A SNP marker affecting AMP levels in pigs and its application
By identifying SNP markers related to AMP content in pig muscle through GWAS and using CRISPR/Cas9 editing technology, the problem of low AMP content in pork in existing technologies has been solved, enabling rapid and accurate improvement of pig genetics and optimizing meat quality and flavor.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-18
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies are insufficient to quickly and effectively increase the adenosine monophosphate (AMP) content in pork, thus affecting the improvement of meat flavor and health traits.
Fourteen SNP markers significantly associated with AMP content in pig muscle were identified through genome-wide association analysis (GWAS). Using molecular marker-assisted breeding (MAS) technology, pig SNP genotypes were selected and optimized. CRISPR/Cas9 gene editing technology was used for site-directed mutagenesis to increase the frequency of dominant alleles generation by generation.
It has enabled the rapid and accurate increase of AMP content and meat quality traits in pigs, improved the progress of genetic improvement and economic benefits in pigs, and optimized the flavor quality and health traits of pork.
Smart Images

Figure CN120818610B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular markers and animal genetic breeding technology, and in particular to a SNP marker that affects AMP content in pigs and its application. Background Technology
[0002] Adenosine monophosphate (AMP) is a nucleotide composed of one molecule of adenosine and one phosphate group, obtained by the two hydrolysis of ATP. AMP is one of the building blocks of RNA and is also a component of NAD+. + AMP is a component of NADP and possesses multiple potential advantages in breeding. Firstly, AMP provides a certain foundation for umami flavor and synergistically enhances the perceived umami of meat with IMP and GMP. It can also be converted into IMP, making it an important precursor to flavor potential. Secondly, AMP is a signaling molecule for cellular energy status, activating the AMPK pathway and participating in the regulation of lipid metabolism, muscle formation, and oxidative stress, thus playing a positive role in improving meat quality and increasing lean meat percentage. In post-mortem metabolism, AMP affects the rate of glycolysis and pH reduction, helping to maintain meat color, tenderness, and water retention. Furthermore, AMP's ability to generate uric acid after metabolism is weaker than that of inosine, making it safer in controlling purine burden. In conclusion, appropriately increasing AMP content is an effective breeding strategy to achieve the dual goals of flavor optimization and healthy meat quality.
[0003] Marker-Assisted Selection (MAS) in pigs is a breeding technique based on molecular genetic markers. It indirectly screens for superior genotypes by identifying molecular markers linked to genes of the target trait, thereby accelerating genetic improvement. Genome-wide Association Analysis (GWAS) is a technique that uses high-throughput genotyping technologies (such as SNP microarrays and sequencing) to identify mutation sites significantly associated with target traits. It is widely used to explore the genetic nature of phenotypic variations. GWAS technology can be used to discover molecular markers associated with important economic traits in pigs, and these markers can be applied to marker-assisted breeding of pigs.
[0004] Therefore, GWAS analysis can be used to identify SNP markers significantly associated with AMP content in pig muscle. Applying these markers to marker-assisted breeding of pigs can precisely increase AMP content at the genetic level. This strategy can significantly accelerate the genetic improvement of AMP, an important flavor and meat quality trait, thereby enhancing the economic value of pork by optimizing its flavor and quality. Summary of the Invention
[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP marker that affects the AMP content in pigs.
[0006] Another object of the present invention is to provide the application of the above-mentioned SNP marker.
[0007] The objective of this invention is achieved through the following technical solution:
[0008] A SNP marker that affects porcine AMP levels, comprising at least one of the following SNP markers:
[0009] (I) The SNP site corresponds to the C>T mutation at position 32536427 on chromosome 2 in International Pig Genome Version 11.1;
[0010] (II) The SNP site corresponds to the T>G mutation at position 32536373 on chromosome 2 in International Pig Genome Version 11.1;
[0011] (III) The SNP site corresponds to the A>G mutation at position 136973141 on chromosome 6 in International Pig Genome Version 11.1;
[0012] (IV) The SNP site corresponds to the T>TACCACCACC mutation at position 133224163 on chromosome 6 in International Pig Genome Version 11.1;
[0013] (V) The SNP site corresponds to the G>A mutation at position 136598298 on chromosome 6 in International Pig Genome Version 11.1;
[0014] (VI) The SNP site corresponds to the G>A mutation at position 6299793 on chromosome 9 in International Pig Genome Version 11.1;
[0015] (VII) The SNP site corresponds to the T>G mutation at position 6280446 on chromosome 9 in International Pig Genome Version 11.1;
[0016] (VIII) The SNP site corresponds to the T>C mutation at position 6304526 on chromosome 9 in International Pig Genome Version 11.1;
[0017] (IX) The SNP site corresponds to the T>G mutation at position 41059384 on chromosome 18 in International Pig Genome Version 11.1;
[0018] (X) The SNP site corresponds to the A>G mutation at position 73513150 on chromosome 16 in International Pig Genome Version 11.1;
[0019] (XI) The SNP site corresponds to the G>A mutation at position 6452450 on chromosome 9 in International Pig Genome Version 11.1;
[0020] (XII) The SNP site corresponds to the G>T mutation at position 6349025 on chromosome 9 in International Pig Genome Version 11.1;
[0021] (XIII) The SNP site corresponds to the G>A mutation at position 6245852 on chromosome 9 in International Pig Genome Version 11.1;
[0022] (XIV) The SNP site corresponds to the G>T mutation at position 6275369 on chromosome 9 in the International Pig Genome Version 11.1.
