emulsion, suspension, powder, granule, capsule, tablet, wettable powder or water dispersible granule.

[0028] In a fourth aspect of the present application, the Pseudomonas putida of the second aspect of the present application is provided purF The use of the knockout strain or the microbial preparation of the third aspect of the present application in any one of (a1) to (a4):

[0029] (a1) riboflavin preparation;

[0030] (a2) biofilm preparation;

[0031] (a3) increasing iron content of animal tissue;

[0032] (a4) increasing iron balance regulation ability of animal;

[0033] The animal in the (a3) to (a4) is fish.

[0034] In some embodiments of the present application, the riboflavin preparation in the (a1) comprises preparing riboflavin under iron deficiency condition.

[0035] In some embodiments of the present application, the fish comprises any one of blue fish, grass carp, silver carp, bighead carp, common carp, crucian carp, bream, sturgeon, eel, grouper, large yellow croaker, turbot, sea perch, gold pompano, zebra fish.

[0036] In the fifth aspect of the present application, a method for increasing iron balance regulation ability of fish is provided, comprising using the Pseudomonas putida purF knockout strain or the microbial preparation of the third aspect of the present application to act on zebra fish.

[0037] In some embodiments of the present application, the acting mode comprises soaking, smearing, spraying, mixing with feed and feeding, etc.

[0038] The present application has the following beneficial effects:

[0039] The present application discloses for the first time that by knocking out or inhibiting the gene or expression of Pseudomonas putida purF , the riboflavin production and intracellular iron level of the Pseudomonas putida under iron deficiency environment can be significantly improved, the iron deficiency adaptation ability of the Pseudomonas putida can be improved, and the adhesion ability and biofilm formation ability of the Pseudomonas putida can also be improved.

[0040] The present application provides a Pseudomonas putida purF knockout strain, experiments prove that the strain is a non-pathogenic strain, and under the dosage of 1×10 6 CFU / mL, no acute toxicity reaction is generated to aseptic zebra fish host. Under iron-limited condition, the purF knockout strain can improve riboflavin production. Meanwhile, the purF knockout strain can improve riboflavin production. Meanwhile, the tonB 、 fumC knockout strain can improve riboflavin production. Meanwhile, the ribB 、 ribA knockout strain can improve riboflavin production. Meanwhile, theiron storage protein (Fet1p) Bfr ) and the relative expression level of iron-regulated protein (Irt1p) fur , thereby significantly improving its survival ability under iron deficiency conditions. purF The knockout strain has good in vitro adhesion ability to grass carp mucus. Compared with the wild type P. putida, the purF The knockout strain has significantly improved biofilm formation ability. The purF The knockout strain can significantly improve the expression of iron-related genes (Fet1p purF The knockout strain, which can significantly improve the expression of iron-related genes (Fet1p aco1 、 ireb2 、 Cp 、 atf4a 、 fth1a 、 DMT1 、 tfr1a and hif1ab ), thereby improving the iron content of fish tissues, provides a new strain resource for developing microbial preparations to improve fish iron metabolism. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 Construction of P. putida knockout strain; wherein A is the amplification electropherogram of the upstream / downstream homologous arm of P. putida purF ; B is the recombinant plasmid pEX18Gm- purF transformed into S17-1ℷ competent cells, wherein 1 is the wild strain, and 2 and 3 are the transformants; C is the homologous exchange of the wild strain and the transformant S17-1ℷ competent cells, wherein 1 is the full length of the wild strain, 2-4 are the full length of the residues in the mutant strain, and 5 is the NC control group; D is the comparison of the base sequence (1506 bp) and the amino acid sequence of P. putida purF ; E is the protein structure prediction model of the wild strain PurF; F is the protein structure marker of the mutant fragment, with blue being the mutant structure; G is the protein structure prediction model of the PurF residue in the knockout strain. purF purF purF purF purF purF The protein structure prediction model of the PurF residue in the knockout strain.

[0042] Figure 2 Growth curve of P. putida knockout strain; wherein A is the growth curve of P. putida purF ; B is the growth curve of the knockout strain of P. putida ​​​​​purF Growth curves of knockout and wild type strains; B is P. putida purF Results of iron adaptation experiment of knockout and wild type strains.

