A SNP molecular marker primer composition related to the horn length of sheep and application thereof

By providing SNP molecular markers and primer combinations related to sheep horn length, the genotype of sheep with long horns can be accurately identified, solving the problem of screening for sheep with long horns in existing technologies and realizing the precision of early breeding and the optimization of breeding management.

CN120818613BActive Publication Date: 2026-01-27INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511336254.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2026-01-27
Estimated Expiration
2045-09-18

AI Technical Summary

Technical Problem

The lack of SNP molecular markers related to sheep horn length in existing technologies makes it difficult to accurately screen sheep individuals with ideal horn lengths, affecting breeding efficiency and survival adaptability.

Method used

Two SNP molecular markers (Marker51324863 and Marker51328863) associated with sheep horn length and their specific primer combinations P1 and P2 were provided. The horn length genotype of sheep was accurately identified by PCR amplification and fluorescence signal detection.

Benefits of technology

This technology enables early and accurate identification of the horn-length genotype in sheep, breaking through the bottleneck of traditional breeding that relies on post-maturity phenotypic measurement, optimizing breeding management, and improving the population's resilience and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120818613B_ABST
    Figure CN120818613B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker primer composition related to the horn length of sheep and application thereof, and belongs to the technical field of molecular biology. The application provides two SNP molecular markers Marker51324863 and Marker51328863 related to the horn length of sheep. Marker51324863 is located at a 51324863 locus on a 19th chromosome of a sheep reference genome ARS-UI_Ramb_v2.0, and the polymorphism is T / G; Marker51328863 is located at a 51328863 locus on the 19th chromosome, and the polymorphism is T / C. The application further provides a primer set for amplifying the two SNP molecular markers, and the SNP molecular marker primer set provided by the application can be used for quickly, accurately and efficiently identifying the horn length of sheep, and selectively breeding according to environmental adaptability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to SNP molecular marker primer compositions related to sheep horn length and their applications. Background Technology

[0002] In the field of animal morphology, the study of horn length has not received sufficient attention compared to other physiological characteristics, and research reports on this topic both domestically and internationally are relatively limited. As a prominent external feature, animal horns, besides serving as weapons in combat, may also be closely related to many factors such as sexual selection and environmental adaptation. In nature, most animals have moderately long or small horns; however, some special animal species, such as certain wild animal species and some ruminants in high-altitude environments, possess unusually long horns. Long horns may help gain an advantage in territorial disputes or intraspecific competition, especially in relatively vast and fiercely competitive environments. Long-horned animals can use the prominence of their horns to intimidate opponents and attract mates, thus gaining more opportunities in reproduction and survival competition. Simultaneously, the specificity of horn length and structure may also have a potential connection to an animal's perception of its surroundings and its regulation of its own balance.

[0003] In the specific species of sheep, differences in horn length are also a product of adaptive evolution. Traditionally, sheep horns were considered to be of moderate length, but in-depth observation of different breeds has revealed significant differences in horn length. These differences are likely influenced by a combination of factors, including the sheep's living environment, genetic makeup, and long-term human breeding selection. Sheep with moderately long horns may have achieved a relative balance in survival and reproduction, while sheep with excessively long or short horns may exhibit unique advantages and disadvantages under specific environmental conditions. For example, in complex and varied terrain, excessively long horns may hinder a sheep's movement, affecting its efficiency in avoiding predators and foraging for food; while in scenarios where horn display is necessary to compete for mates or territory, moderate horn length may be insufficient to meet the demands of survival competition.

[0004] With the rapid development of molecular biology and genomics technologies, marker-assisted animal breeding has become a reality. In-depth research into the genetic mechanisms of sheep horn length can not only reveal the genetic mysteries behind horn length variations but also play a crucial role in sheep breeding practices, namely, precisely selecting sheep individuals with ideal horn length characteristics to better adapt to specific ecological environments and meet the production and management requirements of animal husbandry. Therefore, genetic research on sheep horn length has significant practical application value and potential scientific research significance; however, detailed reports on this topic remain relatively scarce. Summary of the Invention

[0005] The main objective of this invention is to provide a SNP molecular marker related to sheep horn length. Using this SNP molecular marker, gene selection can be performed precisely, thereby efficiently breeding sheep with ideal horn lengths, thus overcoming the technical deficiency of the prior art in lacking SNP molecular markers directly related to sheep horn length.

