Annular RNA molecular marker related to diagnosis of esophageal squamous carcinoma and application thereof

Abstract

The invention discloses a circular RNA molecular marker related to esophageal squamous cell carcinoma diagnosis and application thereof, by constructing a circular RNA expression profile related to an esophageal squamous cell carcinoma patient, the circular RNA molecular marker hsacirc0008389 and the correlation between the expression level of the circular RNA molecular marker hsacirc0008389 and esophageal squamous cell carcinoma are found, compared with healthy human plasma, the expression of the hsacirc0008389 in the plasma of the esophageal squamous cell carcinoma patient is remarkably increased, and the expression level of the hsacirc0008389 in the plasma of the esophageal squamous cell carcinoma patient is remarkably increased. By means of cytology function research, it is found that interference hsacirc0008389 can inhibit proliferation of esophageal squamous cell carcinoma cells, it is indicated that the interference hsacirc0008389 has an important adjusting effect in the development process of esophageal squamous cell carcinoma, and the effect of hsacirc0008389 in auxiliary diagnosis of esophageal squamous cell carcinoma is revealed.

Description

Technical Field

[0001] The present invention relates to the field of biomedical testing technology, and in particular to a circular RNA molecular marker related to the diagnosis of esophageal squamous cell carcinoma and an application thereof. Background Art

[0002] Esophageal cancer is one of the most common malignant tumors in the world. There are 600,000 new cases each year, making it the eighth most common malignant tumor in the world. There are more than 400,000 deaths from esophageal cancer, and the mortality rate ranks sixth among all types of malignant tumors.

[0003] Esophageal cancer is histologically divided into squamous cell carcinoma and adenocarcinoma. In my country, 90% of esophageal cancer cases are esophageal squamous cell carcinoma (ESCC). Traditional treatments for ESCC include surgery, radiotherapy, and chemotherapy, with an overall five-year survival rate of 15%-20%. First-line chemotherapy has an objective response rate of 30%-50%, a median progression-free survival (PFS) of 4-6 months, and a median overall survival (OS) of 9-12 months. Second-line chemotherapy has an objective response rate of 6%-34%, a median progression-free survival (PFS) of 2-4.5 months, and a median overall survival (OS) of 5-8.1 months. Numerous Phase III clinical trials of molecularly targeted therapies for ESCC have failed. Despite the rise of immunotherapy, challenges remain, such as an unclear treatment course, a lack of biomarkers for evaluating efficacy, and a high incidence of side effects.

[0004] At present, there is a relative lack of research on biomarkers for the early diagnosis of esophageal squamous cell carcinoma. Traditional diagnostic methods such as endoscopy and imaging examinations have certain limitations and cannot meet the needs of early, non-invasive and accurate diagnosis. Summary of the Invention

[0005] The purpose of this application is to provide a circular RNA molecular marker hsa_circ_0008389 and its use in the diagnosis and prognosis evaluation of esophageal squamous cell carcinoma.

[0006] The first aspect of the present invention provides a circular RNA molecular marker for the diagnosis of esophageal squamous cell carcinoma, wherein the circular RNA molecular marker is hsa_circ_0008389, and the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1.

[0007] The sequence of SEQ ID No. 1 is: GCCTCTTCTGAAGAGCTGAAAGCTGCCTACCGGAGGCTCTGTATGCTCTACCATCCAGACAAGCACAGAGACCCAGAGCTCAAGTCACAGGCGGAACGACTGTTTAACCTTGTTCACCAGGCTTATGAAGTGCTTAGTGACCCCCAAACCAGGGC CATCTATGATATATATGGGAAGAGAGGACTGGAAATGGAAGGATGGGAGGTTGTGGAAAGGAGGAGAACCCCTGCTGAAATTCGAGAGGAGTTTGAGCGGCTGCAGAGAGAGAGAAGAGAGGAGATTGCAGCAGCGAACCAATCCCAAG (SEQ ID No.1).

[0008] The second aspect of the present invention: The present invention also provides a primer set for the circular molecule marker hsa_circ_0008389, wherein the primer set comprises a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO. 2: ACCAATCCCAAGGCCTCTTC; The nucleotide sequence of the reverse primer is shown in SEQ ID NO. 3: GGTTTGGGGGTCACTAAGCA.