[0023] In the specific implementation plan:
[0024] For (I), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:1, wherein M in the sequence is T or C, and its SNP site is a single base mutation of T278-C278 at position 278 of the sequence labeled in SEQ ID NO:1.
[0025] For (VI), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:2, wherein M in the sequence is A or G, and its SNP site is a single base mutation of A223-G223 at position 223 of the sequence labeled in SEQ ID NO:2.
[0026] For (IX), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:3, where M in the sequence is G or T, and the SNP site is a single base mutation of G274-T274 at position 274 of the sequence in SEQ ID NO:3.
[0027] For (I)-(V), the pigs are of American Duroc breed or their synthetic line.
[0028] For (VI)-(VIII), the pigs are of American Landrace breed or their synthetic line.
[0029] For (IX)-(X), the pigs are of American Large White breed or their synthetic line.
[0030] For (XI)-(XIV), the pigs are of American Landrace, American Large White, American Duroc or their synthetic lines.
[0031] A primer combination for detecting the above-mentioned SNP markers, comprising at least one of primer pairs primer-F1 and primer-R1, primer pairs primer-F2 and primer-R2, and primer pairs primer-F3 and primer-R3, the nucleotide sequences of which are shown in SEQ ID NO:4-9.
[0032] A kit for detecting the above-mentioned SNP markers, comprising the above-mentioned primer combination.
[0033] The application of the SNP markers, primer combinations, or kits in identifying AMP content or meat quality-related traits in pigs or pork, screening pig breeds with high AMP content or excellent meat quality, or in the genetic breeding of pig AMP content or meat quality-related traits.
[0034] A method for genetic improvement of pigs, comprising the following steps:
[0035] Identify the aforementioned SNP markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP markers:
[0036] For (I), select breeding pig individuals with the C / C genotype at position 32536427 on chromosome 2 of International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / T genotype, so as to increase the frequency of allele C at this locus generation by generation.
[0037] For (II), select breeding pigs with the T / T genotype at position 32536373 on chromosome 2 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pigs with the T / G genotype, in order to increase the frequency of the T allele at this locus generation by generation;
[0038] For (III), select breeding pig individuals with the G / G or G / A genotype at position 136973141 on chromosome 6 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype, so as to increase the frequency of the G allele at this locus generation by generation.
[0039] For (Ⅳ), select breeding pig individuals with the TACCACCACC / TACCACCACC or T / TACCACCACC genotype at position 133224163 on chromosome 6 of International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of the TACCACCACC allele at this locus generation by generation.
[0040] For (V), select breeding pig individuals with the A / A or A / G genotype at position 136598298 on chromosome 6 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation.
[0041] For (VI), select breeding pig individuals with the A / A or G / A genotype at position 6299793 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation;
[0042] For (VII), select breeding pig individuals with the T / T or T / G genotype at position 6280446 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of the T allele at this locus generation by generation.
[0043] For (VIII), select breeding pig individuals with the T / T or C / T genotype at position 6304526 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype, so as to increase the frequency of the T allele at this locus generation by generation;
[0044] For (IX), select breeding pig individuals with the G / G or T / G genotype at position 41059384 on chromosome 18 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of the G allele at this locus generation by generation.
[0045] For (X), select breeding pig individuals with the G / G or A / G genotype at position 73513150 on chromosome 16 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype, so as to increase the frequency of the G allele at this locus generation by generation.
[0046] For (XI), select breeding pig individuals with the G / G or G / A genotype at position 6452450 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype, so as to increase the frequency of the G allele at this locus generation by generation.
[0047] For (XII), select breeding pig individuals with the T / T or T / G genotype at position 6349025 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of the T allele at this locus generation by generation.
[0048] For (XIII), select breeding pig individuals with the G / G or G / A genotype at position 6245852 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype, so as to increase the frequency of the G allele at this locus generation by generation.
[0049] For (XIV), breeding pigs with the T / T or T / G genotype at position 6275369 on chromosome 9 of International Pig Genome Version 11.1 are selected from the core breeding population, while breeding pigs with the G / G genotype are culled, in order to increase the frequency of the T allele at this locus generation by generation.
