A snp marker affecting pig purine base content and application thereof

By detecting SNP markers in pigs and using gene editing technology, the frequency of dominant alleles was increased generation by generation, solving the problem of difficulty in reducing purine content in pork in existing technologies. This achieved rapid and accurate breeding results, improving pork quality and economic benefits.

CN120818612BActive Publication Date: 2026-03-10JIANGXI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511333410.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2026-03-10
Estimated Expiration
2045-09-18

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively reduce the purine content in pork through molecular marker-assisted breeding, and traditional processing methods are complex and may lead to the loss of other substances, affecting meat quality and taste.

Method used

By studying and identifying SNP markers associated with purine content, primer combinations and kits were used to detect purine base content in pigs. Combined with gene editing or transgenic technology, the frequency of dominant alleles was increased generation by generation to optimize the purine base content of the pig herd.

Benefits of technology

This technology enables the rapid and accurate reduction of purine content in pork without affecting meat quality and taste, significantly accelerating the breeding process and improving economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120818612B_ABST
    Figure CN120818612B_ABST
Patent Text Reader

Abstract

The present application relates to the field of molecular markers and animal genetic breeding technology, and particularly relates to a SNP marker affecting pig purine base content and application thereof. Based on three test pig populations of American purebred Landrace, American purebred Large White and American purebred Duroc, the present application uses pig whole genome resequencing and GWAS analysis to research and determine 15 SNP markers significantly affecting pig purine base content. By selecting the advantageous alleles of the above SNP markers, the frequency of the advantageous alleles can be increased generation by generation, the corresponding purine content can be reduced or increased, the progress of pig genetic improvement can be accelerated, and the economic benefits of pig breeding can be effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular markers and animal genetic breeding, and particularly relates to a SNP marker affecting pig purine base content and application thereof. BACKGROUND

[0002] Purine is a natural substance existing in all cells of the human body and almost all foods. The purine in human food, including nucleotides, nucleosides and free purine bases, etc., will be absorbed in the form of corresponding nucleosides or bases and enter the purine metabolic pathway. Excessive intake of purine will cause the concentration of blood urate to rise, and if it exceeds the excretion capacity of the body, uric acid will be deposited in the joints in the form of crystals, causing gout. Therefore, reducing the purine content in food has become an important research direction.

[0003] At present, the demand for pork accounts for a large proportion, and pork is a food with moderate purine content. The current method for reducing the purine content of meat is mainly through meat processing, including reasonable cooking methods (studies have shown that more than 60% of hypoxanthine can be transferred to the soup during the boiling process) and special processing (studies have shown that the total purine can be reduced by treating swordfish with sake lees), but these processing methods are complex and may also be accompanied by the loss of other material components. Molecular marker assisted breeding can specifically improve the purine base content, but there are few studies on reducing the purine content of meat from the aspect of molecular marker assisted breeding. By studying and determining the molecular markers associated with purine content, it can provide reference and direction for breeding a low purine base pig population.

[0004] The four common purine bases in organisms include adenine, guanine, hypoxanthine and xanthine, which widely participate in physiological processes such as nucleic acid metabolism, base modification and energy conversion. Reducing purine will also affect meat quality traits and taste, but the content of total purine (the sum of the four purines) and two main uric bases (adenine and hypoxanthine) is negatively correlated with the tenderness, juiciness, oiliness and overall taste of pork, and has no significant correlation with umami; the guanine content, which accounts for a small proportion, is positively correlated with umami. Purine bases need to be selected specifically. It is necessary to reduce the purine base content while not affecting the taste. Therefore, exploring the marker sites affecting purine bases and improving the breeding population have important significance for the production and economic benefits of pig breeding industry. SUMMARY

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present application is to provide a SNP marker affecting pig purine base content.

[0006] Another purpose of the present application is to provide the application of the above-mentioned SNP marker.

[0007] The purpose of the present application is achieved by the following technical solutions:

[0008] A SNP marker affecting pig purine base content, comprising at least one of the following SNP markers:

[0009] (I) the SNP site corresponds to the T>C mutation at position 9130411 on chromosome 2 of the International Pig Genome 11.1 version;

[0010] (II) the SNP site corresponds to the C>T mutation at position 111047325 on chromosome 8 of the International Pig Genome 11.1 version;

[0011] (III) the SNP site corresponds to the T>C mutation at position 59962069 on chromosome 12 of the International Pig Genome 11.1 version;

[0012] (IV) the SNP site corresponds to the T>C mutation at position 40604597 on chromosome 12 of the International Pig Genome 11.1 version;

[0013] (V) the SNP site corresponds to the A>G mutation at position 64561163 on chromosome 2 of the International Pig Genome 11.1 version;

[0014] (VI) the SNP site corresponds to the T>C mutation at position 15496193 on chromosome 15 of the International Pig Genome 11.1 version;

[0015] (VII) the SNP site corresponds to the A>T mutation at position 1627202 on chromosome 9 of the International Pig Genome 11.1 version;

[0016] (VIII) the SNP site corresponds to the A>G mutation at position 28473456 on chromosome 17 of the International Pig Genome 11.1 version;

[0017] (IX) the SNP site corresponds to the G>A mutation at position 223710348 on chromosome 1 of the International Pig Genome 11.1 version;