[0006] The present invention employs the following technical solutions to achieve the above objectives:

[0007] The first aspect of the present invention provides two SNP molecular markers related to sheep horn length, including Marker51324863 and Marker51328863;

[0008] The marker 51324863 is located at locus 51324863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0; the polymorphism of the marker 51324863 is T / G; sheep with the genotype GG at locus 51324863 on chromosome 19 are large-horned sheep; sheep with the genotype TG at locus 51324863 on chromosome 19 are small-horned sheep;

[0009] The marker 51328863 is located at locus 51328863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0; the polymorphism of the marker 51328863 is T / C; sheep with the TT gene at locus 51328863 on chromosome 19 are large-horned sheep; sheep with the CT gene at locus 51328863 on chromosome 19 are small-horned sheep.

[0010] A second aspect of the present invention provides primer sets for detecting the two SNP molecular markers related to sheep horn length, wherein the primer sets consist of primer combination P1 and primer combination P2, wherein each primer combination consists of two forward primers F1 and F2 with different 3' terminal bases and a reverse primer R:

[0011] Primer combination P1: This primer combination P1 is used to amplify Marker 51324863 and consists of forward primer F1 with the nucleotide sequence shown in SEQ ID NO. 1, forward primer F2 with the nucleotide sequence shown in SEQ ID NO. 2, and reverse primer R with the nucleotide sequence shown in SEQ ID NO. 3. The nucleotide sequence of the PCR amplification product is shown in SEQ ID NO. 7. In the nucleotide sequence shown in SEQ ID NO. 7, K is T or G, and K is located at nucleotide position 51324863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0.

[0012] Primer combination P2: This primer combination P2 is used to amplify Marker 51328863 and consists of forward primer F1 with nucleotide sequence SEQ ID NO. 4, forward primer F2 with nucleotide sequence SEQ ID NO. 5, and reverse primer R with nucleotide sequence SEQ ID NO. 6. The nucleotide sequence of the PCR amplification product is shown in SEQ ID NO. 8. In the nucleotide sequence shown in SEQ ID NO. 8, Y is T or C, and Y is located at nucleotide position 51328863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0.

[0013] Furthermore, the 5' end of each forward primer F1 is connected to the FAM-tail universal fluorescent tag sequence, and the 5' end of each forward primer F2 is connected to the HEX-tail universal fluorescent tag sequence.

[0014] A third aspect of the present invention provides a detection kit containing the above-described primer set for detecting SNP molecular markers related to sheep horn length.

[0015] The fourth aspect of the present invention provides any of the following applications of the above-described primer set and the above-described detection kit:

[0016] (1) Application in sheep horn length determination;

[0017] (2) Application in molecular marker-assisted breeding of sheep.

[0018] The fifth aspect of the present invention provides a method for identifying sheep horn length, the method comprising: using the DNA of the sheep to be tested as a template, performing PCR amplification on it using the primer combination P1 or primer combination P2; directly distinguishing genotypes and the correlation between the genotypes and sheep horn length by fluorescence signals, thereby identifying sheep horn length.

[0019] Furthermore, when primer combination P1 is used, the genotypes include GG genotype and TG genotype, wherein sheep with genotype GG are large-horned sheep; sheep with genotype TG are small-horned sheep.

[0020] Furthermore, when primer combination P2 is used, the genotypes include TT genotype and CT genotype, wherein sheep with genotype TT are large-horned sheep; sheep with genotype CT are small-horned sheep.

[0021] The beneficial effects of this invention are:

[0022] Sheep horn length is closely related to their survival adaptability and husbandry management: large-horned individuals in free-range environments can effectively resist predator attacks through horn defense, reducing the risk of lambs being preyed upon, while the small-horned phenotype significantly reduces the mortality rate caused by fighting in intensive farming, while also optimizing the utilization of pen space. Using the SNP molecular markers provided by this invention, horn length-related genotypes can be accurately identified during the lambing stage, overcoming the technical bottleneck of traditional breeding methods that rely on post-maturity phenotypic measurements. These markers support early selection of breeding sheep with target horn length characteristics, enabling targeted breeding of adaptable strains for different farming models (such as highland grazing and factory farming), and reducing ineffective feeding costs through genotyping. Furthermore, the marker data can deeply analyze the molecular regulatory network of horn development, providing cross-dimensional genetic information for sheep disease resistance breeding and behavioral characteristic research, ultimately achieving synergistic optimization of population resilience and livestock economic benefits. Attached Figure Description

[0023] Figure 1 This is the genotyping diagram from Example 1.