[0009] Specifically, the forward primer and reverse primer of the internal reference GAPDH are also included: Internal reference GAPDH Primer F: GGAGCGAGATCCCTCCAAAAT; Internal reference GAPDH Primer R: GGCTGTTGTCATACTTCTCATGG.

[0010] The primer set consisting of the above-mentioned forward primer and reverse primer can be used to detect the expression level of the circular molecular marker hsa_circ_0008389, thereby providing a basis for the diagnosis of esophageal squamous cell carcinoma.

[0011] The third aspect of the present invention: also proposes the use of a circular RNA molecular marker hsa_circ_0008389 in the preparation of a product for the diagnosis of esophageal squamous cell carcinoma.

[0012] In a third aspect, the present invention provides a method for detecting the circular RNA molecular marker and its use in preparing a product for diagnosing esophageal squamous cell carcinoma.

[0013] Furthermore, in a preferred embodiment of the present invention, the reagent is selected from: a probe, a gene chip or a detection primer set that has detection specificity for the circular RNA molecular marker.

[0014] Preferably, the detection primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 3.

[0015] Furthermore, in a preferred embodiment of the present invention, the reagents also include RNA extraction reagents, reverse transcription reaction systems and fluorescent quantitative PCR reagents.

[0016] Furthermore, in a preferred embodiment of the present invention, the reagent includes a chip, a kit or a nucleic acid membrane strip.

[0017] The fourth aspect of the present invention: The present invention provides a kit for diagnosing or preventing esophageal squamous cell carcinoma, the kit comprising a specific primer set for the circular RNA molecular marker; Preferably, the primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 3.

[0018] Compared with the prior art, the present invention has the following advantages: (1) The present invention constructed a circular RNA expression profile related to esophageal squamous cell carcinoma patients and discovered the correlation between the circular RNA molecular marker hsa_circ_0008389 and its expression level and esophageal squamous cell carcinoma. Compared with the plasma of healthy people, the expression of hsa_circ_0008389 in the plasma of esophageal squamous cell carcinoma patients was significantly increased. Through cytological function studies, it was found that interfering with hsa_circ_0008389 can inhibit the proliferation of esophageal squamous cell carcinoma cells, indicating that it plays an important regulatory role in the development of esophageal squamous cell carcinoma.

[0019] (2) This invention reveals the role of hsa_circ_0008389 in the auxiliary diagnosis of esophageal squamous cell carcinoma. The efficient and specific PCR reaction can reduce the cost of diagnostic testing, making it easier to be widely used in clinical practice and providing support for the clinical prevention of esophageal squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Figure 4 is the expression profile of circRNAs in patients with esophageal squamous cell carcinoma and healthy controls. Figure 1 A in the figure shows some circRNAs expressed in the experimental group of esophageal squamous cell carcinoma patients and the healthy control group by hierarchical clustering. Figure 1B in the figure shows that the chromosomal distribution of differentially expressed circRNAs shows that most of them are from chr1, chr2, chr3, chr4, chr5, chr6, chr7, and chrX. Figure 1 Figure C is a volcano plot - CircRNAs showing the difference in circRNA expression between the experimental group and the control group of esophageal squamous cell carcinoma patients.

[0021] Figure 2 This is a structural diagram of the circular molecular marker hsa_circ_0008389 in the examples of this application.

[0022] Figure 3 Schematic diagram of the expression level of hsa_circ_0008389 in the plasma of esophageal squamous cell carcinoma patients and healthy subjects in the examples of this application.

[0023] Figure 4 This is a graph showing the qRT-PCR amplification curve analysis results of hsa_circ_0008389 in the examples of this application.

[0024] Figure 5 This is a graph showing the qRT-PCR melting curve analysis results of hsa_circ_0008389 in the examples of this application.

[0025] Figure 6 This is the ROC curve diagram of hsa_circ_0008389 in the examples of this application.

[0026] Figure 7 This is a graphic representation of the CCK8 experimental detection results in the examples of this application. Figure 7 A in the figure represents the effect of interfering with hsa_circ_0008389 on ECA109 cells. Figure 7 B in Figure 3 shows the effect of overexpression of hsa_circ_0008389 on ECA109 cells. Figure 7 C in the figure represents the effect of interfering with hsa_circ_0008389 on TE12 cells. Figure 7 D in the figure shows the effect of overexpression of hsa_circ_0008389 on TE12 cells. DETAILED DESCRIPTION

[0027] Below, the present application is further described in conjunction with specific implementation methods. It should be noted that, under the premise of no conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.