[0018] (X) the SNP site corresponds to the C>T mutation at position 63901107 on chromosome 2 of the International Pig Genome 11.1 version;

[0019] (XI) the SNP site corresponds to the C>T mutation at position 121459275 on chromosome 7 of the International Pig Genome 11.1 version;

[0020] (XII) the SNP site corresponds to the A>G mutation at position 120820145 on chromosome 8 of the International Pig Genome 11.1 version;

[0021] (XIII) the SNP site corresponds to the A>C mutation at position 119883227 on chromosome 15 of the International Pig Genome 11.1 version;

[0022] (XIV) The SNP site corresponds to the T>C mutation at position 28461000 on chromosome 17 in International Pig Genome Version 11.1;

[0023] (XV) The SNP site corresponds to the T>C mutation at position 135447169 on chromosome 15 in the international pig genome version 11.1.

[0024] In the specific implementation plan:

[0025] For (I), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:1, where M in the sequence is T or C, and the SNP site is a single-base mutation of T91-C91 at position 91 of the sequence marked in SEQ ID NO:1.

[0026] For (VII), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:2, where M in the sequence is A or T, and the SNP site is a single-base mutation of A40-T40 at position 40 of the sequence labeled in SEQ ID NO:2.

[0027] For (XII), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:3, where M in the sequence is A or G, and the SNP site is a single base mutation of A98-G98 at position 98 of the sequence marked in SEQ ID NO:3.

[0028] For (I)-(II), the pig is of American Landrace breed or its synthetic line; the purine base is guanine.

[0029] For (III), the pig is of American Large White breed or its synthetic line; the purine base is guanine.

[0030] For (Ⅳ), the source of the pig is American Landrace, American Large White, American Duroc or their synthetic lines; the purine base is guanine.

[0031] For (V) and (VI), the pigs are of American Landrace breed or their synthetic line; the purine bases are adenine.

[0032] For (VII) and (VIII), the pigs are of American Landrace breed or its synthetic line; the purine bases are hypoxanthine;

[0033] For (IX)-(XⅣ), the pigs are of American Landrace breed or its synthetic line; the purine bases are total purines.

[0034] For (XV), the source of the pig is American Landrace, American Large White, American Duroc or their synthetic lines; the purine bases are total purines.

[0035] A primer combination for detecting the above-mentioned SNP markers, comprising at least one of primer pairs primer-F1 and primer-R1, primer pairs primer-F2 and primer-R2, and primer pairs primer-F3 and primer-R3, the nucleotide sequences of which are shown in SEQ ID NO:4-9.

[0036] A kit for detecting the above-mentioned SNP markers, comprising the above-mentioned primer combination.

[0037] The application of the SNP markers, primer combinations, or kits in identifying purine base content or meat quality-related traits in pigs or pork, screening pig breeds with high guanine base content, low other purine base content, or excellent meat quality, or in the genetic breeding of purine base content or meat quality-related traits in pigs.

[0038] A method for genetic improvement of pigs, comprising the following steps:

[0039] Identify the aforementioned SNP markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP markers:

[0040] For (I), select breeding pig individuals with the C / T or C / C genotype at position 9130411 on chromosome 2 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype at this position, so as to increase the frequency of allele C at this position generation by generation.

[0041] For (II), select breeding pig individuals with the T / C or C / C genotype at position 111047325 on chromosome 8 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the TT genotype at this position, so as to increase the frequency of allele C at this position generation by generation.

[0042] For (III), select breeding pig individuals with the C / C genotype at position 59962069 on chromosome 12 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / T genotype at this position, so as to increase the frequency of allele C at this position generation by generation.

[0043] For (Ⅳ), select breeding pig individuals with the T / C or C / C genotype at position 40604597 on chromosome 12 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype at this position, so as to increase the frequency of allele C at this position generation by generation.

[0044] For (V), select breeding pig individuals with the G / A genotype at position 64561163 on chromosome 2 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype at this position, so as to increase the frequency of allele A at this position generation by generation.

[0045] For (VI), select breeding pig individuals with the C / C or C / T genotype at position 15496193 on chromosome 15 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype at that position, so as to increase the frequency of allele C at that position generation by generation.

[0046] For (VII), select breeding pig individuals with the T / T genotype at position 1627202 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / A genotype at that position, so as to increase the frequency of the T allele at that position generation by generation.

[0047] For (VIII), select breeding pig individuals with the G / G or G / A genotype at position 28473456 on chromosome 17 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype at that position, so as to increase the frequency of the G allele at that position generation by generation.

[0048] For (IX), select breeding pig individuals with the A / A or A / G genotype at position 223710348 on chromosome 1 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype at that position, so as to increase the frequency of allele A at that position generation by generation.

[0049] For (X), select breeding pig individuals with the T / C genotype at locus 63901107 on chromosome 2 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype at this locus, so as to increase the frequency of allele C at this locus generation by generation;

[0050] For (XⅠ), select breeding pig individuals with the T / T or T / C genotype at position 121459275 on chromosome 7 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype at that position, so as to increase the frequency of the T allele at that position generation by generation.

[0051] For (XII), select breeding pig individuals with the G / G or G / A genotype at position 120820145 on chromosome 8 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype at that position, so as to increase the frequency of the G allele at that position generation by generation.