[0043] Figure 3 P. putida purF Results of determination of riboflavin (A) and iron content (B) of knockout strains.

[0044] Figure 4 P. putida purF Relative expression levels of iron synthesis related genes, key genes of riboflavin synthesis, iron storage proteins and iron regulatory proteins of knockout strains under iron deficiency conditions; A is P. putida purF Relative expression levels of iron synthesis related genes, key genes of riboflavin synthesis, iron storage proteins and iron regulatory proteins of knockout and wild type strains under 0 μmol / L 2,2'-bipyridine culture conditions; B is P. putida purF Relative expression levels of iron synthesis related genes, key genes of riboflavin synthesis, iron storage proteins and iron regulatory proteins of knockout and wild type strains under 800 μmol / L 2,2'-bipyridine culture conditions; C is P. putida purF Comparison results of relative expression levels of iron synthesis related genes, key genes of riboflavin synthesis, iron storage proteins and iron regulatory proteins of knockout strains under 0 and 800 μmol / L 2,2'-bipyridine culture conditions; in the figure, ns represents no significant difference, * represents P <0.05, ** represents P <0.01, *** represents P <0.001.

[0045] Figure 5 P. putida purF In vitro adhesion of knockout strains to grass carp mucus (1.2 mg / mL) (A) and P. putida purF Biofilm formation ability of knockout strains (B).

[0046] Figure 6 P. putida wild strain and P. putida purF Safety experiment of knockout strains on zebrafish; A is P. putida purFSurvival curves of zebrafish larvae after infection with the wild type strain of P. putida and the P. putida knockout strain. purF Survival curves of zebrafish larvae after infection with the wild type strain of P. putida and the P. putida knockout strain.

[0047] Figure 7 Survival curves of zebrafish larvae after infection with the wild type strain of P. putida and the P. putida knockout strain. purF Effects of the P. putida knockout strain on the iron content of zebrafish tissues and iron balance regulation-related genes. DETAILED DESCRIPTION

[0048] The content of the present application will be further described in detail below through specific examples.

[0049] It should be understood that these examples are only used to illustrate the present application and not used to limit the scope of the present application.

[0050] In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below. If specific conditions are not indicated in the embodiments, conventional conditions or manufacturer recommended conditions are used. If the reagents or instruments used are not indicated by the manufacturer, they are all conventional products that can be purchased on the market.

[0051] Bacterial culture: the wild type strain of P. putida CD (the preservation name is Pseudomonas putida The wild type strain of P. putida CD was isolated from fish larvae by the previous laboratory, and was identified as P. putida by 16s sequencing. The wild type strain of P. putida, E. coli DH5a and S17-1λPir stored in a -80℃ ultra-low temperature refrigerator were streaked on solid LB medium, and were placed in a biochemical incubator at 28℃ (wild type strain of P. putida), 37℃ (E. coli DH5a and S17-1λPir) for 12~24 h. Single colonies were inoculated in LB liquid medium, and were placed in a constant temperature shaker at 28℃ (wild type strain of P. putida), 37℃ (E. coli DH5a and S17-1λPir) at a speed of 220 rpm for overnight culture, to obtain the corresponding bacterial liquid.

[0052] The features and performances of the present application will be further described in detail below in combination with examples.

[0053] Example 1

[0054] A P. putida purFA gene knockout strain, which is constructed by Red / ET homologous recombination method, recombination plasmid pEX18Gm- purF integrated into the wild type CD bacterial (i.e. Pseudomonas putida) genome Figure 1 , the strain construction method comprising the following steps:

[0055] (1) Extracting Pseudomonas putida whole genome, amplifying purF the full length of the gene (nucleotide sequence as shown in SEQ ID NO: 1) in Figure 1 D~E, the primers used are F: 5'- ATGTGTGGCATCGTCGGTATC -3' (SEQ ID NO: 2) and R: 5'- TCAGTTGTTGTAAAGGTCGATGATC -3' (SEQ ID NO: 3).