[0028] The techniques involved in this invention are conventional molecular cloning techniques. Unless otherwise specified, the enzymes, primers, reagents, and reaction conditions involved can be reasonably selected based on the experience of those skilled in the art. The reagents and consumables involved are commercially available products, and the detection methods and instruments involved are well known and mastered by those skilled in the art. Unless otherwise noted, the experimental methods in the examples adopt existing experimental methods and procedures and are performed strictly in accordance with the kit manufacturer's instructions.

[0029] Example 1 Acquisition of clinical samples of esophageal squamous cell carcinoma marker hsa_circ_0008389 Between March and October 2021, 31 patients with ESCC and 35 healthy controls were recruited from Li Huili Hospital Affiliated to Ningbo University. Plasma samples were collected from 31 patients with ESCC and 35 healthy controls. Recruitment criteria were as follows: Cohort A included patients with histologically confirmed ESCC (aged ≥19 years) who had not previously received tumor treatments such as radiotherapy, chemotherapy, or targeted therapy. Cohort B consisted of patients with untreated non-malignant esophageal diseases. Exclusion criteria included: (i) other malignancies; (ii) previous treatment with radiotherapy, chemotherapy, or biological therapy; and (iii) severe comorbidities. This study adhered to the ethical standards and operating procedures approved by the Ethics Review Committee of Li Huili Hospital, and written informed consent was obtained from all participants.

[0030] Example 2 Screening of esophageal squamous cell carcinoma marker hsa_circ_0008389 In this study, we used gene chip analysis technology to detect the circular RNA expression profiles of three patients with esophageal squamous cell carcinoma and three healthy controls.

[0031] like Figure 1 A hierarchical clustering in Figure 3 indicates that the ESCC patient experimental group (T) and the healthy control group (C) have significantly different circular RNA expression profiles.

[0032] like Figure 1 The chromosomal distribution of differentially expressed circRNAs in the experimental group (T) of esophageal cancer patients and the healthy control group (C) in Figure B shows that most of them are from chr1, chr2, chr3, chr4, chr5, chr6, chr7, and chrX. Among them, 1012 differentially expressed circular RNAs were screened out in the experimental group and the control group, with significant upregulation (up) and significant downregulation (down).

[0033] like Figure 1 The C esophageal cancer patient experimental group (T) and the healthy control group (C) were further screened for significantly different circular RNAs based on the strict criteria of log2-fold change > 2 and P < 0.05.

[0034] Specifically, this study identified a total of 11,381 circular RNAs (circRNAs). After strict screening criteria (log2-foldchange > 2 and P < 0.05), 1,012 of these showed significant differential expression between the esophageal squamous cell carcinoma experimental group (T) and the healthy control group (C). Among these 1,012 significantly differentially expressed molecules, hsa_circ_0008389 was selected as a core candidate molecule due to its extremely high expression in the experimental group (log2-foldchange value significantly higher than other differentially expressed molecules).

[0035] The following table is a screening table for esophageal cancer-related circular RNA markers: including 10 circRNAs with significant expression differences, including hsa_circ_0008389.

[0036]

[0037] *P < 0.01, FC = fold change Based on the above screening results, hsa_circ_0008389 was selected as the subsequent validation object for preventive diagnostic analysis of patients with esophageal squamous cell carcinoma.

[0038] Example 3 Verification of circular RNA molecular marker hsa_circ_0008389.

[0039] 1. Extraction of total RNA from plasma samples (Trizol method) (1) After taking out the plasma sample from the -80℃ freezer, place it at room temperature to thaw.

[0040] (2) Transfer 300 µL of plasma to a 2 mL RNase-free EP tube, add 900 µL of Trizol LS reagent, vortex to mix, and then place at room temperature for 5 min.

[0041] (3) Centrifuge at 12,000 rpm and 4°C for 10 min. After centrifugation, the liquid will separate into layers. The lower layer is a viscous, darker impurity, and the upper layer is a homogenized pink liquid. Transfer the upper layer (approximately 1 mL) to a 1.5 mL RNase-free EP tube.