[0052] For (XⅢ), select breeding pig individuals with the C / C or C / A genotype at locus 119883227 on chromosome 15 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype at that locus, so as to increase the frequency of allele C at that locus generation by generation.

[0053] For (XⅣ), select breeding pig individuals with the C / C or C / T genotype at position 28461000 on chromosome 17 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype at that position, so as to increase the frequency of allele C at that position generation by generation.

[0054] For (XV), select breeding pig individuals from the core breeding pig population who have the C / C or C / T genotype at position 135447169 on chromosome 15 of the International Pig Genome Version 11.1, and cull breeding pig individuals with the T / T genotype at that position, so as to increase the frequency of the C allele at that position generation by generation.

[0055] A method for identifying purine base content or meat quality-related traits in pigs or pork, comprising the following steps:

[0056] Identify the aforementioned SNP markers in pigs or pork, and determine the purine base content or meat quality-related traits in pigs or pork based on the SNP sites of the SNP markers:

[0057] For (I), the purine base content of the pig or pork, from high to low, is ordered by the genotype at position 9130411 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype, T / T genotype;

[0058] For (II), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 111047325 on chromosome 8 of the International Pig Genome Version 11.1, in the following order: C / C genotype, T / C genotype, and T / T genotype.

[0059] For (III), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 59962069 on chromosome 12 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype;

[0060] For (Ⅳ), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 40604597 on chromosome 12 of the International Pig Genome Version 11.1, in the following order: C / C genotype, T / C genotype, T / T genotype;

[0061] For (V), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 64561163 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype;

[0062] For (VI), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 15496193 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: T / T genotype, C / T genotype, C / C genotype;

[0063] For (VII), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 1627202 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: T / A genotype, T / T genotype;

[0064] For (VIII), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 28473456 on chromosome 17 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype, G / G genotype;

[0065] For (IX), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 223710348 on chromosome 1 of the International Pig Genome Version 11.1, in the following order: G / G genotype, A / G genotype, and A / A genotype.

[0066] For (X), the purine base content of the pig or pork, from high to low, is ordered by the genotype at position 63901107 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / C genotype;

[0067] For (XⅠ), the purine base content of the pig or pork, from high to low, is ordered by the genotype at position 121459275 on chromosome 7 of the International Pig Genome Version 11.1, in the following order: C / C genotype, T / C genotype, T / T genotype;

[0068] For (XⅡ), the purine base content of the pig or pork, from high to low, is ordered by the genotype at position 120820145 on chromosome 8 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype, G / G genotype;

[0069] For (XⅢ), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 119883227 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: A / A genotype, C / A genotype, C / C genotype;

[0070] For (XⅣ), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 28461000 on chromosome 17 of the International Pig Genome Version 11.1, in the following order: T / T genotype, C / T genotype, C / C genotype;

[0071] For (XV), the purine base content of the pigs or pork, from high to low, is ordered by the genotype at position 135447169 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: T / T genotype, C / T genotype, and C / C genotype.

[0072] The application of the SNP markers, primer combinations, or kits described herein in the fields of gene editing or transgenics.

[0073] A method for establishing new pig breeds and / or new pig varieties with improved purine base content or meat quality traits, comprising the following steps:

[0074] Identify the above-mentioned SNP markers in pigs or pork, and perform the following mutations based on the SNP markers:

[0075] For (I), pigs with the SNP marker having the genotype T / T or C / T are mutated to the C / C genotype through site-directed mutagenesis.

[0076] For (II), pigs with the SNP marker having the genotype T / T or T / C, the T / T or T / C genotype is mutated to the C / C genotype through site-directed mutagenesis;

[0077] For (III), pigs with the SNP marker having the genotype C / T are mutated to the C / C genotype through site-directed mutagenesis;

[0078] For (Ⅳ), pigs with the SNP marker having the genotype T / T or T / C, the T / C or T / T genotype is mutated to the C / C genotype through site-directed mutagenesis;

[0079] For (V), pigs with the SNP marker having the genotype G / G are mutated to the G / A genotype through site-directed mutagenesis;

[0080] For (VI), pigs with the SNP marker having the genotype C / T or T / T are mutated to the C / C genotype through site-directed mutagenesis.

[0081] For pigs whose SNP markers in (VII) have a genotype of T / A, the T / A genotype is mutated to the T / T genotype by site-directed mutagenesis.

[0082] For (VIII), pigs with the SNP marker having the genotype G / A or A / A are mutated to the G / G genotype through site-directed mutagenesis.

[0083] For (IX), pigs with the SNP marker having the genotype A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype through site-directed mutagenesis;

[0084] For (X), pigs with the SNP marker having the genotype T / T are mutated to the T / C genotype through site-directed mutagenesis;

[0085] For (XⅠ), pigs with the SNP marker having the genotype T / C or C / C, the T / C or C / C genotype is mutated to the T / T genotype through site-directed mutagenesis;

[0086] For pigs whose SNP markers described in (XII) have genotypes of G / A or A / A, the G / A or A / A genotypes are mutated to G / G genotypes by site-directed mutagenesis.

[0087] For (XIII), pigs with the SNP marker having the genotype C / A or A / A are mutated to the C / C genotype through site-directed mutagenesis.

