Metabolic pathway of clerodane diterpenoids

By analyzing the metabolic pathway of crotonyl diterpenoids in Salvia splendens, identifying cytochrome P450 enzymes, and using yeast strain AM119 to ferment and produce annonene, hardwickiic acid, and hautriwaic acid, the problems of the unresolved genome of Salvia divinorum and the side effects of existing anesthetics were solved, and safe and efficient synthesis of crotonyl diterpenoids was achieved.

CN120829892APending Publication Date: 2025-10-24CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410458211.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-04-17
Publication Date
2025-10-24

AI Technical Summary

Technical Problem

The genome sequencing of Salvia divinorum has not yet been published, and other metabolic steps in the salvinorin A synthesis pathway have not been fully explored. In addition, existing narcotic analgesics such as morphine have side effects such as addiction and respiratory depression, and there is a lack of safe and effective alternative drugs.

Method used

By analyzing the metabolic pathway of crotonane-type diterpenoids in the ornamental plant Salvia splendens, cytochrome P450 enzymes such as SsANS, SsHDAS, SsHTAS and SdANS, SdHDAS were identified, and a gene set of the metabolic pathway of crotonane-type diterpenoids was constructed. The yeast strain AM119 was used to ferment and produce annonene, hardwickiic acid, hautriwaic acid and divinatorin A.

Benefits of technology

The synthesis steps of salvinorin A were elucidated quickly, providing a basis for safe and non-addictive analgesic drugs, solving the side effect problem of existing drugs, and achieving the efficient biosynthesis of crotonyl-type diterpenoid compounds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004794858620000021
    Figure BDA0004794858620000021
  • Figure BDA0004794858620000121
    Figure BDA0004794858620000121
  • Figure BDA0004794858620000131
    Figure BDA0004794858620000131
Patent Text Reader

Abstract

The invention discloses a metabolic pathway of a clerodane type diterpenoid compound. The metabolic pathway is characterized in that related metabolic genes in the biosynthesis process of annonene, hardwickic acid, hatriwaic acid and divinatorin A are analyzed. The invention further discloses a preparation method of the clerodane type diterpenoid compound, and application of the clerodane type diterpenoid compound in the biosynthesis process of the clerodane type diterpenoid compound in the biosynthesis process of the clerodane type diterpenoid compound. The invention also verifies the function of some cytochrome P450 enzymes in the aspect of producing the clerodane diterpenoid compounds by utilizing the fermentation of yeast engineering bacteria, and lays a foundation for the industrialization of the clerodane diterpenoid compounds and intermediates of the clerodane diterpenoid compounds.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biosynthesis, and particularly relates to a metabolic pathway of a clerodendran-type diterpenoid compound and its use in synthetic biology. BACKGROUND

[0002] Salvia divinorum is a plant of the Labiatae family, and its effective component is a clerodendran-type diterpenoid compound salvinorin A. Salvinorin A is a strong hallucinogen. At present, the genome sequencing of Salvia divinorum has not been published, and only the type II diterpene synthase in the salvinorin A synthesis pathway has been reported in the literature. The other metabolic steps of the salvinorin A pathway still need to be further explored.

[0003] The popular narcotic analgesic drugs on the market at present are morphine, dolantin, morphine, etc. which achieve analgesic effect by acting on the MOR receptor, but also have obvious shortcomings such as addiction and respiratory depression. In contrast, salvinorin A targets the KOR receptor to produce analgesic effect, and has no addiction and side effects such as respiratory depression. In addition, hardwickiic acid and hautriwaic acid are also reported to have analgesic effect. The clerodendran-type diterpenoid compound salvinorin A and its intermediates hardwickiic acid, hautriwaic acid, etc. can be used as a lead drug to provide a basis for designing high-efficiency and safe drugs in the future. SUMMARY

[0004] In the study of biosynthesis of clerodendran-type diterpenoids, we found that ornamental plants Salvia splendens contain more clerodendran-type diterpenoids, among which salviarin (salvia) is structurally similar to salvinorin A of Salvia divinorum, and the genome sequence of Salvia splendens has been published on NCBI. It is no doubt that the analysis of the metabolic pathway of salviarin will accelerate the elucidation of the synthesis steps of salvinorin A. At present, three different CYP450s in the metabolic pathway of Salvia splendens have been identified: SsANS, SsHDAS, and SsHTAS, which catalyze the products annone, hardwickiic acid, and hautriwaic acid (chrysophanic acid). Based on the above results, further analysis of the transcriptome of Salvia divinorum identified three CYP450s in the salvinorin A metabolic pathway of Salvia divinorum: SdANS, SdHDAS, and SdDAS, which together catalyze the formation of hardwickiic acid (left-handed haussknechtia acid, precursor of salvinorin A) and divinatorin A, providing an experimental basis for further analysis of the biosynthetic pathway of salvinorin A. Based on the research results, the present application includes the following technical solutions.

[0005]

[0006] The first aspect of the present application provides a metabolic pathway (or a metabolic pathway gene set or a metabolic pathway enzyme set) of a clerodendran-type diterpenoid, which includes the following types of enzymes or their encoding genes:

[0007] Clerodendran-type diterpene synthase SspdiTPS2.1 (NCBI number: MT909805) and SspdiTPS1.5 (NCBI number: MT909804);

[0008] Cytochrome P450 enzyme one, referred to as CYP450 one, is a P450 enzyme SsANS derived from Salvia splendens or a conservative variant polypeptide thereof, preferably the conservative variant polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with SsANS, and has the function of cytochrome P450 enzyme one, and the amino acid sequence of SsANS is SEQ ID NO: 7; or

[0009] P450 enzyme SdANS (NCBI No: MN013362) derived from Salvia divinorum or a conservatively varied polypeptide thereof, preferably the conservatively varied polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with SdANS, and has the function of cytochrome P450 enzyme one, and the amino acid sequence of SdANS is SEQ ID NO: 8.