[0056]

[0057] (2) Template: Pseudomonas putida CD whole genome, upstream primer P1: 5'- CAGGTCGACTCTAGAGGATCCATGTGTGGCATCGTCGGTATC -3' (SEQ ID NO: 4), downstream primer P2: 5'- AGTAGACATTTGCCAGGTCGCGGATCAG -3' (SEQ ID NO: 5) were obtained by PCR amplification (PCR reaction system as shown in Table 1, PCR reaction program as shown in Table 2) purF upstream homologous arm of the gene. Template: Pseudomonas putida CD whole genome, upstream primer P3: 5'- CGACCTGGCAAATGTCTACTTCTGCTCCGCGG -3' (SEQ ID NO: 6), downstream primer P4: 5'- TATGACCATGATTACGAATTCTCAGTTGTTGTAAAGGTCGATGATC -3' (SEQ ID NO: 7) were obtained by PCR amplification (PCR reaction system as shown in Table 1, PCR reaction program as shown in Table 2) purF downstream homologous arm of the gene. The upstream homologous arm and the downstream homologous arm were purified and recovered according to the instructions of Beijing Zoben Gold Biotechnology Co., Ltd. Gel Recovery Kit. The two fragments were amplified by overlap extension PCR, using upstream primer P1: 5'- CAGGTCGACTCTAGAGGATCCATGTGTGGCATCGTCGGTATC -3' (SEQ ID NO: 4) and downstream primer P4: 5'- TATGACCATGATTACGAATTCTCAGTTGTTGTAAAGGTCGATGATC -3' (SEQ ID NO: 7). After re-recovery of the gel, a linear DNA fragment was obtained purF -genta.

[0058] Table 1 PCR reaction system

[0059]

[0060] Table 2 PCR reaction program

[0061]

[0062] (3) According to the instructions of EasyPure® Plasmid MiniPrep kit (EM101-02) of Zoonmer Biotechnology Co., Ltd., the pEX18Gm plasmid in E. coli was extracted, and then subjected to single enzyme digestion with BamHI Code No. 1010S (purchased from TaKaRa Biotechnology Co., Ltd, Dalian, China), and the system included 1 μL of BamHI, 2 μL of 10xK Buffer, 4 μL of pEX18Gm plasmid and 13 μL of ddH2O, and the reaction was performed at 30°C for 1 h.

[0063] (4) The pEX18Gm plasmid after single enzyme digestion was added with 1 μL of restriction enzyme EcoRI Code No. 1040S (purchased from TaKaRa Biotechnology Co., Ltd, Dalian, China) for double enzyme digestion, and the reaction was performed at 37°C for 1 h to obtain the linearized pEX18Gm plasmid. The agarose gel electrophoresis was performed to check whether the pEX18Gm plasmid was linearized.

[0064] (5) According to the instructions of ClonExpress II (DNA Seamless Cloning Kit), the linearized pEX18Gm plasmid and the linear DNA fragment in (2) purF -genta prepared the reaction system on ice (Table 3), and constructed the recombinant plasmid according to the instructions.

[0065] Table 3 Reaction system

[0066]

[0067] (6) The recombinant plasmid was transformed into E. coli DH5α by heat shock, and the transformants were screened on a gentamicin sulfate (10 μg / mL) LB agar plate. After the recombinant strain was recovered by shaking culture, 1 mL of bacterial solution was sent to Shengong Biotechnology (Shanghai) Co., Ltd. for one-way sequencing (the primer sequence used is shown in SEQ ID NO: 2), to identify whether the recombinant plasmid was successfully constructed, i.e., to screen the recombinant strain, which was named as pEX18Gm- purF .

[0068] (7) According to the instructions of EasyPure® Plasmid MiniPrep kit (EM101-02) of Zoonmer Biotechnology Co., Ltd., the recombinant plasmid pEX18Gm- purF, heat shock into E. coli S17-1 Pir (donor bacteria), and the transformants were screened by LB agar plates containing gentamicin sulfate (10 μg / mL). After the recombinant strain was recovered by shaking culture, 1 mL of the bacterial solution was sent to GenScript Biotech Corporation (Shanghai) Co., Ltd. for sequencing by single-directional sequencing (the primer sequence used is shown in SEQ ID NO: 2), to identify whether the recombinant plasmid entered the donor bacteria (i.e., the screening of the donor bacteria into which the recombinant plasmid was introduced). Figure 1

[0069] (8) The wild-type P. putida strain was used as the recipient bacteria and was mixed with the recipient bacteria in (7) by dilution and coating on the nitrocellulose membrane, and was incubated at 30°C for 24 h, to perform homologous exchange and obtain transformants (i.e., the screening of the second homologous transformation strain). Figure 1

[0070] (9) The transformants in (8) were transferred to LB liquid medium (containing gentamicin sulfate at a final concentration of 50 μg / mL + cefazolin at a final concentration of 50 μg / mL) and were incubated at 30°C at 220 rpm for 16 h, to screen the first homologous transformation strain.