[0088] For (XIV), pigs with the SNP marker having the genotype C / T or T / T are mutated to the C / C genotype through site-directed mutagenesis.

[0089] For (XV), pigs with the SNP marker having the genotype C / T or T / T are mutated to the C / C genotype through site-directed mutagenesis.

[0090] The mutation is performed using transgenic methods or gene editing methods.

[0091] The preferred method for mutation is to use the CRISPR / Cas9 gene editing method.

[0092] The present invention has the following advantages and effects compared with the prior art:

[0093] (1) Based on three experimental pig groups of purebred American Landrace pigs, purebred American Large White pigs, and purebred American Duroc pigs, this invention uses whole genome resequencing and GWAS analysis to study and identify 15 SNP markers that significantly affect the purine base content of pigs. At least one of the SNP markers in this invention can be used to detect relevant indicators of pigs, or at least one of these SNP markers can be used to carry out corresponding genetic improvement.

[0094] (2) Based on the SNP marker that affects the purine base content of pigs, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including primers and kits for detecting the SNP marker, methods for identifying the purine base content or meat quality-related traits of pigs or pork, methods for genetic improvement of pigs, etc. When applied to the genetic improvement of purine base content and pork quality-related traits of pigs, it can quickly and accurately select and breed purine base content and pork quality-related traits of pigs, significantly accelerating the breeding process.

[0095] (3) This invention uses molecular breeding to solve the problem of high adenine, hypoxanthine and total purine content or low guanine content. By selecting the dominant alleles of the above-mentioned SNP markers, the frequency of dominant alleles can be increased generation by generation, the purine content can be reduced or increased, the progress of pig genetic improvement can be accelerated, and the economic benefits of breeding pigs can be effectively improved. Attached Figure Description

[0096] Figure 1 This is a Manhattan plot of GWAS analysis of the guanine base content trait on different chromosomes in the experimental population; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log[missing value] of the molecular marker site. 10 (P-value).

[0097] Figure 2 This is a Manhattan plot of GWAS analysis of the adenine base content trait on different chromosomes in the experimental population; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log[missing value] of the molecular marker site. 10 (P-value).

[0098] Figure 3 This is a Manhattan plot of GWAS analysis of hypoxanthine base content traits on different chromosomes in the experimental population; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log value corresponding to the molecular marker site. 10 (P-value).

[0099] Figure 4 This is a Manhattan plot of GWAS analysis of the total purine base content trait on different chromosomes in the experimental population; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log value corresponding to the molecular marker site. 10 (P-value).

[0100] Figure 5 This is a violin plot showing the guanine and adenine base content of different genotypes in the corresponding experimental populations; where the X-axis represents the genotype of the SNP molecular marker locus and the Y-axis represents the base content of the individual.

[0101] Figure 6This is a violin plot showing the hypoxanthine and total purine base content of different genotypes in the corresponding experimental populations; where the X-axis represents the genotype of the SNP molecular marker locus and the Y-axis represents the base content of the individual. Detailed Implementation

[0102] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0103] Unless otherwise specified, the techniques used in the embodiments are conventional techniques well known to those skilled in the art. Unless otherwise stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.

[0104] In the embodiments, guanine bases, adenine bases, and hypoxanthine bases together constitute total purines. Among them, the xanthine base content in pigs is very low and difficult to detect. Therefore, the total purine content in this invention does not include xanthine content.

[0105] In the examples, the standards used for HPLC detection were guanine (CAS: 73-40-5), adenine (CAS: 73-24-5), and hypoxanthine (CAS: 68-94-0), all purchased from Sigma.

[0106] Example 1

[0107] 1. Laboratory animals

[0108] The pig population used in this invention includes: 177 purebred American Landrace pigs, 170 purebred American Large White pigs, and 160 purebred American Duroc pigs.

[0109] All pigs were sourced from Jiangxi Yudu Jiada Livestock Co., Ltd. All pigs were slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. after reaching 200 days of age, in the slaughterhouse's cutting workshop. After slaughter and bleeding, the pigs were dehaired, gutted, and had their heads, tails, and limbs (below the wrists and joints) removed, followed by skinning to obtain white carcasses. Sampling was completed within 30 minutes of slaughter to minimize the impact of post-mortem metabolism on purine base content. The longissimus dorsi muscle (eye muscle) was precisely separated from the left side of the pig carcass between the first and second lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0g of muscle tissue was collected, rapidly transferred to 2mL cryovials, cut into small pieces, and flash-frozen in liquid nitrogen (-196℃). The tissue was then stored at -80℃ in an ultra-low temperature freezer until the experiment.

[0110] 2. HPLC quantitative determination of purine base content in pork

[0111] (1) Accurately weigh 0.2g of ocular muscle tissue and put it into a 15mL centrifuge tube. After cutting it into small pieces, add 2mL of 8% (w / w) perchloric acid solution (which can hydrolyze the purine bases in nucleosides, nucleotides, nucleic acids and other compounds in the sample), and add 1mL of water. Vortex thoroughly to mix.

[0112] (2) Place the sample after mixing in step (1) into a boiling water bath (100°C) and heat for 1 hour, vortexing carefully every 10 minutes; after the sample cools to room temperature, adjust the pH of the system to 3.6 using 2M potassium hydroxide solution and 5% (V / V) formic acid solution, and then dilute the extract to a final volume of 10 mL using ammonium formate buffer (pH=3.6).