[0042] (4) Add 200 μL of chloroform (chloroform: isoamyl alcohol = 24:2), shake the solution manually to mix it evenly, and let it stand at room temperature for 3 minutes. Then centrifuge it at 12,000 rpm and 4°C for 15 minutes. It should be understood that the addition of isoamyl alcohol can effectively eliminate the appearance of bubbles, and chloroform can reduce the interference of lipids on the experimental results. In addition, since the Trizol LS reagent is acidic, after adding chloroform, it is necessary to prevent emulsification caused by violent shaking. Therefore, manual shaking is adopted to mix the solution evenly and prevent the decrease in RNA yield due to emulsification.

[0043] (5) Use a pipette to carefully transfer 400 µL to 600 µL of the upper aqueous phase to another labeled RNase-free EP tube. Then add an equal volume of isopropanol to the aqueous phase, shake it gently or blow it evenly with a pipette, and finally let it stand at 4°C (on ice or in a refrigerated centrifuge) for 15 min.

[0044] (6) Centrifuge at 12,000 rpm and 4°C for 10 min. A white precipitate will be found at the bottom of the EP tube. Discard the supernatant and add 1 mL of pre-cooled 75% ethanol solution to wash the precipitate (turn the EP tube upside down to make the precipitate float).

[0045] (7) Centrifuge at 8000 rpm and 4°C for 5 min. Pour off the supernatant and then use a pipette to remove the remaining liquid at the bottom of the EP tube (be careful not to remove the white precipitate). Place at room temperature for about 15 min to allow the ethanol to evaporate and dry.

[0046] (8) Add 15 µL of RNase-free water and gently mix with a pipette to completely dissolve the precipitate. Place on ice until ready for use.

[0047] 2. Extraction of Total RNA from Pathological Tissue Plasma (1) Take the esophageal tissue out of the -80°C ultra-low temperature freezer, take an appropriate amount (about 100 mg) of tissue, cut it into small pieces, and grind it in a mortar with liquid nitrogen. Pour the ground tissue into a 1.5 ml RNase-free EP tube, add 1 ml TRIzol and mix well.

[0048] (2) Let the TRIzol-added tissue sample suspension stand at room temperature for 5 minutes to allow the nucleic acid and protein complexes to effectively and completely dissociate.

[0049] (3) Add 200 μl of chloroform, mix thoroughly for 15 seconds, and let stand at room temperature for 3 minutes.

[0050] (4) Centrifuge at 12,000 rpm for 15 minutes at 4°C. Gently remove the EP tube from the centrifuge. The mixture will separate into three layers: a red organic phase at the bottom, a protein film in the middle, and a colorless aqueous phase at the top. RNA is in the colorless aqueous phase at the top, which has a volume of approximately 600 μl.

[0051] (5) Use a pipette to carefully transfer the aqueous phase to a new EP tube, taking care to avoid sucking up the protein film layer. Add 1.5 ml of anhydrous ethanol and invert the EP tube upside down to mix thoroughly.

[0052] (6) Remove the centrifuge column from the kit and place it in a 2 ml collection tube. Transfer the mixture to the centrifuge column and centrifuge at 13,000 rpm for 15 seconds. Discard the waste liquid. If the mixture cannot be added in one go, add it in batches and repeat this step.

[0053] (7) Add 700 μl of RWT in the kit to the centrifuge column, centrifuge at 13,000 rpm for 15 seconds, and discard the waste liquid.

[0054] (8) Add 500 μl of RPE from the kit to the centrifuge column, as in step 7.

[0055] (9) Add 500 μl of RPE from the kit again and centrifuge for 2 minutes as in step 7.

[0056] (10) Remove the centrifuge column and place it in a new 2 ml collection tube. Continue centrifugation for 1 minute to remove the residual liquid on the centrifuge column.

[0057] (11) Remove the centrifuge column and place it in a 1.5 ml collection tube. Add 20 μl of RNase-free water to the center of the centrifuge column filter membrane and centrifuge at 13,000 rpm for 1 minute to fully dissolve the RNA.

[0058] (12) Determine the RNA concentration and purity and store at -80°C for use in the next experiment.

[0059] 3. Quantification of Total RNA (1) Take 1µL of the extracted RNA solution and measure the purity and concentration of the total RNA using a UV spectrophotometer. The purity requirement is that the OD260 / OD280 ratio in the sample should be between 1.8 and 2.1.

[0060] (2) The concentration of total RNA in plasma can generally be used directly without dilution.