[0071] (10) The first homologous transformation strain was transferred to LB liquid medium without antibiotics and was incubated for 12 h, and the bacterial solution was gradiently diluted to 10 -2 ~10 -4 , and was coated on LB agar (containing 10% sucrose) and was incubated for 15 h, to screen the second homologous transformation strain. The transformants and the wild-type P. putida strain were used as templates, and primers F: 5'- ATGTGTGGCATCGTCGGTATC-3' (SEQ ID NO: 2) and R: 5'- TCAGTTGTTGTAAAGGTCGATGATC -3' (SEQ ID NO: 3) were used to perform PCR identification, to determine whether the single colonies of the second homologous transformation were mutant strains. Further, the PCR products were sent to GenScript Biotech Corporation (Shanghai) Co., Ltd. for sequencing by single-directional sequencing (the primer sequence used is 5'- ATGAGCAATGTTGAACTGACCG-3' (SEQ ID NO: 8)), and the mutant strains with successful sequence identification were named P. putida knock-out strain. purF

[0072] P. putida purF The P. putida knock-out strain has been preserved in the China Center for Type Culture Collection, and the preservation name is Pseudomonas putida purF ​​​, and the deposit number is CCTCC NO: M 2025894, the deposit date is April 25, 2025, and the deposit address is Wuhan, China. Wuhan University.

[0073] Example 2

[0074] P. putida of Example 1 purF The knockout strain was subjected to strain growth curve test, and P. putida wild strain (hereinafter referred to as wild strain) was used as a control to investigate the growth of P. putida purF knockout strain (hereinafter referred to as purF knockout strain).

[0075] Determination of strain growth curve test: (1) The wild strain and purF knockout strain were inoculated in LB liquid medium (50 μL of bacterial solution + 5 mL of LB liquid medium) at a ratio of 1:100, and cultured at 28°C, 220 rpm overnight. (2) The concentration of bacterial solution was detected by microplate reader, and the concentration was adjusted to OD 600 =0.01 using LB liquid medium. (3) 10 μL of bacterial solution was taken to a 96-well plate, and 190 μL of fresh LB liquid medium was added, and six parallel samples were set for each group. (4) It was placed in a biochemical incubator at 28°C, and the OD 600 was measured every two hours until the growth reached a stable period.

[0076] The growth curve results of the wild strain and purF knockout strain are shown in Figure 2 A, purF The growth rate of the knockout strain was consistent with that of the wild strain, indicating that the knockout purF would not affect the growth of the wild strain, and could be used for subsequent biological phenotype experiments and bioinformatics analysis.

[0077] Further adaptation to iron deficiency experiment was carried out on purF knockout strain, and the experimental process was as follows:

[0078] (1) 50 μL of wild strain and purF knockout strain were inoculated on LB solid medium, and cultured at 28°C for 12 h to grow single colonies, and the single colonies were inoculated in 5 mL of LB liquid medium for expansion culture, and cultured at 28°C, 220 rpm overnight.

[0079] (2) Adjust the bacterial concentration to OD using antibiotic-free LB liquid medium. 600 Up to 0.1;

[0080] (3) Add iron chelating agent 2,2′-bipyridine to antibiotic-free LB medium to final concentrations of 0, 300, 600, 800 and 900 μmol / L;

[0081] (4) Combine wild strains and purF The knockout strains were inoculated into the above culture medium and cultured for 30 h. Growth curves of the bacteria at different chelate concentrations were plotted. The lowest chelate concentration that could completely inhibit bacterial growth was screened out.