[0113] (3) The content of the three purine bases in the extract of each individual was detected by high performance liquid chromatography (HPLC) (unit: mg / 100g). The specific operation was as follows: 10 mL of the extract obtained in step (2) was centrifuged at 3000 rpm for 5 min at 4°C to obtain a clear supernatant, which was then filtered through a 0.22 μm filter membrane and then analyzed by the instrument. The HPLC analysis was performed on an Agilent 1260 Infinity II system (Agilent, USA) equipped with a UV detector and a working wavelength of 254 nm. Sample components were separated on a Waters Atlantis T3 column (4.6 mm × 250.0 mm × 5.0 μm) (Waters, USA); the column temperature was 30°C, and the injection volume for each sample was 10 μL; at each injection, the sample was eluted using a mobile phase consisting of 99% (v / v) 10.0 mmol / L ammonia formate solution (pH=3.6) and 1% (v / v) methanol solution at a constant flow rate of 1.0 mL / min. Concentration data obtained from the HPLC system were converted from the original unit µg / mL to mg / 100g using the following formula:

[0114]

[0115] Where C represents the content of each purine base in 100 grams of pork (mg / 100g), and C0 represents the concentration of purine bases measured by HPLC (µg / mL).

[0116] (4) This invention uses the Wilcoxon rank-sum test in R software (v4.3.1) to compare and analyze the differences in purine base content among the three pig breeds and the differences in purine content between individuals of different sexes within each breed. In addition, the Pearson correlation coefficient is used to calculate the correlation between the two sets of data for each purine phenotype.

[0117] Descriptive statistical results are shown in Table 1. The table shows that there are significant differences in guanine content among the three varieties. Duroc has the highest content, while Large White has the lowest. For hypoxanthine, Duroc has the highest content, while Large White and Long White do not show significant differences. Adenine shows the opposite trend to guanine. Total purine content, as the sum of the three bases, shows a similar trend to hypoxanthine, mainly because hypoxanthine has the highest proportion of total purine content.

[0118] Table 1. Descriptive statistics of four purine phenotypes in three varieties.

[0119]

[0120] Note: LSM, Least Squares Mean; SD, Standard Deviation; CV, Coefficient of Variation (%). a,b,c Different letters indicate significant differences in the same trait between two groups; S_B, slaughter batch; M_B, test batch; ns, P ≥ 0.05; *, P < 0.05; **, P ≤ 0.01; ***, P ≤ 0.001.

[0121] Example 2

[0122] 1. Acquisition, quality control, and genotyping of porcine whole-genome resequencing data

[0123] (1) DNA extraction: Ear tissue samples were collected from each individual in the three experimental pig groups in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.

[0124] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. The clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.

[0125] (3) Sequence alignment: The data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.

[0126] (4) Mutation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, then use Sambamba (v0.8.2) to remove the PCR repeat sequences in the bam format file, and finally use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).

[0127] (5) Variation quality control: Use samtools to perform quality control on the population-level genotype data obtained in step (4). Among them, the variant sites are retained if they meet the condition of "FILTER="PASS"" and the variant detection quality value GQ>20. Further use Plink (v1.9) to perform quality control on the population-level genotype data, and exclude variant sites with a minor allele frequency (MAF) of less than 5% and samples with an individual genotype detection rate (call rate) of less than 80%. Finally, use beagle (r1399) to autofill the genotypes to obtain high-quality genotype data.

[0128] After processing using the methods described above, 2,199,681, 2,258,840, and 1,757,796 mutation sites (including SNPs and Indels) were obtained in Dabai, Changbai, and Duroc, respectively.

[0129] 2. Genome-wide association analysis (GWAS) and meta-analysis

[0130] (1) Genome-wide association analysis was performed on the phenotypic data after confounding correction using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA, v0.98.1). Specifically:

[0131] ① Phenotypic processing: This invention uses the lm() function in R language to perform simple linear regression on gender and batch number, and the corrected residuals are used as the phenotypes for the final association analysis.

[0132] ② The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:

[0133]

[0134] Where y represents the n-dimensional vector of the phenotype (quantitative trait or binary vector) to be analyzed, which in this study is the content of the four purine bases; W represents a matrix consisting of a column of "1"s (n×c dimensions); α represents the effect and intercept vector of the corresponding covariate (c dimensions); x represents the vector of the genotype of the detection locus (n dimensions); β represents the vector of the magnitude of the effect of the detection locus; u represents a vector with a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution; ε indicates that it follows a mean of 0 and a covariance-variance matrix of τ. -1 The residual vector of In (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix, and In represents the n×n identity matrix; MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 0.05 / N (Bonferroni correction) is set, where N is the number of valid SNPs / Indels.

[0135] (2) Using the results of the above GWAS analysis, the purine base content in the three populations was meta-analyzed in METAL software according to conventional methods. The meta-analysis was performed based on the standard error weighting method (SCHEME STDERR).

[0136] This invention is based on GWAS analysis ( Figures 1-4 A total of 15 representative SNP loci were obtained (including those obtained from meta-analysis), and their basic genetic parameters are shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the website did not have the SNP name information for that locus, the SNP name was represented in the form of "chromosome_location". Other important genetic parameters for each representative locus were provided by GWAS analysis using GEMMA software, including the chromosome and location of the locus, alleles, effect size, and p-value (Wald test).