[0061] 4. Reverse transcription of RNA into cDNA The reverse transcription experimental steps, reaction system (Table 1), and reaction conditions (Table 2) were all from the reverse transcription kit instructions. The RNA sample volume was calculated based on a 2 μg transcript mass.

[0062] Add the reaction system according to Table 1, and then carry out the reaction on the machine according to the reaction conditions in Table 2.

[0063] The reverse transcription reaction system is shown in Table 1 below.

[0064] The reverse transcription reaction conditions are shown in Table 2 below.

[0065] After the reaction is completed, add 80 μL of RNase-free water to each sample, mix thoroughly with a pipette, and store in a -20°C refrigerator. If not used for a long time, store in a -80°C ultra-low temperature refrigerator.

[0066] 3. Design reverse PCR primers to amplify the interface and flanking sequences of the circular RNA molecular marker hsa_circ_0008389 and verify by DNA sequencing. Based on some reference sequences provided in the Circbase database, reverse PCR primers were designed to identify the interface and flanking sequences of hsa_circ_0008389. The primer sequences are as follows:

[0067] like Figure 2 As shown, the back-splicing junction site of the circular RNA marker hsa_circ_0008389 provided by the present invention. The circular RNA marker hsa_circ_0008389 forms a closed circular structure through back-splicing. hsa_circ_0008389 is located in gene chr1 (hsa_circ_0008389 consists of three exons 2, 3, and 4, with a total length of 306 nt).

[0068] The full length of hsa_circ_0008389 is 306 bases, and the full-length sequence is: GCCTCTTCTGAAGAGCTGAAAGCTGCCTACCGGAGGCTCTGTATGCTCTACCATCCAGACAAGCACAGAGACCCAGAGCTCAAGTCACAGGCGGAACGACTGTTTAACCTTGTTCACCAGGCTTATGAAGTGCTTAGTGACCCCCAAACCAGGGC CATCTATGATATATATGGGAAGAGAGGACTGGAAATGGAAGGATGGGAGGTTGTGGAAAGGAGGAGAACCCCTGCTGAAATTCGAGAGGAGTTTGAGCGGCTGCAGAGAGAGAGAAGAGAGGAGATTGCAGCAGCGAACCAATCCCAAG (SEQ ID NO.1) Example 4 1. qRT-PCR was used to detect the expression level of hsa_circ_0008389 in the plasma of esophageal squamous cell carcinoma patients and healthy controls.

[0069] Total RNA was extracted according to the method described in Example 3, and the residual genomic DNA in the extracted RNA was removed with DNase, and the RNA was reverse transcribed into cDNA; finally, qRT-PCR amplification was used for detection, and the primer sequences of qRT-PCR are shown in SEQ ID NO. 2-5.

[0070] The qRT-PCR reaction system (Table 3), experimental procedures, and reaction conditions (Table 4) were based on the qRT-PCR kit's instruction manual. Primers were synthesized by BGI (Shenzhen) and Sangon Biotech (Shanghai) Co., Ltd.

[0071] First, add sample according to the reaction system in Table 3.

[0072] Table 3 below shows the reaction system for qRT-PCR detection of hsa_circ_0008389

[0073] After adding the sample, perform qRT-PCR reactions on an Mx3005P fluorescence quantitative PCR instrument and an AppliedBiosystems™ QuantStudio™ 3 real-time quantitative PCR instrument according to the reaction conditions in Table 4.

[0074] The following Table 4 shows the qRT-PCR reaction conditions.

[0075] Quantitative analysis after PCR amplification: Expression level: The quantification cycle (Cq; also known as the threshold cycle (Ct)) refers to the number of cycles the reaction undergoes when the cumulative fluorescence signal intensity of each reaction reaches the threshold specified by the instrument. It can reflect the amount of cDNA involved in the reaction.

[0076] In this example, Cq is used to represent the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference, and the ΔCq value is used to relatively quantify the expression level of the target gene. ΔCq = Cq (target gene) - Cq (RNU6-2). The larger the ΔCq value, the more cycles of target gene amplification when a specific fluorescence threshold is reached, which means the expression level is lower. When calculating the relative expression level of the target gene, 2 -ΔCP and 2 -ΔΔCP The specific calculation method is: ΔΔCq = ΔCq (target gene) - ΔCq (GAPDH), 2 -ΔCP and 2 -ΔΔCP It directly reflects the relative difference in the expression level of the target gene. -ΔCP and 2 -ΔΔCP The larger the value, the higher the expression level of the target gene, and vice versa.