[0082] Results of the adaptation to iron deficiency experiment, such as Figure 2 As shown, the addition of 900 μmol / L 2,2'-bipyridine limited the growth of the wild-type strain. After 16 h of culture, the OD of the wild-type strain was [missing value]. 600 =0.613) compared to purF Knockout strains (OD) 600 =0.871) The growth rate decreased significantly by 42.09%, indicating sensitivity to iron limitation. Furthermore, purF The knockout strains showed less growth inhibition under high iron restriction, especially at 900 μmol / L, where they still achieved a high OD. 600 Value, indicating purF The absence of genes gives purF Knockout strains exhibit a stronger survival advantage and greater ability to adapt to iron-deficient environments under iron-limited conditions.

[0083] Example 3

[0084] This embodiment is used for examination. purF The regulatory effect of knockout strains on riboflavin under iron-limited conditions (culture under different concentrations of 2,2'-bipyridine stress) is as follows:

[0085] Will purF Knockout strains and wild-type strains were cultured under different concentrations (0 and 800 μmol / L) of 2,2'-bipyridine stress, with the same culture conditions as the iron deficiency adaptation experiment in Example 2.

[0086] Riboflavin determination: Riboflavin emits fluorescence at a wavelength of 520 nm when excited by light at a wavelength of 450 nm under pH conditions of 4–9. Within the riboflavin concentration range of 0.1–10 μg, the fluorescence intensity is directly proportional to the riboflavin concentration. Sodium thiosulfate can eliminate the fluorescence of riboflavin.

[0087] Determination method: (1) Prepare 1.0 μg / mL standard riboflavin solution: accurately weigh 1.0 mg VB2, dissolve it in a small amount of 1% acetic acid (HAc), transfer it to a 1 L volumetric flask, dilute to the mark with 1% HAc, and shake well. The solution should be placed in a brown reagent bottle and stored in a cool place. (2) Sample solution: containing riboflavin 0.01-10 μg / mL. (3) Fluorescence quenching agent: weigh 0.2 g sodium thiosulfate into a 10 mL volumetric flask, dissolve with water to 10 mL. (4) Standard riboflavin fluorescence determination: take 1 mL of sample solution, add 0.1 mL of standard riboflavin solution, adjust to pH 5.0 with 0.1 mol / L hydrochloric acid, and measure the fluorescence intensity as A. (5) Sample fluorescence intensity determination: take 1 mL of sample solution in a test tube, respectively add 0.1 mL of distilled water and 0.1 mL of quenching agent solution. Adjust to pH 5.0 with 0.1 mol / L hydrochloric acid, and measure the fluorescence intensity of each in the fluorescence spectrophotometer. Add water to B, and add quenching agent to C.

[0088] Formula: Riboflavin concentration (μg / mL) = (B-C) / (A-B) x 0.1.

[0089] Determination of iron content: In an acidic medium, iron is dissociated from the complex, then reduced to divalent iron by a reducing agent, and forms a purple-red compound with ferrozine. This colored substance has a characteristic absorption peak at 562 nm, and the iron content is calculated accordingly. The specific determination method is according to the iron content (ferrozine colorimetric method) kit (ADS-W-D007) instruction.

[0090] The results are shown in Figure 3 The wild strain and purF The knockout strain can synthesize riboflavin in the absence of exogenous riboflavin medium. purF -800 (i.e. purF The highest riboflavin yield of the knockout strain cultured under 800 μmol / L 2,2'-dipyridyl stress was 0.09801±0.0084 μg / mL, which was significantly up-regulated by 307.19% compared with Wild type-800 (i.e. the wild strain cultured under 800 μmol / L 2,2'-dipyridyl stress). Figure 3 Further detection of bacterial iron content by iron content (ferrozine colorimetric method) kit (ADS-W-D007) found that after knocking out purF the gene of Pseudomonas putida, purFThe iron content of type -0 is significantly lower than that of Wild type-0, decreasing by 40.82%. Furthermore, compared to the iron content of Wild type-800, purF The iron content at -800 was significantly increased by 204.20%. Figure 3 (B) This and purF The trend of highest riboflavin production at -800 h is consistent with the trend.