[0137] Table 2. Basic genetic parameters of 15 representative SNP loci in the mixed population.

[0138]

[0139] Note: The meta-analysis integrates genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.

[0140] 3. Analysis of differences in purine base content phenotypes among different genotypes

[0141] Genotypes at displayed molecular marker sites in each of the 507 pigs from three experimental populations were extracted from sequencing files using Plink (v1.9). After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with their corresponding purine base content. Then, the `summarise` function from the `dplyr` package in R was used to statistically analyze the differences in phenotypic distribution among different genotypes. The results are shown in Table 3. Figures 5-6 As shown in the figure. The p-value is obtained from the variance test.

[0142] Table 3. Effects of each molecular marker site on purine base content (unit: mg / 100g)

[0143]

[0144] 4. Heritability analysis

[0145] Heritability is one of the most important fundamental genetic parameters in quantitative genetics, and it can be divided into broad-sense heritability, narrow-sense heritability, and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h0). 2 ), which refers to the proportion of the variance in quantitative trait breeding values ​​to the variance in phenotypic values, is the additive effect portion after eliminating dominant and epistatic effects, and is stably inherited during generational transmission. This invention estimates single-marker heritability based on the effect value (β) and its standard error (SE) of each locus in the GWAS results file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the whole-genome level. The specific calculation formula is as follows:

[0146]

[0147] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.

[0148] As shown in Table 4, the heritability estimates for all phenotypes are at a moderate level, roughly ranging from 0.32 to 0.36.

[0149] Table 4. Heritability estimates of the four phenotypes in the three experimental populations (h) 2 )

[0150]

[0151] Example 3

[0152] This embodiment provides a specific method and process for detecting SNP markers in Embodiment 2. Specifically, taking SNP markers rs331794591, 9_1627202, and rs339018821 as examples, their corresponding phenotypes are guanine base content, hypoxanthine base content, and total purine base content, respectively. The specific method is as follows:

[0153] 1. Primer design

[0154] (1) The target fragment containing the SNP site (rs331794591) that is significantly correlated with the purine base content of American Landrace pigs is a 257 bp nucleotide sequence (SEQ ID NO:1) from chromosome 2. The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and its nucleic acid sequence is as follows:

[0155] Upstream primer-F1: 5'-AGTGGCTGAGCAGAGTTGTC-3' (SEQ ID NO:4);

[0156] Downstream primer primer-R1: 5'-ATTGCCCCGTGCGTAAAATG-3' (SEQ ID NO:5).

[0157] (2) The target fragment containing the SNP site (9_1627202) that is significantly associated with the hypoxanthine base content of American Landrace pigs is a 294bp nucleotide sequence (SEQ ID NO:2) on chromosome 9. The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and its nucleic acid sequence is as follows:

[0158] Upstream primer-F2: 5'-GGAGTCCTCTAAGCATCACTGG-3' (SEQ ID NO:6);

[0159] Downstream primer primer-R2: 5'-ATTCCCATTTCCCTCAACAGGAA-3' (SEQ ID NO:7).

[0160] (3) The target fragment containing the SNP site (rs339018821) that is significantly correlated with the total purine base content of American Landrace pigs is a 215bp nucleotide sequence (SEQ ID NO:3) on chromosome 8. The upstream and downstream primers for sequence amplification are primer-F3 and primer-R3, and their nucleic acid sequences are as follows:

[0161] Upstream primer primer-F3: 5'-GCGCCTTGGGTTTCTTGTCT-3' (SEQ ID NO:8);

[0162] Downstream primer primer-R3: 5'-CAACAGAGTGATGCTTCGCA-3' (SEQ ID NO:9).

[0163] 2. PCR amplification

[0164] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-60℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.

[0165] 3. DNA sequencing

[0166] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites.

[0167] SEQ ID No:1 (chr2:9130320-9130577):

[0168] AGTGGCTGAGCAGAGTTGTCTCAGAGTCTGTACAGGCCTCTGGACACCTGAATTATTCGTTCTCATCCTGTCCTGGGCCTCTCCTTTATT M (T > C)

[0169] TCTAAAGAGAGATTGTCACCTTATCATCTAATGACTGTCATCTCTGGAATTCACCTGTCCCTTTCCTTTCCTCTTGAGCGATGATAAGGACCTTCTTGCGCAAGCTTTCAGAGCCCTCCCTGGACGGGGGATGTACCTTCTGGATACATTTTACGCACGGGGCAAT

[0170] SEQ ID No:2 (chr9:1627162-1627456):

[0171] GGAGTCCTCTAAGCATCACTGGTGTGACTGATGTGGAAA M (A > T)

[0172] ACCACTGTCTACTGAAGCCAAATGGCCAAGGAAGAGGTACATGGGGGTGTGAAGCTGGGGACAGCTTTTTTAAAAGAATTATGCTGACATTGCCTACTAAGGTGACAACATAAATGCCTAGAAAT ATCACAAAGCAGATGACACCAAGCACAGGATCCTCCGTGAGCCCCAAAAGGATGAACTCTGTCACACTGCTGTGGTTTCCAGCCTCCATCTCTCCTGTGGGTTGTTCCTGTTGAGGGAAATGGGAAT

[0173] SEQIDNo:3 (chr8:120820047-120820262):

[0174] GCGCCTTGGGTTTCTTGTCTCTTTAGAGCATGTTAGAGTTACTAGGTACCACCCATTCTCCAGACAGGTGCCATATTTGACTCAGCCAGGCAGAGAA M (A > G)

[0175] CCGTTGAGAAGTAGCATAGCAATGACGTCCCTGACACCCACTGCAGCCACCGCTCTTAAGTAAGCTATTATTTCACATCACAGAAGCAGCTGTGATTTGCGAAGCATCACTCTGTTG

[0176] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The primer binding position is indicated by bolding at the beginning and end of the sequence.