[0050] A method for identifying AMP content or meat quality-related traits in pigs or pork, comprising the following steps:
[0051] Identify the aforementioned SNP markers in pigs or pork, and determine the AMP content or meat quality-related traits in pigs or pork based on the SNP sites of the SNP markers:
[0052] For (I), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are sorted by the genotype at position 32536427 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype;
[0053] For (II), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are ordered by the genotype at position 32536373 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / G genotype;
[0054] For (III), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are ordered by the genotype at position 136973141 on chromosome 6 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype and A / A genotype.
[0055] For (Ⅳ), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are sorted by the genotype at position 133224163 on chromosome 6 of the International Pig Genome Version 11.1, in the following order: TACCACCACC / TACCACCACC genotype, T / TACCACCACC genotype and T / T genotype.
[0056] For (V), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are sorted by the genotype at position 136598298 on chromosome 6 of the International Pig Genome Version 11.1, in the following order: A / A genotype, A / G genotype, and G / G genotype.
[0057] For (VI), the AMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 6299793 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype, and G / G genotype.
[0058] For (VII), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are ordered by the genotype at position 6280446 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / G genotype and G / G genotype.
[0059] For (VIII), the AMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 6304526 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: T / T genotype, C / T genotype, and C / C genotype.
[0060] For (IX), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are ordered by the genotype at position 41059384 on chromosome 18 of the International Pig Genome Version 11.1, in the following order: G / G genotype, T / G genotype and T / T genotype.
[0061] For (X), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are sorted by the genotype at position 73513150 on chromosome 16 of the International Pig Genome Version 11.1, in the following order: G / G genotype, A / G genotype, and A / A genotype.
[0062] For (XI), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are sorted by the genotype at position 6452450 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype and A / A genotype.
[0063] For (XII), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are ordered by the genotype at position 6349025 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / G genotype and G / G genotype.
[0064] For (XIII), the AMP content of the pigs or pork, from high to low or the meat quality traits from good to bad, are sorted by the genotype at position 6245852 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype and A / A genotype.
[0065] For (XIV), the AMP content of the pigs or pork, from high to low or the meat quality traits from excellent to poor, are ordered by the genotype at position 6275369 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / G genotype, and G / G genotype.
[0066] The application of the SNP markers, primer combinations, or kits described herein in the fields of gene editing or transgenics.
[0067] A method for establishing new pig breeds and / or new pig varieties that increase AMP content or improve meat quality-related traits, comprising the following steps:
[0068] The above-mentioned SNP markers in pigs were identified, and the following mutations were performed based on the SNP markers:
[0069] For (I), pigs with the SNP marker having the genotype C / T are mutated to the C / C genotype through site-directed mutagenesis;
[0070] For (II), the pigs with the SNP marker having the genotype T / G are mutated to the T / T genotype through site-directed mutagenesis;
[0071] For (III), pigs with the SNP marker having the genotype G / A or A / A, the G / A or A / A genotype is mutated to the G / G genotype through site-directed mutagenesis;
[0072] For (Ⅳ), pigs with the SNP marker having the genotype T / TACCACCACC or T / T, the T / TACCACCACC or T / T genotype is mutated to the TACCACCACC / TACCACCACC genotype by site-directed mutagenesis.
[0073] For (V), pigs with the SNP marker having the genotype A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype through site-directed mutagenesis;
[0074] For (VI), pigs with the SNP marker having the genotype G / A or G / G are mutated to the A / A genotype through site-directed mutagenesis.
[0075] For (VII), pigs with the SNP marker having the genotype T / G or G / G, the T / G or G / G genotype is mutated to the T / T genotype through site-directed mutagenesis;
[0076] For (VIII), pigs with the SNP marker having the genotype C / C or C / T are mutated to the T / T genotype through site-directed mutagenesis.
[0077] For (IX), pigs with the SNP marker having the genotype T / G or T / T, the T / G or T / T genotype is mutated to the G / G genotype through site-directed mutagenesis.
[0078] For (X), pigs with the SNP marker having the genotype A / G or A / A can have their A / G or A / A genotype mutated to the G / G genotype through site-directed mutagenesis.
[0079] For (XI), pigs with the SNP marker having the genotype G / A or A / A are mutated to the G / G genotype through site-directed mutagenesis.
[0080] For (XII), pigs with the SNP marker having the genotype T / G or G / G are mutated to the T / T genotype through site-directed mutagenesis.
[0081] For (XIII), pigs with the SNP marker having the genotype G / A or A / A are mutated to the G / G genotype through site-directed mutagenesis.
[0082] For (XIV), pigs with the SNP marker having the genotype T / G or G / G are mutated to the T / T genotype through site-directed mutagenesis.