[0010] When the precursor of the clerodendranol-type diterpenoid is geranylgeranyl diphosphate (GGPP), the clerodendranol-type diterpene synthases SspdiTPS2.1 (NCBI No: MT909805) and SspdiTPS1.5 (NCBI No: MT909804) catalyze the formation of kolavenol, and the product of the metabolic pathway is annone.

[0011] In other words, the metabolic pathway for synthesizing annone with geranylgeranyl diphosphate (GGPP) as the precursor includes the clerodendranol-type diterpene synthases SspdiTPS2.1 (NCBI No: MT909805) and SspdiTPS1.5 (NCBI No: MT909804), cytochrome P450 enzyme SsANS or SdANS (NCBI No: MN013362), or their encoding genes.

[0012] Further, the above metabolic pathway further includes the following enzymes or their encoding genes:

[0013] Cytochrome P450 enzyme two, referred to as CYP450 two, is P450 enzyme SsHDAS derived from Salvia splendens or a conservatively varied polypeptide thereof, preferably the conservatively varied polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with SsHDAS, and has the function of cytochrome P450 enzyme two, and the amino acid sequence of SsHDAS is SEQ ID NO: 9; or

[0014] P450 enzyme SdHDAS (NCBI No. MN013369) derived from Salvia divinorum or a conservatively modified polypeptide thereof, preferably having more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology to SdHDAS and having the function of cytochrome P450 enzyme two, the amino acid sequence of SdHDAS being SEQ ID NO: 10,

[0015] The product of the metabolic pathway is a clerodane diterpenoid compound, namely hardwickiic acid (CAS No. 1782-65-6).

[0016] In other words, the metabolic pathway (or metabolic pathway gene set or metabolic pathway enzyme set) for synthesizing hardwickiic acid (CAS No. 1782-65-6) using geranylgeranyl diphosphate (GGPP) as a precursor includes clerodane diterpene synthases SspdiTPS2.1 (NCBI No. MT909805) and SspdiTPS1.5 (NCBI No. MT909804), cytochrome P450 enzymes SsANS / SdANS (NCBI No. MN013362) and SsHDAS / SdHDAS (NCBI No. MN013369) or their encoding genes.

[0017] Further, the above metabolic pathway further includes the following enzymes or their encoding genes:

[0018] Cytochrome P450 enzyme three, referred to as CYP450 three, is a P450 enzyme SsHTAS derived from Salvia splendens or a conservatively modified polypeptide thereof, preferably having more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology to SsHTAS and having the function of cytochrome P450 enzyme three, the amino acid sequence of SsHTAS being SEQ ID NO: 11,

[0019] The product of the metabolic pathway is a clerodane diterpenoid compound, namely hardwickiic acid (CAS No. 1782-65-6).

[0020] In other words, the metabolic pathway (or metabolic pathway gene set or metabolic pathway enzyme set) for the synthesis of hautriwaic acid (CAS No.: 18411-75-1) from geranylgeranyl diphosphate (GGPP) as precursor comprises the crocetane diterpene synthases SspdiTPS2.1 (NCBI No.: MT909805) and SspdiTPS1.5 (NCBI No.: MT909804), the cytochrome P450 enzymes SsANS / SdANS (NCBI No.: MN013362), SsHDAS / SdHDAS (NCBI No.: MN013369) and SsHTAS (amino acid sequence of SEQ ID NO: 11) or their encoding genes.

[0021] Further, the metabolic pathway comprises the following enzymes or their encoding genes:

[0022] The cytochrome P450 enzyme four, shortly CYP450 four, is the P450 enzyme SdDAS (NCBI No.: MN013363) derived from Salvia divinorum or a conservative variant polypeptide thereof, preferably having more than 95%, preferably more than 96%, preferably more than 97%, preferably more than 98%, more preferably more than 99% homology to SdDAS (NCBI No.: MN013363) having the amino acid sequence of SEQ ID NO: 12,

[0023] The product of the metabolic pathway is divinatorin A.

[0024] In other words, the metabolic pathway (or metabolic pathway gene set or metabolic pathway enzyme set) for the synthesis of divinatorin A from geranylgeranyl diphosphate (GGPP) as precursor comprises the crocetane diterpene synthases SspdiTPS2.1 (NCBI No.: MT909805) and SspdiTPS1.5 (NCBI No.: MT909804), the cytochrome P450 enzymes SsANS / SdANS (NCBI No.: MN013362), SsHDAS / SdHDAS (NCBI No.: MN013369) and SdDAS (NCBI No.: MN013363) or their encoding genes.

[0025] In one embodiment, in the above metabolic pathway, the nucleotide sequence of the gene encoding said cytochrome P450 enzyme SsANS having an amino acid sequence as set forth in SEQ ID NO: 7 is a nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology with SEQ ID NO: 1;

[0026] The nucleotide sequence of the gene encoding said cytochrome P450 enzyme SdANS (NCBI No. MN013362) having an amino acid sequence as set forth in SEQ ID NO: 8 is a nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology with SEQ ID NO: 2;

[0027] The nucleotide sequence of the gene encoding said cytochrome P450 enzyme SsHDAS having an amino acid sequence as set forth in SEQ ID NO: 9 is a nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology with SEQ ID NO: 3;

[0028] The nucleotide sequence of the gene encoding said cytochrome P450 enzyme SdHDAS (NCBI No. MN013369) having an amino acid sequence as set forth in SEQ ID NO: 10 is a nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology with SEQ ID NO: 4;

[0029] The nucleotide sequence of the gene encoding said cytochrome P450 enzyme SsHTAS having an amino acid sequence as set forth in SEQ ID NO: 11 is a nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology with SEQ ID NO: 5;

[0030] The nucleotide sequence of the gene SdDAS encoding the cytochrome P450 enzyme SdDAS having the amino acid sequence of SEQ ID NO: 12 is SEQ ID NO: 6, or a nucleotide sequence having more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with SEQ ID NO: 6.