[0024] Figure 2 Box plot showing the association between SNPs and sheep horn length phenotype in Example 1.

[0025] Figure 3 This is the genotyping diagram from Example 2.

[0026] Figure 4 Box plot showing the association between SNPs and sheep horn length phenotype in Example 2. Detailed Implementation

[0027] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0028] Explanation of the sequence listing: Underlined bases indicate polymorphic SNP sites.

[0029] SEQ ID NO. 1:

[0030] GAAGGTCGGAGTCAACGGATTGCGATTCGCTTCAGCTCA

[0031] SEQ ID NO. 2:

[0032] GAAGGTGACCAAGTTCATGCTGCGATTCGCTTCAGCTCC

[0033] SEQ ID NO.3: ACTCCAGGCATCAAGAATGCT

[0034] SEQ ID NO. 4:

[0035] GAAGGTCGGAGTCAACGGATTCTACCAGTTCTCACAACCGCA

[0036] SEQ ID NO. 5:

[0037] GAAGGTGACCAAGTTCATGCTACCAGTTCTCACAACCGCG

[0038] SEQ ID NO. 6:

[0039] GTGTGGCTGGTGTGGACG

[0040] Example 1: Identification of sheep horn length using the SNP molecular marker chr19: 51324863

[0041] 1. Experimental subjects: A total of 35 small-tailed Han sheep were selected (Table 3).

[0042] 2. SNP molecular marker detection:

[0043] (1) Collect 5 mL of sheep venous blood and extract DNA using the traditional CTAB method. Calculate the DNA stock solution based on the concentration and mix it with nuclease-free water to dilute it to 20 ng / ul. Dilute the primer powder to 100 uM with nuclease-free water and then prepare the primer mixture according to the ratio of F1:F2:R:water = 24:24:48:100.

[0044] Forward primer F1 (SEQ ID NO. 1):

[0045] GAAGGTCGGAGTCAACGGATTGCGATTCGCTTCAGCTCA;

[0046] Forward primer F2 (SEQ ID NO. 2):

[0047] GAAGGTGACCAAGTTCATGCTGCGATTCGCTTCAGCTCC;

[0048] Reverse primer R (SEQ ID NO. 3):

[0049] ACCTCAGGCATCAAGAATGCT.

[0050] (2) Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using specific primers for SNP molecular markers. The amplification system is shown in Table 1, and the amplification program is shown in Table 2. The PCR products were obtained.

[0051] Table 1 PCR amplification system

[0052]

[0053] Table 2 PCR amplification program

[0054]

[0055] (3) After the PCR amplification cycle, the fluorescence value was read using a real-time PCR instrument at a temperature below 40°C. The PCR products were then sequenced, and the sequencing results were analyzed using LGC_OMEGA's genotype reading software (Kluster Caller). Based on the sample cluster and fluorescence type, the genotypes were divided into two types: GG and TG. Figure 1 As shown.

[0056] (4) Result determination: Based on different genotypes, the sheep horn length is determined to be either large-horned or small-horned; sheep with genotype GG are large-horned; sheep with genotype TG are small-horned.

[0057] Table 3. Marking and identification of 35 Small-tailed Han sheep

[0058]

[0059] Because phenotypic measurements of the homozygous mutant (TT) group were lacking, only the GG and TG genotypes were included in the genotype-phenotype association analysis. SNP correlation analysis for sheep horn length is as follows: Figure 2 As shown, sheep with the genotype GG at locus 51324863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0 have large horns, with an average horn length of 28.1 cm; sheep with the genotype TG at locus 51324863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0 have small horns, with an average horn length of 12.3 cm. The difference in horn length based on genotype is highly significant.

[0060] Example 2: Identification of sheep horn length using the SNP molecular marker chr19: 51328863

[0061] 1. Experimental subjects: A total of 35 small-tailed Han sheep were selected (Table 4).

[0062] 2. SNP molecular marker detection:

[0063] (1) Collect 5 mL of sheep venous blood and extract DNA using the traditional CTAB method. Calculate the DNA stock solution based on the concentration and mix it with nuclease-free water to dilute it to 20 ng / ul. Dilute the primer powder to 100 uM with nuclease-free water and then prepare the primer mixture according to the ratio of F1:F2:R:water = 24:24:48:100.