[0083] The mutation is performed using transgenic methods or gene editing methods.
[0084] The preferred method for mutation is to use the CRISPR / Cas9 gene editing method.
[0085] The present invention has the following advantages and effects compared with the prior art:
[0086] (1) Based on three experimental pig groups, namely American purebred Landrace pig, American purebred Large White pig, and American purebred Duroc pig, this invention uses whole genome resequencing and GWAS analysis to study and identify 14 SNP molecular markers that are significantly related to AMP content. At least one of the SNP markers in this invention can be used to detect relevant indicators in pigs, or at least one of these SNP markers can be used for genetic improvement.
[0087] (2) Based on the SNP markers that affect the AMP content of pigs, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including primers and kits for detecting the SNP markers, methods for identifying the AMP content or meat quality-related traits of pigs or pork, and methods for genetic improvement of pigs. When applied to the genetic improvement of AMP content and meat quality-related traits in pigs, it can quickly and accurately select and breed pigs with AMP content and meat quality-related traits, thus accelerating the breeding process.
[0088] (3) This invention uses molecular breeding to solve the problem of low AMP content. By selecting the superior alleles of the above-mentioned SNPs, the frequency of superior alleles can be increased generation by generation, the AMP content can be increased, the progress of pig genetic improvement can be accelerated, and the economic benefits of breeding pigs can be effectively improved. Attached Figure Description
[0089] Figure 1 This is a Manhattan plot showing GWAS analysis of AMP content traits on different chromosomes in different experimental populations; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log value corresponding to the molecular marker site. 10 (P-value).
[0090] Figure 2 This is a violin plot showing the AMP levels of different genotypes at all loci in their respective populations. The X-axis represents the genotype of the SNP molecular marker locus, and the Y-axis represents the AMP level of the individual. Detailed Implementation
[0091] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0092] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.
[0093] In the examples, the standard for HPLC detection was adenosine monophosphate (CAS: 61-19-8), which was purchased from Shanghai Anpu Experimental Technology Co., Ltd.
[0094] Example 1
[0095] 1. Laboratory animals
[0096] The pig population used in this invention consists of: 173 purebred American Landrace pigs, 166 purebred American Large White pigs, and 158 purebred American Duroc pigs.
[0097] All pigs were sourced from Jiangxi Yudu Jiada Livestock Co., Ltd. All pigs were slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. after reaching 200 days of age, in the slaughterhouse's cutting workshop. After slaughter and bleeding, the hair, internal organs, head, tail, and limbs (below the wrists and joints) were removed, and the skin was removed to obtain a carcass. Sampling was completed within 30 minutes post-slaughter to minimize the impact of post-mortem metabolism on the content of purine nucleotides and their metabolites. The longissimus dorsi muscle was precisely separated from the left side of the pig carcass between the first and second lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0g of muscle tissue was collected, rapidly transferred to 2mL cryovials, cut into small pieces, and flash-frozen in liquid nitrogen (-196℃), then stored in an ultra-low temperature freezer at -80℃ until the experiment.
[0098] 2. HPLC Quantitative Determination of AMP Content in Pork
[0099] (1) AMP extraction: Accurately weigh 0.4g (accurate to 0.001g) of the longissimus dorsi muscle sample from the shredded sample and place it in a 15mL polypropylene acid-resistant centrifuge tube.
[0100] (2) Acid hydrolysis extraction: Add 6 mL of 6% (w / w) perchloric acid solution pre-cooled to 4℃, and then homogenize it for 45 s with a handheld high-speed homogenizer (run for 10 s / pause for 5 s, cycle 3 times), and use an ice bath intermittently to prevent overheating.
[0101] (3) Centrifugation purification: Transfer the homogenate to a constant temperature water bath shaker (4℃), shake at 200 rpm for 15 min to promote nucleotide release; centrifuge at 4℃ and 5000 rpm for 10 min, collect the supernatant into a new tube, repeat the centrifugation twice, and combine the supernatants from the two centrifugations.
[0102] (4) Precise pH control for acid-base neutralization: The supernatant combined in step (3) is placed in an ice bath, and 3 mol / L NaOH solution is added dropwise using a micropipette to adjust the pH to 6.5±0.1 (real-time monitoring with a pH meter) to minimize interference with ATPase activity; ultrapure water is added to bring the volume to 10 mL, vortexed and mixed, and then allowed to stand for 10 min to promote ion balance.