[0031] A second aspect of the present application provides a cytochrome P450 enzyme (CYP450) which is a polypeptide selected from the group consisting of:

[0032] SsANS having the amino acid sequence of SEQ ID NO: 7, or a conservatively variant polypeptide thereof, preferably the conservatively variant polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with SsANS and has the function of cytochrome P450 enzyme SsANS, i.e. catalyzing the conversion of kolavenol toannonene;

[0033] SsHDAS having the amino acid sequence of SEQ ID NO: 9, or a conservatively variant polypeptide thereof, preferably the conservatively variant polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with SsHDAS and has the function of cytochrome P450 enzyme SsHDAS, i.e. catalyzing the conversion ofannonene to laevigatinsäure (CAS No.: 1782-65-6); or

[0034] SsHTAS having the amino acid sequence of SEQ ID NO: 11, or a conservatively variant polypeptide thereof, preferably the conservatively variant polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with SsHTAS and has the function of cytochrome P450 enzyme SsHTAS, i.e. catalyzing the conversion of laevigatinsäure (CAS No.: 1782-65-6) to hautriwaic acid (CAS No.: 18411-75-1).

[0035] The third aspect of the present application provides a DNA molecule comprising the coding genes of the above-mentioned cytochrome P450 enzyme one, cytochrome P450 enzyme two, cytochrome P450 enzyme three and cytochrome P450 enzyme four, for example an expression cassette / expression frame for expressing any one of the coding genes of SEQ ID NO: 1-6.

[0036] The fourth aspect of the present application provides a recombinant plasmid comprising the above-mentioned DNA molecule, which is an overexpression vector formed by cloning the above-mentioned DNA molecule on a plasmid vector suitable for expression in a host, for example a yeast strain AM119.

[0037] In one embodiment, the plasmid vector for expressing the coding genes of the crocane-type diterpene synthases SspdiTPS2.1 (NCBI No. MT909805) and SspdiTPS1.5 (NCBI No. MT909804) is pESC-HIS; the plasmid vector for expressing the genes SsANS and / or SdANS is pESC-LEU-CPR; the plasmid vector for expressing the genes SsHDAS and / or SdHDAS is pESC-URA; the plasmid vector for expressing the gene SsHTAS is pESC-URA; and the plasmid vector for expressing the gene SdDAS is pESC-TRP.

[0038] The fifth aspect of the present application provides the use of the metabolic pathway as described above, the DNA molecule as described above or the recombinant plasmid as described above in constructing a crocane-type diterpene compound expression organism.

[0039] Preferably, the above-mentioned organism is a microbial engineering strain, a transgenic plant or a plant cell comprising the MVA pathway (mevalonate pathway) and capable of producing geranylgeranyl diphosphate (GGPP).

[0040] The host cell of the microbial engineering strain is a eukaryotic cell or a prokaryotic cell; preferably, the eukaryotic cell includes a yeast, a fungal cell, an insect cell or a mammalian cell, or the prokaryotic cell includes an Escherichia coli, a Bacillus subtilis or a Streptomyces; more preferably, the host cell is a yeast; more preferably, the yeast is Saccharomyces cerevisiae. In one embodiment, the host of the microbial engineering strain is a yeast strain AM119.

[0041] The plant is an angiosperm or a gymnosperm; more preferably, the plant is a dicotyledon or a monocotyledon; more preferably, the plant is tobacco; more preferably, the plant is Nicotiana benthamiana. The plant can be selected from Salvia splendens, a sage such as Salvia divinorum, Herba Scutellariae and the like.

[0042] The sixth aspect of the present application provides a microbial engineering bacteria, which is a transformant comprising the recombinant plasmid as described above.

[0043] In one embodiment, the microbial engineering bacteria comprises MVA pathway (mevalonate pathway) and can produce geranylgeranyl diphosphate (GGPP), which overexpresses crocetane-type diterpene synthase SspdiTPS2.1 (NCBI No: MT909805) and SspdiTPS1.5 (NCBI No: MT909804), cytochrome P450 enzyme SsANS and / or SdANS (NCBI No: MN013362), which can produce annonene by fermentation.

[0044] In another embodiment, the microbial engineering bacteria comprises MVA pathway (mevalonate pathway) and can produce geranylgeranyl diphosphate (GGPP), which overexpresses crocetane-type diterpene synthase SspdiTPS2.1 (NCBI No: MT909805) and SspdiTPS1.5 (NCBI No: MT909804), cytochrome P450 enzyme SsANS and / or SdANS (NCBI No: MN013362), and SsHDAS and / or SdHDAS (NCBI No: MN013369), which can produce levorotatory hardwickiic acid by fermentation.

[0045] In another embodiment, the microbial engineering bacteria comprises MVA pathway (mevalonate pathway) and can produce geranylgeranyl diphosphate (GGPP), which overexpresses crocetane-type diterpene synthase SspdiTPS2.1 (NCBI No: MT909805) and SspdiTPS1.5 (NCBI No: MT909804), cytochrome P450 enzyme SsANS / SdANS (NCBI No: MN013362), SsHDAS and / or SdHDAS (NCBI No: MN013369), and SsHTAS (amino acid sequence is SEQ ID NO: 11), which can produce hautriwaic acid by fermentation.