[0064] Forward primer F1 (SEQ ID NO. 4):

[0065] GAAGGTCGGAGTCAACGGATTCTACCAGTTCTCACAACCGCA;

[0066] Forward primer F2 (SEQ ID NO. 5):

[0067] GAAGGTGACCAAGTTCATGCTACCAGTTCTCACAACCGCG;

[0068] Reverse primer R (SEQ ID NO. 6):

[0069] GTGTGGCTGGTGTGGACG.

[0070] (2) Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using specific primers for SNP molecular markers. The amplification system is shown in Table 1, and the amplification program is shown in Table 2. The PCR products were obtained.

[0071] (3) After the PCR amplification cycle, the fluorescence value was read using a real-time PCR instrument at a temperature below 40°C. The PCR products were then sequenced, and the sequencing results were analyzed using LGC_OMEGA's genotype reading software (Kluster Caller). Based on the sample cluster and fluorescence type, the genotypes were divided into two types: TT and CT. Figure 3 As shown.

[0072] (4) Result determination: Based on different genotypes, the sheep horn length is determined to be either large-horned or small-horned; sheep with genotype TT are large-horned; sheep with genotype CT are small-horned.

[0073] Table 4. Marking and identification of 35 Small-tailed Han sheep

[0074]

[0075] Because phenotypic measurements of the homozygous mutant (CC) group were lacking, only the TT and CT genotypes were included in the genotype-phenotype association analysis. SNP correlation analysis for sheep horn length is as follows: Figure 4As shown, sheep with the TT gene at locus 51328863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0 have large horns, with an average horn length of 28.1 cm; sheep with the CT gene at locus 51328863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0 have small horns, with an average horn length of 12.3 cm. The difference in horn length based on genotype is highly significant.

Claims

1. A primer set for detecting SNP molecular markers related to sheep horn length, characterized in that, The primer set consists of primer combination P1 and primer combination P2, wherein each primer combination consists of two forward primers F1 and F2 with different 3' terminal bases and one reverse primer R: Primer combination P1: This primer combination P1 is used to amplify SNP site 1, and consists of forward primer F1 with nucleotide sequence SEQ ID NO. 1, forward primer F2 with nucleotide sequence SEQ ID NO. 2, and reverse primer R with nucleotide sequence SEQ ID NO. 3; the allelic variation base of SNP site 1 is T / G, which is located at position 51324863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.0; Primer combination P2: This primer combination P2 is used to amplify SNP site 2, and consists of forward primer F1 with nucleotide sequence SEQ ID NO. 4, forward primer F2 with nucleotide sequence SEQ ID NO. 5, and reverse primer R with nucleotide sequence SEQ ID NO. 6; the allelic variation base of the SNP site 2 is T / C, which is located at position 51328863 on chromosome 19 of the sheep reference genome ARS-UI_Ramb_v2.

0.

2. The primer set according to claim 1, characterized in that, Each forward primer F1 has a 5'-end linked to a FAM-tail universal fluorescent tag sequence, and each forward primer F2 has a 5'-end linked to a HEX-tail universal fluorescent tag sequence.

3. A detection kit containing the primer set described in claim 1 for detecting SNP molecular markers related to sheep horn length.

4. The application of the primer set described in claim 1 and the detection kit described in claim 3 in the identification of sheep horn length, characterized in that, The sheep in question are small-tailed Han sheep.

5. A method for determining the horn length of the Small-tailed Han sheep, characterized in that, The method includes: using the DNA of the sheep to be tested as a template, performing PCR amplification on it using primer combination P1 or primer combination P2 as described in claim 1; directly distinguishing the genotype and the correlation between the genotype and the horn length of the small-tailed Han sheep by fluorescence signal, and identifying the horn length of the small-tailed Han sheep.

6. The method according to claim 5, characterized in that, When primer combination P1 is used, the genotypes include GG genotype and TG genotype, wherein the small-tailed Han sheep with genotype GG is a large-horned sheep; and the small-tailed Han sheep with genotype TG is a small-horned sheep.

7. The method according to claim 5, characterized in that, When primer combination P2 is used, the genotypes include TT genotype and CT genotype, wherein the small-tailed Han sheep with genotype TT is a large-horned sheep; and the small-tailed Han sheep with genotype CT is a small-horned sheep.

Citation Information

Patent Citations

  • SNP marker related to sheep multi-horn character and application thereof

    CN105603092A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to horn length of sheep and application of SNP molecular marker

    CN118480611A