[0103] (5) The content of AMP in the extract of the longissimus dorsi muscle of each individual pig was determined by high performance liquid chromatography (HPLC) (unit: mg / 100g). The HPLC analysis was performed on an ACQUITYUPLCH-ClassPLUS System (Waters). The chromatographic column was Waters BEH C18 (1.7 μm, 2.1× 100 mm). The mobile phase was 0.05 mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v). The flow rate was 0.2 mL / min (isocratic elution). The column temperature was 30℃. The detection wavelength was 254 nm. The injection volume was 2 μL. The external standard method was used for quantification. The standard curve should meet the requirement of R²≥0.999.
[0104] (6) Concentration data obtained from the HPLC system are converted from the original unit µg / mL to mg / 100g using the following formula:
[0105]
[0106] Where C represents the content of AMP in 100 grams of pork (mg / 100g), and C0 represents the concentration of AMP measured by HPLC (µg / mL).
[0107] This invention presents descriptive statistics on HPLC detection data of AMP in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace, and Duroc). The sample size (N), mean, standard deviation (SD), minimum-maximum (Min-Max), and coefficient of variation (CV) were systematically calculated. The descriptive statistical results are shown in Table 1. The table shows that the mean 5'-adenosine monophosphate (AMP) content (52.32 ± 0.57) in Duroc was significantly higher than that in Large White and Landrace, and the coefficient of variation was the lowest (13.7%), indicating less inter-individual variability and suggesting a more stable AMP biosynthetic pathway.
[0108] Table 1. Descriptive statistics of AMP content in three varieties (unit: mg / 100g)
[0109]
[0110] Example 2
[0111] 1. Acquisition, quality control, and genotyping of whole-genome resequencing data in pigs.
[0112] (1) DNA extraction: Ear tissue samples were collected from each individual in the three experimental pig groups in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.
[0113] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. Clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.
[0114] (3) Sequence alignment: The data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.
[0115] (4) Mutation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, then use Sambamba (v0.8.2) to remove the PCR repeat sequences in the bam format file, and finally use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).
[0116] (5) Variation Quality Control: The population-level genotype data obtained in step (4) was quality controlled using samtools. High-quality genotype sites were retained if they met the condition "FILTER="PASS"" and the variation detection quality value (GQ) > 20. Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with a minor allele frequency (MAF) below 5% and samples with an individual genotype call rate below 80%. Finally, beagle (r1399) was used to autofill the genotypes to obtain high-quality genotype data.
[0117] After processing using the methods described above, 1,928,103, 1,964,653, and 1,513,322 mutation sites (including SNPs and Indels) were obtained in Dabai, Changbai, and Duroc, respectively.
[0118] 2. Genome-wide association study (GWAS) and meta-analysis
[0119] (1) Genome-wide association analysis was performed on the phenotypic data after confounding correction using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1). Specifically:
[0120] ① Phenotypic processing: This invention uses the lm() function in R language to perform simple linear regression on gender and batch number, and the corrected residuals are used as the phenotypes for the final association analysis.
[0121] ② The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:
[0122]
[0123] Where y represents the n-dimensional vector of the phenotype (quantitative trait or binary vector) to be analyzed, which in this study is the AMP content; W represents a matrix consisting of a column of "1"s (n×c dimensions); α represents the effect and intercept vector of the corresponding covariate (c dimensions); x represents the vector of genotypes at the detection locus (n dimensions); β represents the vector of the magnitude of the effect at the detection locus; u represents a vector with a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution; ε indicates that it follows a mean of 0 and a covariance-variance matrix of τ. -1 The residual vector of In (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix, and In represents the n×n identity matrix; MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 0.05 / N (Bonferroni correction) is set, where N is the number of valid SNPs / Indels.
[0124] (2) Using the results of the above GWAS analysis, meta-analysis of AMP content in the three groups was performed in METAL software according to conventional methods. The meta-analysis was performed based on the standard error weighting method (SCHEME STDERR).
[0125] This invention is based on GWAS analysis ( Figure 1 A total of 14 representative SNP loci were obtained (including those obtained from meta-analysis), and their basic genetic parameters are shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the website did not have the SNP name information for that locus, the SNP name was represented in the form of "chromosome_location". Other important genetic parameters for each representative locus were provided by GWAS analysis using GEMMA software, including the chromosome and location of the locus, alleles, effect size, and p-value (Wald test).
[0126] Table 2. Basic genetic parameters of 14 representative SNP loci in pigs
[0127]
[0128] Note: The meta-analysis integrates genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.
[0129] 3. Analysis of phenotypic differences in AMP content among different genotypes
[0130] Genotypes at displayed molecular marker sites in each of the 497 pigs from three populations were extracted from sequencing files using Plink (v1.9). After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with their corresponding AMP levels. Then, the `summarise` function from the `dplyr` package in R was used to statistically analyze the differences in phenotypic distribution among different genotypes. The results are shown in Table 3. Figure 2 As shown in the figure. The p-value is obtained from the variance test.