[0046] In another embodiment, the microbial engineering bacteria comprise the MVA pathway (mevalonate pathway) and can produce geranylgeranyl diphosphate (GGPP), overexpress the crocetane-type diterpene synthases SspdiTPS2.1 (NCBI No. MT909805) and SspdiTPS1.5 (NCBI No. MT909804), the cytochrome P450 enzymes SsANS and / or SdANS (NCBI No. MN013362), SsHDAS and / or SdHDAS (NCBI No. MN013369), and SdDAS (NCBI No. MN013363), which can produce divinatorin A through fermentation.

[0047] The sixth aspect of the present application provides the use of the microbial engineering bacteria as described above in the fermentation production of crocetane-type diterpenes selected from the group consisting ofannonene, hardwickiic acid (CAS No. 1782-65-6), hautriwaic acid (CAS No. 18411-75-1), and divinatorin A.

[0048] The present application newly discovers several biosynthesis genes of crocetane-type diterpenes and their synthetic biology applications, and for the first time analyzes all metabolic genes of the biosynthesis processes ofannonene, hardwickiic acid (L-hardwickiic acid), hautriwaic acid, and divinatorin A. The present application also verifies the functions of some cytochrome P450 enzymes SsANS, SdANS (NCBI No. MN013362), SsHDAS, SdHDAS (NCBI No. MN013369), SsHTAS, and SdDAS (NCBI No. MN013363) in the production of these crocetane-type diterpenes through fermentation using yeast as a biological chassis, which lays a foundation for the industrialization of crocetane-type diterpenes and intermediates thereof. BRIEF DESCRIPTION OF DRAWINGS

[0049] Figure 1Gas chromatography-mass spectrometry (GCMS) and liquid chromatography-mass spectrometry (LCMS) detection spectra of the products of the P450 formed by Salvia splendens and Salvia divinorum. A, GCMS detection of the product annnonene formed by SsANS and SdANS catalyzing kolavenol; B, LCMS negative mode detection of the product hardwickiic acid formed by SsHDAS and SdHDAS catalyzing annnonene, where the hardwickiic acid standard is used as a positive control; C, LCMS negative mode detection of the product hautriwaic acid formed by SsHTAS catalyzing hardwickiic acid, where the hautriwaic acid standard is used as a positive control; D, LCMS negative mode detection of the product divinatorin A formed by SdDAS catalyzing hardwickiic acid. DETAILED DESCRIPTION

[0050] The research group first analyzed the biosynthesis process of the clorane diterpenoids and intermediates, including the discovery of genes and the enzymes encoded by the genes, the demonstration of the functions of the genes and the enzymes, and the elucidation of the enzyme activities, including the analysis of the biosynthesis in cells and the analysis of the biosynthesis in plants, thereby providing a new idea for the industrial production of the clorane diterpenoids and intermediates.

[0051] In the analysis of the biosynthesis process of the clorane diterpenoids annnonene, hardwickiic acid, hautriwaic acid and divinatorin A, three new cytochrome P450 enzymes (CYP450) were cloned from the ornamental plant Salvia splendens, which are SsANS that can catalyze kolavenol to form annnonene, SsHDAS that can catalyze annnonene to form hardwickiic acid, and SsHTAS that can catalyze hardwickiic acid to form hautriwaic acid.

[0052] Among them, SsANS is a polypeptide with an amino acid sequence as shown in SEQ ID NO: 7, SsHDAS is a polypeptide with an amino acid sequence as shown in SEQ ID NO: 9, and SsHTAS is a polypeptide with an amino acid sequence as shown in SEQ ID NO: 11.

[0053] It can be expected that the conservative variant polypeptides of the three enzymes also have the same function.

[0054] As used herein, the term "conservatively modified variants" refers to polypeptides that have substantially the same biological function or activity as the polypeptide in question. Such "conservatively modified variants" can have (i) one or more conservative or non-conservative amino acid substitutions (preferably conservative amino acid substitutions) of the polypeptide, where such substituted amino acid residues can or can not be encoded by the genetic code, or (ii) one or more substitution groups in one or more amino acid residues, or (iii) a polypeptide formed by fusing the mature polypeptide to another compound (such as a compound that extends the half-life of the polypeptide, e.g., a polyethylene glycol), or (iv) a polypeptide formed by fusing additional amino acid sequences to the polypeptide (such as a leader or secretory sequence or a sequence to facilitate purification of the polypeptide or a proprotein sequence, or a fusion protein formed with an antigen IgG fragment). For example, (1) a polypeptide formed by substitution, deletion, or addition of one or more (e.g., 1-20, preferably 1-10; more preferably 1-5; more preferably 1-3) amino acid residues of the amino acid sequence of the enzyme, and which has the function of the wild-type enzyme; (2) a polypeptide that is more than 50% (preferably more than 60%; more preferably more than 70%; more preferably more than 80%; more preferably more than 85%; more preferably more than 90%; more preferably more than 95%; more preferably more than 98%; more preferably more than 99%) identical to the polypeptide of the sequence shown, and which has the function of the wild-type enzyme; or (3) a polypeptide formed by adding a tag sequence to the N or C terminus of the polypeptide of the sequence shown, or by adding a signal peptide sequence to the N terminus thereof. These fragments, derivatives, and analogs are within the scope of those skilled in the art according to the teachings herein.

[0055] In order to realize biosynthesis of the crocetane-type diterpenoids in host organisms, the coding genes SspdiTPS2.1, SspdiTPS1.5, SsANS, SdANS, SsHDAS, SdHDAS, SsHTAS and SdDAS of the relevant enzymes in the metabolic pathway including crocetane-type diterpene synthases: SspdiTPS2.1 (NCBI No: MT909805) and SspdiTPS1.5 (NCBI No: MT909804), cytochrome P450 enzymes SsANS, SdANS (NCBI No: MN013362), SsHDAS, SdHDAS (NCBI No: MN013369), SsHTAS and SdDAS (NCBI No: MN013363) can be artificially synthesized, and the coding genes are constructed as gene expression cassettes or expression constructs as DNA molecules as exogenous genes, and the expression cassettes / expression constructs are operably linked to plasmid vectors by subcloning to obtain recombinant plasmids, and then the recombinant plasmids are transformed into host cells to obtain transformants, i.e. genetically engineered bacteria or recombinant bacteria, or are transformed into plants by Agrobacterium-mediated method to obtain transgenic plants, so as to realize cloning of the exogenous genes, and the genetically engineered bacteria / recombinant bacteria or transgenic plants are used to overexpress the above-mentioned heterologous genes to synthesize crocetane-type diterpenoids annone, hardwickiic acid, hautriwaic acid and / or divinatorin A.