[0091] Further analysis was performed using qRT-PCR to determine the wild-type strain ( gyrB (as an internal reference gene) and purF Iron synthesis-related genes in knockout strains were measured under 0 and 800 μmol / L 2,2'-bipyridine culture conditions. tonB , fumC ), key genes for riboflavin synthesis ( ribB , ribA ), and iron storage protein ( Bfr The relative expression levels of the target gene were determined. Specifically, the PCR reaction system consisted of a total volume of 25 μL, containing 2 μL of bacterial suspension, 1 μL of forward and reverse primers (10 mM), 8.5 μL of ddH2O, and 12.5 μL of EasyTaqMix enzyme. Primer sequences for iron-regulated target genes are shown in Table 6. The PCR amplification program was as follows: preheating at 95℃ for 5 min, denaturation at 94℃ for 35 cycles of 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 90 s, and a final extension at 72℃ for 10 min. Agarose gel electrophoresis analysis of the PCR products confirmed the primers' specificity to the strain and the generation of a single reaction product of the expected size. The qRT-PCR reaction system was prepared according to the instructions using the TransStartTopGreenqPCRSuperMix kit from Beijing TransGen Biotech Co., Ltd. (Table 4), and amplified using a real-time quantitative PCR instrument. The reaction program was set as follows (Table 5). -ΔΔCt The method calculates the relative expression level of the target gene.

[0092] Table 4 qRT-PCR reaction system

[0093]

[0094] Table 5 qRT-PCR reaction procedure

[0095]

[0096] Table 6 Primer sequences of target genes related to iron regulation in malodorous pseudomonocytes

[0097]

[0098] qRT-PCR results are shown in Figure 4 ribA As a key gene of riboflavin synthesis, compared with the wild strain, purF The knockout strain was significantly up-regulated by 141.41% (P < 0.05) in Figure 4 A) and 163.21% (P < 0.05) in B) compared with Wild type-800. purF The knockout strain was significantly up-regulated by 141.41% (P < 0.05) in Figure 4 B) compared with Wild type-800. purF In the knockout strain, purF Compared with Wild type-800, purF -0 was significantly up-regulated by 155.41%, indicating that the knockout of purF enhanced the expression of ribA genes to promote the production of riboflavin by the bacteria under iron deficiency. purF Compared with Wild type-800, purF The expression of fumC , fur and tonB of Wild type-800 was significantly up-regulated by 150.82, 2.76 and 10.78 times, respectively, indicating that the knockout strain significantly improved its survival ability under iron deficiency by up-regulating the expression of purF , fumC and fur genes (C). tonB Figure 4

[0099] Example 4

[0100] This example is used to investigate the in vitro adhesion ability of the knockout strain to grass carp mucus and the biofilm formation ability, and the specific experiment is as follows: purF

[0101] ​​​​Determination of the adhesion ability of strains in vitro: (1) Preparation of mucus: the body surface of healthy grass carp (purchased from Nanyou District Market of Zhanjiang City, Guangdong Province) was washed with 1x PBS buffer, and the mucus was gently scraped with a sterile glass slide and collected into a 2 mL centrifuge tube. After being placed at 4°C overnight for 20 h, it was centrifuged at 12000 rpm and 4°C for 25 min. The supernatant was filtered through a 0.45 μm sterile filter membrane and then through a 0.22 μm sterile filter membrane to remove bacteria. The protein concentration of the mucus was detected by a BCA protein concentration determination kit (P0012), and the protein concentration was adjusted to 1.2 mg / mL with 1x PBS buffer; (2) 20 μL of the mucus was evenly spread on a glass slide, dried for 12 h to prepare a slide, and then 200 μL of 4% methanol was added for fixation for 30 min; (3) After the methanol was completely volatilized, 200 μL of 4% methanol was added to the slide again for fixation for 30 min, and then 200 μL of 0.1% crystal violet solution was added for staining for 2 min; (4) The slide was washed with 1x PBS buffer until no color liquid flowed out, and then the slide was naturally air-dried; (5) The number of bacteria on the slide was observed under an optical microscope, and 10 fields of view were randomly selected for each slide to take photos and count, with three replicates for each strain. purF The bacterial suspension of the knockout strain or wild strain (prepared in the same way as in the determination of the biofilm formation ability of strains) (OD 600 = 0.3) was coated on the above slide, and incubated in a biochemical incubator at 28°C for 2 h; (4) The slide was washed with 1x PBS buffer for 3 times and then naturally air-dried; (5) The above slide was fixed with 200 μL of 4% methanol for 30 min, and then 200 μL of 0.1% crystal violet solution was added for staining for 2 min; (6) The slide was washed with 1x PBS buffer until no color liquid flowed out, and then the slide was naturally air-dried; (7) The number of bacteria on the slide was observed under an optical microscope, and 10 fields of view were randomly selected for each slide to take photos and count, with three replicates for each strain.