[0131] Table 3. Effects of each molecular marker site on AMP content (unit: mg / 100g)
[0132]
[0133] 4. Heritability analysis
[0134] Heritability is one of the most important fundamental genetic parameters in quantitative genetics, and it can be divided into broad-sense heritability, narrow-sense heritability, and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h0). 2 ), which refers to the proportion of the variance in quantitative trait breeding values to the variance in phenotypic values, is the additive effect portion after eliminating dominant and epistatic effects, and is stably inherited during generational transmission. This invention estimates single-marker heritability based on the effect value (β) and its standard error (SE) of each locus in the GWAS results file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the whole-genome level. The specific calculation formula is as follows:
[0135]
[0136] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.
[0137] As shown in Table 4, the estimated heritability values of different varieties are all at a moderate level, roughly ranging from 0.352 to 0.354.
[0138] Table 4. Heritability estimates of AMP content in the three populations (h 2 )
[0139]
[0140] Example 3
[0141] This embodiment provides a specific method and process for detecting SNP markers in Embodiment 2, specifically taking SNP markers 2_32536427, 9_6299793, and 18_41059384 as examples, whose corresponding pig breeds are Duroc, Landrace, and Large White, respectively. The specific method is as follows:
[0142] 1. Primer design
[0143] (1) The target fragment containing SNP sites that are significantly associated with AMP levels in Duroc pigs is a 578 bp nucleotide sequence from chromosome 2 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and their nucleic acid sequences are as follows:
[0144] Upstream primer-F1: 5'-GAGGTACCACGTCACACCAG-3' (SEQ ID NO:4);
[0145] Downstream primer primer-R1: 5'-GCCCCCAAACTGTCTCCTTT-3' (SEQ ID NO:5).
[0146] (2) The target fragment containing SNP sites that are significantly associated with AMP content in American Landrace pigs is a 501 bp nucleotide sequence from chromosome 9 (SEQ ID NO:2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and their nucleic acid sequences are as follows:
[0147] Upstream primer-F2: 5'-GCAGGGAAGCCAGGAATCTC-3' (SEQ ID NO:6);
[0148] Downstream primer primer-R2: 5'-TGGTCTCAAGGCACCACATC-3' (SEQ ID NO:7).
[0149] (3) The target fragment containing SNP sites that are significantly associated with AMP levels in American Large White pigs is a 559 bp nucleotide sequence from chromosome 18 (SEQ ID NO:3). The upstream and downstream primers for sequence amplification are primer-F3 and primer-R3, and their nucleic acid sequences are as follows:
[0150] Upstream primer primer-F3: 5'-TGTCTTTCTCTGTCTGACTTCGT-3' (SEQ ID NO:8);
[0151] Downstream primer primer-R3: 5'-GGGCAAAGTGCACTTTTTCTCT-3' (SEQ ID NO:9).
[0152] 2. PCR amplification
[0153] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-65℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.
[0154] 3. DNA sequencing
[0155] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites.
[0156] SEQ ID NO:1 (chr2:32536149-32536727):
[0157] GAGGTACCACGTCACACCAGCCAGAATGGCCATCATCAAAAAGTCTACAAACAATAAGTGCTCGAGAGGATATGGAGGAAAGGGAACCCTATTACACTGTTGGTGGGATTGTAAATTTGTGCAACCGTTGTGGAAAAC AGTATGGAGGTGCCTCAAAAACTAAAAATAGAATACATTTGATCTAGCAATCCCACTCCTGGGCTTCTATCCAGAGAAAACCATTACTTGCAAAGACACATGTACTCTAATGTTCATAGCAGCACTATTTGCAATAGC M(C / T)AAGACATGGAAGCAACCTAAATGTCCATCGACAGAGGAGTGGATCAAGAAGAGGTGGTACACATACACAGTGGAATATTACTCAGCCATTAAAAGGAAAGAAATACCGGCATTTGCAGCAACATGGATGGACCTAGAAATTATCATGCTAAGTGAAGTCAGCCATACAATGAGATACCAACATCAAATGCTTTCACTGACATTTGGAATCTGAAAAAAGAACAGAATGAACTTTGCAAAACAAATACTGACTCACAGACTTTGAAAAACTTATGGTCTCCAAAGGAGACAGTTTGGGGGC
[0158] SEQ ID NO:2(chr9:6299570-6300071):