[0056] In this paper, for the sake of convenience, a certain protein such as P450 enzyme SsANS is sometimes mixed with its coding gene (DNA) name SsANS, and those skilled in the art should understand that they represent different types of substances in different descriptions. Those skilled in the art can easily understand their meanings according to the context and context. For example, for AaMYC3, when describing the function or category of transcription factor, it refers to the protein; when it is described as a gene, it refers to the coding gene of the protein.

[0057] As used herein, the "expression cassette" or "gene expression cassette" refers to a gene expression system comprising all necessary elements required for expression of a polypeptide of interest (e.g. crocetane-type diterpene synthase, cytochrome P450 enzyme), which usually includes the following elements: promoter, gene sequence encoding polypeptide, terminator; in addition, signal peptide coding sequence, etc. can be optionally included; these elements are operatively linked.

[0058] As used herein, the "expression construct" or "expression construct" refers to a recombinant DNA molecule comprising a desired nucleic acid coding sequence (e.g. SEQ ID NO: 1-6), which can comprise one or more gene expression cassettes. The "construct" is usually contained in an expression vector (plasmid vector).

[0059] As used herein, the term "exogenous" or "heterologous" refers to the origin of two or more nucleic acid or protein sequences from different sources or the origin of a protein (or nucleic acid) from a different source and a host cell. For example, a nucleic acid is exogenous to a host cell if the combination of the nucleic acid and the host cell is not naturally occurring. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0060] As used herein, the term "operably linked" or "operatively linked" refers to the functional placement of two or more nucleic acid regions or nucleic acid sequences in a specific location relative to each other. For example, a promoter region is placed in a specific location relative to a nucleic acid sequence of interest such that transcription of the nucleic acid sequence is directed by the promoter region, and thus, the promoter region is "operably linked" to the nucleic acid sequence.

[0061] As a preferred embodiment of the present application, the recombinant expression vector can include, but is not limited to, one selected from the following (I) to (IV):

[0062] (I) a recombinant plasmid obtained by inserting SspdiTPS2.1 and SspdiTPS1.5 into a pESC-HIS vector;

[0063] (II) a recombinant plasmid obtained by inserting SsANS or SdANS into a pESC-LEU-CPR vector;

[0064] (III) a recombinant plasmid obtained by inserting SsHDAS, SsHTAS or SdHDAS into a pESC-URA vector.

[0065] (IV) a recombinant plasmid obtained by inserting SdDAS into a pESC-TRP vector

[0066] As a preferred embodiment of the present application, the recombinant bacteria are as follows (V) or (VI):

[0067] (V) recombinant bacteria obtained by introducing the recombinant plasmid of (I), (II), (III) or (IV) above into E. coli;

[0068] (VI) recombinant bacteria obtained by introducing the recombinant plasmid of (I), (II), (III) or (IV) above into yeast.

[0069] As a preferred embodiment of the present application, the yeast can be S. cerevisiae, and in particular, can be yeast strain AM119.

[0070] For example, by using yeast engineering bacteria, yeast culture medium containing D-glucose as carbon source, through fermentation can de novo synthesis of crocetane type diterpenoids annone, hardwickiic acid, hautriwaic acid and / or divinatorin A.

[0071] In the description of the technical solutions of the present application, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, as used in phrases such as "A, B, and / or C", the term "and / or" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0072] The results also show that by yeast engineering bacteria fermentation using basic carbon source glucose de novo synthesis of crocetane type diterpenoids has the following advantages:

[0073] 1. Yeast engineering bacteria and plant-derived enzymes and their encoding genes have good adaptability.

[0074] 2. By using easy-to-culture yeast strains to produce crocetane type diterpenoids by fermentation not only solves the problems of plant extraction method consuming a large amount of plant raw materials, being limited by season and region, and low extraction efficiency, but also avoids the disadvantages of chemical synthesis method such as multiple by-products, low activity of target product, and environmental pollution.

[0075] 3. Using recombinant yeast bacteria for whole-cell de novo biosynthesis of crocetane type diterpenoids does not require additional addition of amino acid precursors, and the basic carbon source can meet the production needs, opening up a new way for industrial production of crocetane type diterpenoids.

[0076] The present application will be further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present application and are not intended to limit the scope of the present application.

[0077] Examples

[0078] The amount of addition, content and concentration of various substances involved in the examples are described, wherein the percentage content, unless otherwise specified, refers to the mass percentage content.

[0079] In the examples herein, if no specific description is made for the reaction temperature or operating temperature, the temperature generally refers to room temperature (15-30°C).

[0080] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, preparation of competent cells, transformation, etc., which are mainly performed with reference to the Molecular Cloning Experiment Guide (3rd Edition), J. Sambrook, D.W. Russell (USA) editors, Huang Peitang et al. translation, Science Press, Beijing, 2002. For example, the competent cell transformation method and the preparation method of the competent cells are both performed with reference to the Molecular Cloning Experiment Guide (3rd Edition) Chapter 1 page 96. If necessary, the specific experimental conditions can be determined by simple tests.

[0081] The PCR amplification experiments are performed according to the reaction conditions or kit instructions provided by the plasmid or DNA template supplier. If necessary, it can be adjusted by simple test.