[0077] 2. Use the ROC curve to evaluate the diagnostic value of hsa_circ_0008389 in the plasma of patients with esophageal squamous cell carcinoma.

[0078] GraphPad Prism 8.0.2 software was used to analyze qRT-PCR results using receiver operating characteristic (ROC) curve analysis. The Wilson / Brown statistical method was used to calculate the area under the curve (AUC) and determine the optimal cutoff value.

[0079] 3. Results qRT-PCR was used to detect the expression level of hsa_circ_0008389 in the plasma of 31 esophageal squamous cell carcinoma patients and 35 healthy subjects. Figure 3 and Figure 4 shown.

[0080] Depend on Figure 3 It can be seen that the expression levels of hsa_circ_0008389 in the plasma of 35 healthy controls (N=35) and 31 esophageal squamous cell carcinoma patients (N=31) were compared. The expression level of hsa_circ_0008389 in the plasma of the esophageal squamous cell carcinoma patients in the experimental group was significantly increased compared with the expression level of healthy people.

[0081] Depend on Figure 4 It can be seen that after about 20-30 cycles of the amplification curve, the fluorescence signal entered the plateau phase, indicating that the PCR reaction was close to saturation, showing good amplification efficiency and repeatability, indicating that hsa_circ_0008389 can be used as a diagnostic marker for esophageal squamous cell carcinoma and can effectively detect esophageal squamous cell carcinoma-related circular RNA from clinical samples.

[0082] Depend on Figure 5 As can be seen, the melting curves show a distinct melting peak within the same temperature range for the two replicates, indicating good specificity of the PCR product. Efficient and specific PCR reactions can reduce the cost of diagnostic tests and make them more widely applicable in clinical practice.

[0083] Depend on Figure 6 It can be seen that the AUC of esophageal squamous cell carcinoma is 0.7221, indicating that the circular RNA molecular marker hsa_circ_0008389 can be used as a tumor diagnostic marker, indicating that hsa_circ_0008389 is significantly increased in the serum of esophageal squamous cell carcinoma and can well predict the occurrence of tumors.

[0084] The real-time quantitative polymerase chain reaction (qRT-PCR) detection method of the present invention can ideally detect the expression of the circular RNA molecular marker hsa_circ_0008389 in an organism.

[0085] Example 5 CCK8 assay was used to detect the effect of hsa_circ_0008389 on cell proliferation.

[0086] 1. Cell Culture ECA109 and TE12 cells were cultured in RPMI-1640 medium (Gibco, America) supplemented with 10% fetal bovine serum (FBS; Gibco, America) and an appropriate amount of penicillin and streptomycin (100 U / mL streptomycin-penicillin; Hyclone, America) in a 37°C, 5% CO2 incubator. Experimental groups were transfected with hsa_circ_0008389 overexpression plasmids or siRNA, while controls were transfected with the corresponding empty vector or negative control siRNA.

[0087] 2. CCK8 assay to detect cell proliferation Cells in the logarithmic growth phase were seeded into 96-well culture plates at 5,000 cells per well. After the cells attached, they were cultured for different time points (e.g., 24 hours, 48 ​​hours, 72 hours, etc.). At each time point, the original culture medium was removed and the cells were rinsed three times with 10% PBS.

[0088] Add 10 μL of CCK8 reagent to each well (be careful not to create bubbles in the wells, as they will affect the A value reading), and then add 200 μL of the corresponding culture medium to mix the CCK8 reagent and culture medium evenly.

[0089] The culture plate was returned to a 37°C, 5% CO2 incubator and incubated for 2 h to allow the CCK8 reagent to react with the cells.

[0090] The absorbance (A value) of each well was measured at a wavelength of 450 nm using an enzyme-linked immunosorbent assay (ELISA). Multiple replicate wells were set up for each experimental group and control group to ensure the reliability of the data.

[0091] 3. Data Processing and Analysis Absorbance (A) was used to represent cell proliferation, and growth curves were drawn to analyze the effect of hsa_circ_0008389 on cell proliferation. Data are presented as mean ± standard deviation (x ± s). One-way ANOVA was performed using GraphPad. P < 0.05 was considered statistically significant.

[0092] IV. Results 1. hsa_circ_0008389 promotes the proliferation of esophageal squamous cell carcinoma cells.