[0159] GCAGGGAAGCCAGGAATCTCTTAGACTGGGGGGCCTACAGCAGTGCTTCTCAAACTAATATGCATACGACTCACCTTGGGTTGTGAGAGAATGCAGGTGTGGAGTCTGAGAATCTGCATTTCTAAAAGATTCTATGATTGCAGAAGCTACCGGTCTGTGGCCCCACTTTCTATGGACTTTTTAGATTTTCAGCAAGAGCCAGAGCAGTGCCAGAGCCCAGCA M(A / G) CGCAGAGAGGGGATGAGCCTGCTGTGACCACGGCAGGGCCAGTCCTCAGAGACGGACTTCTGGAAGATCCCTTTCTCCCAGTGGGGCTGCTGAATGGGTCCCAGCAGTGACTGGGGAGACAGGCAGTGATGGAGGCAGGACCAGCCAGGGCCTTCACAGCCTCACAGAAAAGGAGATGCGTTCCCCCTCAGCCCTGTCAGAGGAAGCTAAGTGCAGAGCTCTCGGAGAGAGAGCGATGCTCTCAAGGCCATGGCTTAAGATGTGGTGCCTTGAGACCA
[0160] SEQ ID NO:3(chr18:41059110-41059669):
[0161] TGTCTTTCTCTGTCTGACTTCGTTTAGTTTGCTAATCTCTATGTTGCTGCAAATGGCATCATTTCATTCTTCTTTATGGCTGAGTAATATTCCAGTGTATATATGTGTAACATCTTCTTTGTCCATTCATCTGTTG CCGGACATTTATGTTGTTTCCATTGTACCATGACGTTTTCGCTTATGGCCTGGAATACTCCCCCTATCTCTCAGAAGGATTCTGTGTATCTGTCTCTGGCCAGGTCAGATATCCTCACTGCCTTTCCATCTTGCCTG M(T / G) GCAAAATGAGTCTCCTCTGCATGTTCCTGTGGTCCAGGGTCACACATGCCATTGCGCTTTATCTTCCAATTGCTACGCATGCATCAGAATTTCTCACCCCTTATTTGTGAGATACTTATTAATTTCAGACACTTTTCTTATT TAAATTTATATCCCTAACACTTTGCACAGCTTCTGTGGATAGACAAATATTTGTTGTCTCAATATTTGTTGATGTGAATTTAGTGGAAAAAGAGAGATAGTAAAAGGAAGAAAGAAAGAAAAGAGAAAAAGTGCACTTTGCCC
[0162] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The primer binding position is indicated by bolding at the beginning and end of the sequence.
[0163] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The use of a SNP site or an Indel site affecting the AMP content of a pig in identifying the AMP content of a pig or pork or in the genetic breeding of the AMP content of a pig, characterized in that The SNP site or Indel site comprises at least one of the following SNP sites or Indel sites: (I) The SNP site corresponds to the C>T mutation at position 32536427 on chromosome 2 of the International Pig Genome 11.1 version; (II) The SNP site corresponds to the T>G mutation at position 32536373 on chromosome 2 of the International Pig Genome 11.1 version; (III) The SNP site corresponds to the A>G mutation at position 136973141 on chromosome 6 of the International Pig Genome 11.1 version; (IV) The Indel site corresponds to the T>TACCACCACC mutation at position 133224163 on chromosome 6 of the International Pig Genome 11.1 version; (V) The SNP site corresponds to the G>A mutation at position 136598298 on chromosome 6 of the International Pig Genome 11.1 version; (VI) The SNP site corresponds to the G>A mutation at position 6299793 on chromosome 9 of the International Pig Genome 11.1 version; (VII) The SNP site corresponds to the T>G mutation at position 6280446 on chromosome 9 of the International Pig Genome 11.1 version; (VIII) The SNP site corresponds to the T>C mutation at position 6304526 on chromosome 9 of the International Pig Genome 11.1 version; (IX) The SNP site corresponds to the T>G mutation at position 41059384 on chromosome 18 of the International Pig Genome 11.1 version; (X) The SNP site corresponds to the A>G mutation at position 73513150 on chromosome 16 of the International Pig Genome 11.1 version; For (I)-(V), the pig is a Duroc pig of the American line; For (VI)-(VIII), the pig is a Landrace pig of the American line; For (IX)-(X), the pig is a Large White pig of the American line.
2. The use according to claim 1, characterized in that: For (I), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 1, and the base is T or C; For (VI), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 2, and the base is A or G; For (IX), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 3, and the base is G or T.
3. The use of a primer combination for detecting a SNP site affecting the AMP content of a pig in identifying the AMP content of a pig or pork or in the genetic breeding of the AMP content of a pig, characterized in that, The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, and the nucleotide sequences thereof are shown as SEQ ID NO: 4-9; The SNP site is SNP site (I), SNP site (VI), or SNP site (IX) as described in claim 1 or 2.
4. Use of a kit for detecting a SNP site affecting AMP content of a pig in identifying AMP content of a pig or pork or genetic breeding of AMP content of a pig, characterized in that The kit comprises the primer combination as described in claim 3.