[0082] The whole gene synthesis, primer synthesis and gene sequencing in the embodiments are completed by Shengong Bioengineering (Shanghai) Co., Ltd.

[0083] Taking the backbone plasmid pESC as an example, the PCR primers used for constructing the recombinant expression plasmids in the embodiments are listed in Table 1.

[0084] Table 1, primers used for constructing recombinant plasmids in the embodiments

[0085]

[0086]

[0087] In Table 1, the suffix "F" in the name represents forward; "R" represents reverse.

[0088] In the embodiments, the backbone plasmids based on which the recombinant plasmids are constructed are as follows: pESC-URA vector, pESC-HIS vector, pESC-LEU vector, pESC-TRP vector, all purchased from Agilent Technologies.

[0089] In the embodiments, the yeast strain AM119 used as a host cell can produce GGPP by fermentation, which is preserved by the Evangelos C. Tatsis (Evita) research group of the Chinese Academy of Sciences Molecular Plant Science Excellence Innovation Center, and any unit and individual can obtain the strain for verification of the present application, but without the permission of the Chinese Academy of Sciences Molecular Plant Science Excellence Innovation Center, it cannot be used for other purposes, including development and utilization, scientific research and teaching.

[0090] It should be noted that, for the sake of convenience of description, in the embodiments, the plasmid number and the corresponding strain number can share a number, which is easily understood by those skilled in the art, i.e. the same number can refer to different biological forms in different environments.

[0091] Example 1: Construction of expression vectors for enzymes related to the metabolic pathway of crassulacean succulence diterpenoids

[0092] 1. Commissioned by Shengong Bioengineering (Shanghai) Co., Ltd. to synthesize the genes of enzymes related to the metabolic pathway of crassulacean succulence diterpenoids, including cytochrome P450 enzymes (CYP450): SdANS, SdHDAS, SdDAS. The isolation and identification process of crassulacean succulence diterpene synthases SspdiTPS2.1 (NCBI number: MT909805) and SspdiTPS1.5 (NCBI number: MT909804) is described in the article by Li Haixu et al. published in Molecular Plant in 2023 (DOI: 10.1016 / j.molp.2023.01.006);

[0093] Alternatively, natural enzyme genes are extracted from plants such as Salvia prionitis, primers are designed, and plant transcriptome cDNA is used as a template to amplify the relevant genes through polymerase chain reaction (PCR).

[0094] The amino acid sequences of these enzyme proteins and the nucleotide sequences of the encoding genes are listed in the sequence listing.

[0095] 2. Clone the coding genes of each enzyme on a plasmid vector suitable for expression in yeast cells. As an example, the cloning and recombinant expression vector construction of P450 enzymes SsANS, SsHDAS, and SsHTAS from Salvia prionitis and P450 enzymes SdANS, SdHDAS, SdDAS from Salvia divinorum are described as follows.

[0096] For the discovery of the function of P450 enzymes in Salvia prionitis, based on the article by Li Haixu et al. published in Molecular Plant in 2023 (DOI: 10.1016 / j.molp.2023.01.006), the functions of SspdiTPS2.1 and SspdiTPS1.5 have been confirmed. Subsequently, we further analyzed the transcriptome data of Salvia prionitis root, stem, leaf, and flower tissues published on the NCBI website, and used bioinformatics software MutRank and SOM analysis to find that SsANS of the CYP76 gene family and SsHDAS, SsHTAS of the CYP728D / CYP716B gene subfamily have consistent expression patterns with SspdiTPS2.1. We believe that these P450 enzyme genes may be involved in the metabolic pathway of crassulacean succulence diterpenoids.

[0097] We ground the frozen tissue of the leaves of S. sanguinea using a tissue lyser and extracted RNA using the RNA extraction kit (Qiagen, Germany). The extracted RNA was purified using the TURBO DNA-free kit (ThermoFisher) to remove gDNA. Subsequently, the RNA was reverse transcribed into cDNA using Superscript IV (ThermoFisher, USA).

[0098] Subsequently, the cDNA of the leaves of S. sanguinea or the synthetic psilocybin-containing S. divinorum synthetic genes SdANS, SdHDAS, SdDAS were used as templates to amplify the gene products using KOD Hi-Fi enzyme and the following primer pairs to amplify the sequences:

[0099] SsANS pESC F:

[0100] cactaaagggcggccgcactagta ATGGATTCCTCCTTCCCTTT,

[0101] SsANS pESC R:

[0102] cttgtaatccatcgatactagtgctgc CTTCTTGTATGGGATGA.

[0103] SsHDAS pESC F:

[0104] aggagaaaaaaccccggatccg ATGGAGTCGACGACGATATT,

[0105] SsHDAS pESC R:

[0106] caacttctgttccatgtcgac TCATGCTTTATAAGGTTCTCTGC.

[0107] SsHTAS pESC F:

[0108] cactaaagggcggccgcactagta ATGGAGTCGACGATGATTATG,

[0109] SsHTAS pESC R:

[0110] cttgtaatccatcgatactagtgc CAACAATTTTTCTGAGGGGTTG.

[0111] SdANS pESC F:

[0112] ACCCTCACTAAAGGGCGGCCGCAACCATGGATTCCTTCCCTTTCCTC,

[0113] SdANS pESC R:

[0114] GTCATCCTTGTAATCCATCGATACTAACTTATATGGGATGCTCTTG。

[0115] SsHDAS pESC F:

[0116] ACCCTCACTAAAGGGCGGCCGCAACCATGGAGTCGACGATTATGTTG,

[0117] SsHDAS pESC R:

[0118] GTCATCCTTGTAATCCATCGATACTATTATATTTGTCTGCATTG。

[0119] SdDAS pESC F:

[0120] ACCCTCACTAAAGGGCGGCCGCAACCATGGAGTCGACGATTATGTTG,

[0121] SdDAS pESC R:

[0122] GTCATCCTTGTAATCCATCGATACGAAAGGGTTGGTGATGTGAAT。

[0123] The PCR reaction system is as follows: 94°C for 3 min; 98°C for 15 s, 60°C for 30 s, 68°C for 1 min 40 s, 35 cycles; 68°C for 10 min.