[0093] like Figure 7 Effects of hsa_circ_0008389 interference and overexpression on cell proliferation in ECA109 and TE12 cells (CCK8 assay), such as Figure 7 In Figure A, as time went on, the proliferation number of ECA109 cells in the interference experimental group (si-circ_0008389) was significantly reduced compared with that in the negative control group. Specifically, at 96 h, the cell density of the red line (si-circ_0008389) was significantly lower than that of the blue line (negative control). Figure 7 In Figure B, the proliferation of ECA109 cells in the overexpression experimental group (circ_0008389) increased significantly over time compared to the empty vector control group. Specifically, at 96 hours, the cell density of the red line (circ_0008389) was significantly higher than that of the blue line (empty vector). Figure 7In Figure C, the proliferation of TE12 cells in the interference experimental group (si-circ_0008389) was significantly reduced compared to the negative control group. Specifically, at 96 hours, the cell density of the red line (si-circ_0008389) was significantly lower than that of the blue line (negative control). Figure 7 In Figure D, the proliferation number of TE12 cells in the overexpression experimental group (circ_0008389) was significantly increased compared with that in the empty vector control group. Specifically, at 96 h, the cell density of the red line (circ_0008389) was significantly higher than that of the blue line (empty vector).

[0094] The results showed that after siRNA interference with hsa_circ_0008389, the proliferation ability of esophageal squamous cell carcinoma cells (ECA109 / TE12) was significantly decreased, while overexpression of hsa_circ_0008389 promoted a significant increase in the proliferation ability of esophageal squamous cell carcinoma cells (ECA109 / TE12).

[0095] In summary, this application, by constructing a circular RNA expression profile associated with esophageal squamous cell carcinoma patients, discovered the circular RNA molecular marker hsa_circ_0008389 and its correlation with esophageal squamous cell carcinoma. Compared with the plasma of healthy subjects, the expression of hsa_circ_0008389 was significantly increased in the plasma of esophageal squamous cell carcinoma patients. Through cytological functional studies, it was found that interfering with hsa_circ_0008389 can inhibit the proliferation of esophageal squamous cell carcinoma cells, indicating that it plays an important regulatory role in the development of esophageal squamous cell carcinoma. The present invention reveals the carcinogenicity of hsa_circ_0008389 and provides a new diagnostic approach of "inhibition rather than supplementation". Compared with the existing technology that esophageal cancer requires overexpression of tumor suppressor genes to be effective, this application proves its carcinogenicity through siRNA interference experiments. After knockdown, the proliferation ability of cancer cells is significantly inhibited, and the diagnostic logic is more direct and efficient. In addition, compared with the existing technology that relies on tissue biopsy (invasive operation), the present application only requires blood drawing for detection, which is more convenient and reproducible.

[0096] The above describes the basic principles, main features, and advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above-described embodiments. The above-described embodiments and the specification merely illustrate the principles of the present application. Various changes and improvements may be made to the present application without departing from the spirit and scope of the present application. These changes and improvements fall within the scope of the present application for which protection is sought. The scope of protection claimed by the present application is defined by the appended claims and their equivalents.

Claims

1. A circular RNA molecular marker for the diagnosis of esophageal squamous cell carcinoma, characterized in that: The nucleotide sequence of the circular RNA molecular marker is hsa_circ_0008389 shown in SEQ ID No.

1.

2. A primer set for a circular RNA molecular marker according to claim 1, characterized in that: The primer set includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO. 2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

3. Use of the circular RNA molecular marker according to claim 1 in the preparation of a diagnostic product for esophageal squamous cell carcinoma.

4. Use of a reagent for detecting the circular RNA molecular marker according to claim 1 in the preparation of a product for diagnosing esophageal squamous cell carcinoma.

5. The use according to claim 4, characterized in that The reagent is selected from: a probe, a gene chip or a detection primer set that has detection specificity for the circular RNA molecular marker; The detection primer set includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

6. The use according to claim 5, characterized in that The reagents also include RNA extraction reagents, reverse transcription reaction systems and fluorescent quantitative PCR reagents.

7. The use according to claim 4, characterized in that The reagents include chips, test kits or nucleic acid membrane strips.

8. A kit for diagnosing or preventing esophageal squamous cell carcinoma, characterized in that: The kit includes a specific primer set for the circular RNA molecular marker described in claim 1; The primer set includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 3.

Images