[0177] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Use of a SNP locus affecting pig purine base content in the identification of pig or pork purine base content, or in the genetic breeding of pig purine base content, characterized in that The SNP site comprises at least one of the following: (I) the SNP site corresponds to a T>C mutation at position 9130411 on chromosome 2 of the International Pig Genome 11.1 version; (II) the SNP site corresponds to a C>T mutation at position 111047325 on chromosome 8 of the International Pig Genome 11.1 version; (III) the SNP site corresponds to a T>C mutation at position 59962069 on chromosome 12 of the International Pig Genome 11.1 version; (IV) the SNP site corresponds to an A>G mutation at position 64561163 on chromosome 2 of the International Pig Genome 11.1 version; (V) the SNP site corresponds to a T>C mutation at position 15496193 on chromosome 15 of the International Pig Genome 11.1 version; (VI) the SNP site corresponds to an A>T mutation at position 1627202 on chromosome 9 of the International Pig Genome 11.1 version; (VII) the SNP site corresponds to an A>G mutation at position 28473456 on chromosome 17 of the International Pig Genome 11.1 version; (VIII) the SNP site corresponds to a G>A mutation at position 223710348 on chromosome 1 of the International Pig Genome 11.1 version; (IX) the SNP site corresponds to a C>T mutation at position 63901107 on chromosome 2 of the International Pig Genome 11.1 version; (X) the SNP site corresponds to a C>T mutation at position 121459275 on chromosome 7 of the International Pig Genome 11.1 version; (XI) the SNP site corresponds to an A>G mutation at position 120820145 on chromosome 8 of the International Pig Genome 11.1 version; (XII) the SNP site corresponds to an A>C mutation at position 119883227 on chromosome 15 of the International Pig Genome 11.1 version; (XIII) the SNP site corresponds to a T>C mutation at position 28461000 on chromosome 17 of the International Pig Genome 11.1 version; For (I)-(II), the pig is a US long white pig; the purine base is guanine; For (III), the pig is a US large white pig; the purine base is guanine; For (IV) and (V), the pig is a US long white pig; the purine base is adenine; For (VI) and (VII), the pig is a US long white pig; the purine base is hypoxanthine; For (VIII)-(XIII), the pig is a US long white pig; the purine base is total purine.

2. The use according to claim 1, characterized in that: For (I), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 1, and the base is T or C; For (VI), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 2, and the base is A or T; For (XI), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 3, and the base is A or G.

3. Use of a primer combination for detecting a SNP site affecting pig purine base content in identifying pig or pork purine base content or pig purine base content genetic breeding, characterized in that The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, the nucleotide sequences of which are shown in SEQ ID NO: 4-9; The SNP site is the SNP site (I), (VI) or (XI) as described in claim 1, and the pig is a Landrace pig.

4. Use of a kit for detecting a SNP site affecting the purine base content of a pig in the identification of the purine base content of a pig or pork or in the genetic breeding of the purine base content of a pig, characterized in that The kit comprises the primer combination as described in claim 3; The SNP site is the SNP site (I), (VI) or (XI) as described in claim 1, and the pig is a Landrace pig.