[0124] The amplified gene sequence is recombined with pESC-HIS vector (Invitrogen), pESC-URA vector and pESC-LEU vector (Invitrogen) by homologous recombinase (ClonExpress II One Step Cloning Kit, Novagen), 37℃ reaction for 30 min in a PCR instrument, transformed into DH5α, and after bacterial liquid PCR identification, the plasmids pESC-HIS-SspdiTPS1.5△50-SspdiTPS2.1, pESC-LEU-SsANS-CrCPR, pESC-LEU-SdANS-CrCPR, pESC-URA-SsHDAS, pESC-URA-SdHDAS, pESC-URA-SsHDAS-SsHTAS, pESC-TRP-SdDAS with correct sequencing are obtained. Among them, the symbol "△ number x" represents that the protein is cut at the x (number) position of the amino acid sequence, and the sequence before the △ position is the signal peptide. Only the nucleotide sequence corresponding to the position after the △ is cloned in the experiment.

[0125] The corresponding relationship between the enzymes and the plasmids is shown in Table 2 below.

[0126] Table 2, corresponding relationship between enzyme set and plasmid combination.

[0127]

[0128]

[0129] Example 2: Construction of recombinant bacteria

[0130] The plasmids pESC-HIS-SspdiTPS1.5△50-SspdiTPS2.1, pESC-LEU-SsANS-CrCPR, pESC-LEU-SdANS-CrCPR, pESC-URA-SsHDAS, pESC-URA-SdHDAS, pESC-URA-SsHDAS-SsHTAS, pESC-TRP-SdDAS constructed above are combined into Saccharomyces cerevisiae AM119 strain by lithium acetate method, and the following enzyme sets / gene sets are expressed in the obtained engineering strains, respectively:

[0131] Engineering strain 1, expressing SspdiTPS1.5, SspdiTPS2.1 and SsANS;

[0132] Engineering strain 2, expressing SspdiTPS1.5, SspdiTPS2.1 and SdANS;

[0133] Engineered strain 3, expressing SspdiTPS1.5, SspdiTPS2.1, SsANS, and SsHDAS;

[0134] Engineered strain 4, expressing SspdiTPS1.5, SspdiTPS2.1, SsANS, SsHDAS, and SsHTAS;

[0135] Engineered strain 5, expressing SspdiTPS1.5, SspdiTPS2.1, SdANS, and SdHDAS;

[0136] Engineered strain 6, expressing SspdiTPS1.5, SspdiTPS2.1, SdANS, SdHDAS, and SdDAS.

[0137] Fermentation cultures were performed and their metabolites were analyzed.

[0138] Two days after plasmid transformation, colonies of the above constructed engineered strains 1-6 were picked from the plates and inoculated into 10 mL of glucose dropout liquid medium (Shanghai Yichen Bio) for 1 day. After that, the cells were harvested and resuspended in 20 mL of dropout liquid medium containing 2% w / v D-galactose for 2 more days. The culture medium DOSupplement-His / -Leu, DO Supplement-His / -Leu / -Ura, DO Supplement-His / -Leu / -Trp / -Ura powder used in the experiment were purchased from Shanghai Yichen Bio-technology Co., Ltd. The corresponding solid and liquid culture media can be prepared according to the relevant instructions.

[0139] Subsequently, an equal volume of ethyl acetate (EtOAc) was used to extract the culture, and the organic phase was evaporated using a rotary evaporator. The dried extract was then resuspended in 500 μΐ^of methanol and filtered using a 0.22 micron pore size syringe filter. Metabolites were analyzed by coupling a Dionex Ultimate 3000 UHPLC system (Thermo) to a Q Exactive system. Five microliters (5 μΐ^) of each processed sample was injected into the UPLC (Kinetex 2.6 μιη C18 The size was 100 x 2.1 mm, Phenomenex). The process was carried out at a flow rate of 0.35 mL per minute. A gradient of solvent A (2 mM NH4FA + 0.01% FA) and solvent B (ACN) was used, with B increasing linearly from 40% to 99% between 0 and 10 minutes. Solvent B was maintained at 99% from 10 to 12 minutes. Mass spectrometry acquisition was carried out in positive mode, with the following parameters: spray voltage 3500 V, capillary temperature 320 °C, sheath gas 40 and auxiliary gas 10. The resulting products were compared with standards of crocetane-type diterpenoids and its intermediates, and the results are shown in Figure 1 .

[0140] The detection analysis of the fermentation broth extracts showed that the engineering strain 1 and the engineering strain 2 could produce annonene (middle A), the fermentation products of the engineering strain 3 and the engineering strain 5 were hardwickiic acid (middle B), the fermentation product of the engineering strain 4 was hautriwaic acid (middle C), and the fermentation product of the engineering strain 6 was divinatorin A (middle D). Figure 1 Figure 1 Figure 1 Figure 1

[0141] The above experimental results show the feasibility of the metabolic engineering design scheme of the present application, and show that the fermentation production of crocetane-type diterpenoids by the microbial engineering strain has application prospects.