[0102] Determination of the biofilm formation ability of strains: (1) The wild strain and purF The knockout strain was inoculated in LB liquid medium, and activated at 28°C and 220 rpm; (2) After the concentration of the bacterial solution was measured by a microplate reader, the OD 600 was adjusted to 0.2 with LB liquid medium; (3) 100 μL of the bacterial suspension was placed in a 96-well cell culture plate, with six biological replicates for each strain, and incubated in a 28°C growth incubator for 24 h; (4) The bacterial solution in the well was aspirated, the cell culture plate was washed with 1x PBS buffer for 2-3 times, and then placed in a 65°C oven for drying; (5) 150 μL of 0.1% crystal violet was added for staining for 15 min; (6) The cell culture plate was washed with 1x PBS buffer for 2-3 times, and then naturally air-dried; (7) 200 μL of 33% acetic acid was added to dissolve the stained biofilm on the cell culture plate; (8) The OD 590 was detected by a microplate reader, with three replicates for each strain.

[0103] The biofilm formation ability of strains was determined by measuring purFThe knockout strain's ability to adhere to grass carp mucus in vitro was investigated, and the results were as follows: Figure 5 As shown, purF The knockout strain showed a 296.77% significantly higher in vitro adhesion of grass carp mucus (1.2 mg / mL) compared to the wild-type strain. Figure 5 (A) indicates purF The knockout strain exhibits good in vitro adhesion ability to grass carp mucus.

[0104] The results of the determination of the biofilm formation ability of the strain are as follows: Figure 5 According to the results of the B-group analysis, purF The biofilm formation ability of the knockout strain was significantly increased by 146.81% compared to the wild-type strain, indicating that... purF The knockout strains have a better ability to form a membrane.

[0105] Example 5

[0106] This embodiment was determined through artificial planting experiments. purF Safety and LD50 of the knockout strain in germ-free zebrafish 50 , explore purF The function of genes in the interaction between *Pseudomonas putida* and germ-free zebrafish was further revealed. purF The relationship between genes and host iron metabolism is as follows:

[0107] Establishment of a sterile zebrafish (GF) model: Zebrafish fertilized eggs were soaked in a freshly prepared 0.003% sodium hypochlorite disinfectant solution (0.03 g sodium hypochlorite and 999.97 g ddH2O). The fertilized eggs were then washed three times with sterile culture medium (3.5 g NaCl, 0.05 g KCl, 0.025 g NaHCO3 and 0.1 g CaCl2, ddH2O to a 1 L volumetric flask). After soaking in 0.05% PVP-I solution (25 mL 0.1% PVP-I, 25 mL PBS buffer) for 1 min, the eggs were washed three more times with sterile culture medium. Next, the eggs were soaked in 0.003% sodium hypochlorite disinfectant solution for 10 min, and then washed three more times with sterile culture medium. Finally, the eggs were transferred to sterile culture medium for incubation. The fertilized eggs were placed in a clean bench at 28℃ and incubated under a cycle of 14 h light followed by 10 h darkness. After hatching, the eggshells were promptly removed (the eggshells floated on the water surface and were removed using a sterile pipette). The sterile culture medium was changed every two days to establish a sterile zebrafish model. Animal experiments were conducted in strict accordance with the "Guidelines for Laboratory Animal Care and Use" and the national standard GB / T 14926.41-2001 "Methods for Detection of Living Environment and Fecal Specimens of Sterile Animals".