5. A method of genetic improvement of swine, characterized in that, Comprising the following steps: Determining the SNP site genotypes of the breeding pigs in the breeding pig core group, and making a corresponding selection according to the SNP site genotypes: the SNP site is as described in claim 1 or 2; For (I), selecting from the breeding pig core group a breeding pig individual having a C / T or C / C genotype at position 9130411 on chromosome 2 of the international pig genome version 11.1, and eliminating a breeding pig individual having a T / T genotype at this position, so as to increase the frequency of allele C at this position from generation to generation; For (II), selecting from the breeding pig core group a breeding pig individual having a T / C or C / C genotype at position 111047325 on chromosome 8 of the international pig genome version 11.1, and eliminating a breeding pig individual having a T / T genotype at this position, so as to increase the frequency of allele C at this position from generation to generation; For (III), selecting from the breeding pig core group a breeding pig individual having a C / C genotype at position 59962069 on chromosome 12 of the international pig genome version 11.1, and eliminating a breeding pig individual having a C / T genotype at this position, so as to increase the frequency of allele C at this position from generation to generation; For (IV), selecting from the breeding pig core group a breeding pig individual having a G / A genotype at position 64561163 on chromosome 2 of the international pig genome version 11.1, and eliminating a breeding pig individual having a G / G genotype at this position, so as to increase the frequency of allele A at this position from generation to generation; For (V), selecting from the breeding pig core group a breeding pig individual having a C / C or C / T genotype at position 15496193 on chromosome 15 of the international pig genome version 11.1, and eliminating a breeding pig individual having a T / T genotype at this position, so as to increase the frequency of allele C at this position from generation to generation; For (VI), selecting from the breeding pig core group a breeding pig individual having a T / T genotype at position 1627202 on chromosome 9 of the international pig genome version 11.1, and eliminating a breeding pig individual having a T / A genotype at this position, so as to increase the frequency of allele T at this position from generation to generation; For (VII), selecting from the breeding pig core group a breeding pig individual having a G / G or G / A genotype at position 28473456 on chromosome 17 of the international pig genome version 11.1, and eliminating a breeding pig individual having an A / A genotype at this position, so as to increase the frequency of allele G at this position from generation to generation; For (VIII), selecting swine individuals with A / A or A / G genotype at position 223710348 on chromosome 1 of the international pig genome version 11.1 from the swine core group, and eliminating swine individuals with G / G genotype at the position to increase the frequency of allele A at the position generation by generation; For (IX), selecting swine individuals with T / C genotype at position 63901107 on chromosome 2 of the international pig genome version 11.1 from the swine core group, and eliminating swine individuals with T / T genotype at the position to increase the frequency of allele C at the position generation by generation; For (X), selecting swine individuals with T / T or T / C genotype at position 121459275 on chromosome 7 of the international pig genome version 11.1 from the swine core group, and eliminating swine individuals with C / C genotype at the position to increase the frequency of allele T at the position generation by generation; For (XI), selecting swine individuals with G / G or G / A genotype at position 120820145 on chromosome 8 of the international pig genome version 11.1 from the swine core group, and eliminating swine individuals with A / A genotype at the position to increase the frequency of allele G at the position generation by generation; For (XII), selecting swine individuals with C / C or C / A genotype at position 119883227 on chromosome 15 of the international pig genome version 11.1 from the swine core group, and eliminating swine individuals with A / A genotype at the position to increase the frequency of allele C at the position generation by generation; For (XIII), selecting swine individuals with C / C or C / T genotype at position 28461000 on chromosome 17 of the international pig genome version 11.1 from the swine core group, and eliminating swine individuals with T / T genotype at the position to increase the frequency of allele C at the position generation by generation; For (I)-(II), the pigs are American Landrace pigs; For (III), the pigs are American Large White pigs; For (IV)-(XIII), the pigs are American Landrace pigs.

6. A method of identifying the purine base content of a pig or pork, characterized by Comprising the following steps: Determining the SNP site genotype of the pig or pork, and determining the purine base content of the pig or pork according to the SNP site genotype, wherein the SNP site is as described in claim 1 or 2; For (I), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 9130411 on chromosome 2 of the international pig genome version 11.1, in the order of C / C genotype, C / T genotype, T / T genotype; For (II), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 111047325 on chromosome 8 of the international pig genome version 11.1, in the order of C / C genotype, T / C genotype, T / T genotype; For (III), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 59962069 on chromosome 12 of the international pig genome version 11.1, in the order of C / C genotype, C / T genotype; For (IV), the pig or pork purine base content from high to low, with the genotype of 64561163 on chromosome 2 of the international pig genome 11.1 version, in turn: G / G genotype, G / A genotype; For (V), the pig or pork purine base content from high to low, with the genotype of 15496193 on chromosome 15 of the international pig genome 11.1 version, in turn: T / T genotype, C / T genotype, C / C genotype; For (VI), the pig or pork purine base content from high to low, with the genotype of 1627202 on chromosome 9 of the international pig genome 11.1 version, in turn: T / A genotype, T / T genotype; For (VII), the pig or pork purine base content from high to low, with the genotype of 28473456 on chromosome 17 of the international pig genome 11.1 version, in turn: A / A genotype, G / A genotype, G / G genotype; For (VIII), the pig or pork purine base content from high to low, with the genotype of 223710348 on chromosome 1 of the international pig genome 11.1 version, in turn: G / G genotype, A / G genotype, A / A genotype; For (IX), the pig or pork purine base content from high to low, with the genotype of 63901107 on chromosome 2 of the international pig genome 11.1 version, in turn: T / T genotype, T / C genotype; For (X), the pig or pork purine base content from high to low, with the genotype of 121459275 on chromosome 7 of the international pig genome 11.1 version, in turn: C / C genotype, T / C gene, T / T genotype; For (XI), the pig or pork purine base content from high to low, with the genotype of 120820145 on chromosome 8 of the international pig genome 11.1 version, in turn: A / A genotype, G / A genotype, G / G genotype; For (XII), the pig or pork purine base content from high to low, with the genotype of 119883227 on chromosome 15 of the international pig genome 11.1 version, in turn: A / A genotype, C / A genotype, C / C genotype; For (XIII), the pig or pork purine base content from high to low, with the genotype of 28461000 on chromosome 17 of the international pig genome 11.1 version, in turn: T / T genotype, C / T genotype, C / C genotype; For (I)-(II), the pig is American long white pig; For (III), the pig is American large white pig; For (IV)-(XIII), the pig is American long white pig.

Citation Information

Patent Citations

  • Pork quality trait related gene DGAT1 and application thereof in porcine marker-assisted selection

    CN101824416A

  • SNP (Single Nucleotide Polymorphism) marker for influencing total purine content in pork

    CN114196762A