[0142] The above-described embodiments are only preferred embodiments of the present application, and the protection scope of the present application is not limited thereto. Any equivalent replacement or transformation made by those skilled in the art based on the present application is within the protection scope of the present application.​​​​

Claims

1. A metabolic pathway of a clerodendran-type diterpene compound, characterized in that, The following enzymes or their encoding genes are also included: The cytochrome P450 enzyme one is a P450 enzyme SsANS derived from Salvia splendens or a conservative variant polypeptide thereof, which has more than 95% homology with SsANS and has the function of cytochrome P450 enzyme one, and the amino acid sequence of SsANS is SEQ ID NO: 7; or The cytochrome P450 enzyme one is a P450 enzyme SsANS derived from Salvia splendens or a conservative variant polypeptide thereof, which has more than 95% homology with SsANS and has the function of cytochrome P450 enzyme one, and the amino acid sequence of SsANS is SEQ ID NO: 7; or The cytochrome P450 enzyme one is a P450 enzyme SsANS derived from Salvia splendens or a conservative variant polypeptide thereof, which has more than 95% homology with SsANS and has the function of cytochrome P450 enzyme one, and the amino acid sequence of SsANS is SEQ ID NO: 7; or When the precursor of the crocetane diterpenoid is geranylgeranyl diphosphate (GGPP), the product of the metabolic pathway is an annonene.

2. The metabolic pathway of claim 1, wherein, The following enzymes or their encoding genes are also included: The cytochrome P450 enzyme two is a P450 enzyme SsHDAS derived from Salvia splendens or a conservative variant polypeptide thereof, which has more than 95% homology with SsHDAS and has the function of cytochrome P450 enzyme two, and the amino acid sequence of SsHDAS is SEQ ID NO: 9; or The cytochrome P450 enzyme two is a P450 enzyme SdHDAS derived from Salvia divinorum or a conservative variant polypeptide thereof, which has more than 95% homology with SdHDAS and has the function of cytochrome P450 enzyme two, and the amino acid sequence of SdHDAS is SEQ ID NO: 10, The product of the metabolic pathway is a hardwickiic acid.

3. The metabolic pathway of claim 2, wherein, The following enzymes or their encoding genes are also included: The cytochrome P450 enzyme three is a P450 enzyme SsHTAS derived from Salvia splendens or a conservative variant polypeptide thereof, which has more than 95% homology with SsHTAS and has the function of cytochrome P450 enzyme three, and the amino acid sequence of SsHTAS is SEQ ID NO: 11, The product of the metabolic pathway is a hautriwaic acid.

4. The metabolic pathway of claim 2, wherein, The following enzymes or their encoding genes are also included: cytochrome P450 enzyme four is a polypeptide derived from P450 enzyme SdDAS (NCBI No. MN013363) from Salvia divinorum or a conservative variant polypeptide having 95% or more homology with SdDAS and having the function of cytochrome P450 enzyme four, and the amino acid sequence of SdDAS (NCBI No. MN013363) is SEQ ID NO: 12, the product of the metabolic pathway is a clerodane diterpenoid compound, and the clerodane diterpenoid compound is divinatorin A.

5. The metabolic pathway of any one of claims 1-4, wherein, the nucleotide sequence of the coding gene SsANS of the cytochrome P450 enzyme SsANS having the amino acid sequence of SEQ ID NO: 7 is SEQ ID NO: 1; the nucleotide sequence of the coding gene SdANS of the cytochrome P450 enzyme SdANS (NCBI No. MN013362) having the amino acid sequence of SEQ ID NO: 8 is SEQ ID NO: 2; the nucleotide sequence of the coding gene SsHDAS of the cytochrome P450 enzyme SsHDAS having the amino acid sequence of SEQ ID NO: 9 is SEQ ID NO: 3; the nucleotide sequence of the coding gene SdHDAS of the cytochrome P450 enzyme SdHDAS (NCBI No. MN013369) having the amino acid sequence of SEQ ID NO: 10 is SEQ ID NO: 4; the nucleotide sequence of the coding gene SsHTAS of the cytochrome P450 enzyme SsHTAS having the amino acid sequence of SEQ ID NO: 11 is SEQ ID NO: 5; the nucleotide sequence of the coding gene SdDAS of the cytochrome P450 enzyme SdDAS (NCBI No. MN013363) having the amino acid sequence of SEQ ID NO: 12 is SEQ ID NO:

6.

6. A cytochrome P450 enzyme, characterized in that, a polypeptide selected from the group consisting of: SsANS as described in claim 1 or a conservative variant polypeptide having 95% or more homology with SsANS and having the function of cytochrome P450 enzyme one, and the amino acid sequence of SsANS is SEQ ID NO: 7; SsHDAS as described in claim 2 or a conservative variant polypeptide having 95% or more homology with SsHDAS and having the function of cytochrome P450 enzyme two, and the amino acid sequence of SsHDAS is SEQ ID NO: 9; or SsHTAS as described in claim 3 or a conservative variant polypeptide having 95% or more homology with SsHTAS and having the function of cytochrome P450 enzyme three, and the amino acid sequence of SsHTAS is SEQ ID NO:

11.

7. A DNA molecule, characterized in that, a coding gene of the enzyme as described in claims 1-5.

8. A recombinant plasmid, characterized in that, DNA molecule as claimed in claim 7.

9. Use of the metabolic pathway as claimed in any one of claims 1 to 5, the DNA molecule as claimed in claim 7 or the recombinant plasmid as claimed in claim 8 for the construction of a biosensor for crocetane-type diterpenoids.

10. Use of the recombinant plasmid as claimed in claim 8 for the construction of a microbial engineering strain, a transgenic plant or a plant cell comprising the MVA pathway and capable of producing geranylgeranyl diphosphate (GGPP).

11. A microbially engineered bacterium, characterized in that, which is a transformant comprising the recombinant plasmid as claimed in claim 8.

12. Use of the microbial engineering strain as claimed in claim 11 for the fermentative production of crocetane-type diterpenoids selected from the group consisting of annonene, laevigahardwickiic acid, hautriwaic acid and divinatorin A.