[0108] Animal grouping and colonization methods: Wild-type strains of *Pseudomonas putida* and *Pseudomonas putida* purF The knockout strain was inoculated into LB liquid medium and cultured at 28°C and 220 rpm for 24 h. Afterwards, (the culture process was the same as in Example 2), the culture was centrifuged at 7500 rpm for 10 min, and the culture supernatant was removed. The bacterial pellet was washed three times with 1×PBS, and sterile culture medium was added at 1×10⁻⁶ ppm. 6 The final concentration of CFU / mL was transferred to a sterile zebrafish model. Each group consisted of 30 fish, with the control group colonized with an equal volume of ddH2O. The sampling time was 48 h.

[0109] The qRT-PCR method was used to detect iron-related genes such as iron-dependent enzymes in the host (zebrafish). aco1 ), iron reactive element binding protein ( ireb2 Iron metabolism enzymes assist transferrin in transporting Fe. 3+ ( Cp ), activation of transcription factors ( atf4a ), encoding hepcidin protein 1a ( fth1a Metal ion transporters ( DMT1 ), transferrin receptor ( tfr1a ) and hypoxia-inducible factor-1α subtype ( hif1ab The expression of ) and the selection of internal reference genes. β-actin The determination method is the same as in Example 3, and the primer sequences used are shown in Table 7.

[0110] Table 7 Primer sequences of iron-related genes in zebrafish

[0111]

[0112] Pseudomonas putida purF Safety experiments and LD50 results of zebrafish larvae infected with knockout strains after normal hatching showed that 1×10⁻⁶ oz. 5 1×10 6 and 1×10 7 The survival rate in the CFU / mL group was 100%, revealing purF The knockout strain is a non-pathogenic strain. Figure 6 (A). Furthermore, through wild-type and *Pseudomonas putida* strains... purF The experimental results of aseptically treated zebrafish embryos implanted with knockout strains and hatched larvae showed that the survival rate of all experimental groups remained at 100%, and the survival curves were not statistically different from those of the control group. P >0.05)( Figure 6 ), indicating wild plants and purF Knockout plants at 1×10 6 At a dose of CFU / mL, no acute toxicity was observed in sterile zebrafish hosts.

[0113] Further comparison was made between artificially colonized wild-type strains of *Pseudomonas putida* and... purF The effects of the knockout strain on iron balance regulation-related genes in germ-free zebrafish were investigated, revealing that compared to the wild-type strain, purF Among the zebrafish that were knocked out and established, ireb2 , Cp , atf4a , fth1a , DMT1 , tfr1a and hif1ab All were significantly upregulated, with fold increases of 8.99, 6.35, 1.86, 1.23, 1.45, 1.55, and 1.53, respectively; while iron-dependent enzymes ( aco1 The adjustment was significantly reduced, by a factor of 0.33. Figure 7 ).also, purF The tissue iron content of zebrafish colonized from the knockout strain was 8.27 ± 0.36 μg / g, which was significantly increased by 30.85% compared to the wild-type strain. This indicates that the iron content constructed in this invention... purF The knockout strain significantly affected the expression of iron-related genes in the host compared to the wild-type strain, thereby regulating the increase of iron content in host tissues.

[0114] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. Knocking out purF Use of the gene in any one of (1) to (3): (1) Improving the ability of Pseudomonas putida to synthesize riboflavin under iron deficiency conditions; (2) Improving the biofilm formation ability of Pseudomonas putida; (3) Improving the adhesion of Pseudomonas putida to grass carp mucus; The purF The nucleotide sequence of the gene is shown as SEQ ID NO:

1.

2. A Pseudomonas putida purF knockout strain, said Pseudomonas putida purF does not contain in its genome purF a gene, said purF the nucleotide sequence of said gene is set forth in SEQ ID NO:

1.

3. The P. putida of claim 2 purF Knockout strains characterized in that, the malodor pseudomonas purF The accession number of the knock-out strain is CCTCC NO: M 2025894.

4. A microbial preparation comprising the P. putida of claim 2 or 3 purF Knockout strains.

5. The P. putida of claim 2 or 3 purF Use of the knockout strain or the microbial preparation of claim 4 in the manufacture of a preparation for increasing the iron content of zebrafish tissue.

Citation Information

Patent Citations

  • Pseudomonas putida and application thereof as fish probiotics

    CN120536323A