5. A method for genetic improvement of pigs, characterized by Comprising the following steps: Determine the SNP site or Indel site genotype of the breeding pig in the breeding pig core group, and make a corresponding selection according to the genotype of the SNP site or Indel site: the SNP site or Indel site is as described in claim 1; For (I), selecting from the core group of breeding pigs a breeding pig individual that is C / C genotype at position 32536427 on chromosome 2 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is C / T genotype, so as to increase the frequency of allele C at the locus generation by generation; For (II), selecting from the core group of breeding pigs a breeding pig individual that is T / T genotype at position 32536373 on chromosome 2 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is T / G genotype, so as to increase the frequency of allele T at the locus generation by generation; For (III), selecting from the core group of breeding pigs a breeding pig individual that is G / G or G / A genotype at position 136973141 on chromosome 6 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is A / A genotype, so as to increase the frequency of allele G at the locus generation by generation; For (IV), selecting from the core group of breeding pigs a breeding pig individual that is TACCACCACC / TACCACCACC genotype at position 133224163 on chromosome 6 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is T / T or T / TACCACCACC genotype, so as to increase the frequency of allele TACCACCACC at the locus generation by generation; For (V), selecting from the core group of breeding pigs a breeding pig individual that is A / A or A / G genotype at position 136598298 on chromosome 6 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is G / G genotype, so as to increase the frequency of allele A at the locus generation by generation; For (VI), selecting from the core group of breeding pigs a breeding pig individual that is A / A or G / A genotype at position 6299793 on chromosome 9 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is G / G genotype, so as to increase the frequency of allele A at the locus generation by generation; For (VII), selecting from the core group of breeding pigs a breeding pig individual that is T / T or T / G genotype at position 6280446 on chromosome 9 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is G / G genotype, so as to increase the frequency of allele T at the locus generation by generation; For (VIII), selecting from the core group of breeding pigs a breeding pig individual that is T / T or C / T genotype at position 6304526 on chromosome 9 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is C / C genotype, so as to increase the frequency of allele T at the locus generation by generation; For (IX), selecting from the core group of breeding pigs a breeding pig individual that is G / G or T / G genotype at position 41059384 on chromosome 18 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is T / T genotype, so as to increase the frequency of allele G at the locus generation by generation; For (X), selecting from the core group of breeding pigs a breeding pig individual that is G / G or A / G genotype at position 73513150 on chromosome 16 of the International Pig Genome 11.1 version, and eliminating a breeding pig individual that is A / A genotype, so as to increase the frequency of allele G at the locus generation by generation; For (I)-(IV), the pig is a Duroc pig of American line; For (V)-(VII), the pig is a Landrace pig of American line; For (VIII)-(IX), the pig is a Large White pig of American line.
6. A method of identifying the AMP content of a pig or pork, characterized by comprising the following steps: determining the genotype of a SNP site or an Indel site of a pig or pork, and judging the content of AMP of the pig or pork according to the genotype of the SNP site or the Indel site, wherein the SNP site or the Indel site is as described in claim 1; For (I), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 32536427 on chromosome 2 of the international pig genome version 11.1, in turn: C / C genotype, C / T genotype; For (II), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 32536373 on chromosome 2 of the international pig genome version 11.1, in turn: T / T genotype, T / G genotype; For (III), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 136973141 on chromosome 6 of the international pig genome version 11.1, in turn: G / G genotype, G / A genotype and A / A genotype; For (IV), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 133224163 on chromosome 6 of the international pig genome version 11.1, in turn: TACCACCACC / TACCACCACC genotype, T / TACCACCACC genotype and T / T genotype; For (V), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 136598298 on chromosome 6 of the international pig genome version 11.1, in turn: A / A genotype, A / G genotype and G / G genotype; For (VI), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 6299793 on chromosome 9 of the international pig genome version 11.1, in turn: A / A genotype, G / A genotype and G / G genotype; For (VII), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 6280446 on chromosome 9 of the international pig genome version 11.1, in turn: T / T genotype, T / G genotype and G / G genotype; For (VIII), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 6304526 on chromosome 9 of the international pig genome version 11.1, in turn: T / T genotype, C / T genotype and C / C genotype; For (IX), the content of AMP of the pig or pork from high to low is ranked according to the genotype at position 41059384 on chromosome 18 of the international pig genome version 11.1, in turn: G / G genotype, T / G genotype and T / T genotype; For (X), the pig or pork AMP content is ranked from high to low by the genotype at position 73513150 on chromosome 16 of the international pig genome version 11.1, in turn: G / G genotype, A / G genotype, and A / A genotype; For (I)-(IV), the pig is a Duroc pig of the American type; For (V)-(VII), the pig is a Landrace pig of the American type; For (VIII)-(IX), the pig is a Large White pig of the American type.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to sow birth process traits and application
CN117265134A
SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 2 and related to lean meat percentage and application of SNP molecular marker
CN117821604A