Application of MdCIK2 gene in regulating disease resistance of apple
By identifying and applying the apple receptor kinase gene MdCIK2, the disease resistance of apples was regulated, solving the problem of improving apple disease resistance, providing genetic resources and breeding strategies for green prevention and control, and improving apple resistance to rot disease.
Patent Information
- Application Number
- CN202511315873.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-16
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-09-16
AI Technical Summary
The existing technology has not identified any RLKs that specifically negatively regulate resistance to rot in apples, making it difficult to improve the disease resistance of apples, and the long-term reliance on chemical agents for control has caused environmental pollution problems.
We identified and applied the apple receptor kinase gene MdCIK2, and used gene editing technology to enhance or reduce the resistance of apples to rot by silencing or overexpressing this gene to regulate the disease resistance of apples.
The function of MdCIK2 in apple disease resistance was clarified. Silencing MdCIK2 enhances apple resistance to canker, while overexpressing MdCIK2 reduces resistance. This study provides important genetic resources and breeding strategies, laying the foundation for green control of apple tree canker.
Smart Images

Figure CN120829923B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to the application of the receptor kinase gene MdCIK2 in regulating the disease resistance of apples. Background Technology
[0002] apple( Malus domestica It is one of the three major cultivated fruit trees in my country, and is caused by fungi of the genus *Heteropoda* in the phylum Ascomycota. Valsa mali Apple tree canker, caused by [unspecified pathogen], is a major branch and trunk disease affecting the apple industry. It is characterized by strong latent infectivity and rapid spread, leading to weakened trees and even death, seriously threatening the sustainable development of the apple industry. Although efficient disease control technologies have been developed, which can alleviate the disease's occurrence to some extent, long-term reliance on chemical agents can easily cause environmental pollution and other problems. Furthermore, with social development and increasingly stringent food safety requirements, green disease control has become an important trend in the industry's development. The scientific use of disease-resistant varieties is the most economical, effective, and environmentally friendly way to achieve green and sustainable disease control. Exploring the genetic resources of apple trees to cultivate disease-resistant varieties is considered the core strategy for achieving green control of apple tree canker.
[0003] Plant immune responses at two levels—pattern-triggered immunity (PTI) and effector-triggered immunity (ETI)—work synergistically to resist pathogen infection. Plant receptor-like kinases (RLKs), as transmembrane signal sensing and transduction elements, play a crucial role in PTI, primarily composed of extracellular and intracellular kinase domains. Plant RLKs can be further classified based on their extracellular domain structure, with the largest subfamily being LRR-RLKs containing the LRR domain. Plant LRR-RLKs can act as receptors, co-receptors, or regulators, playing important roles in plant growth, development, and immunity. Currently, only a few regulatory LRR-RLKs have been identified as participating in plant immunity.
[0004] In recent years, using gene editing technology to target plant disease-susceptibility genes to create disease-resistant materials has become a green, efficient, and long-lasting disease control strategy. The loss of function of negative immune regulators may significantly enhance resistance by relieving immunosuppression. However, no specific negative regulators of canker resistance have yet been identified in apples. Summary of the Invention
[0005] In light of this, this invention identified a class of RLK genes negatively regulating apple resistance to rot disease, and named them MdCIK2 based on the name of their homologous protein in the model plant Arabidopsis thaliana. Silencing these genes significantly enhances apple resistance to rot disease, while overexpression significantly reduces resistance and inhibits the expression of apple immune marker genes. This discovery provides important gene resources for molecular breeding of apples for disease resistance and targeted gene editing, possessing significant theoretical value and application prospects.
[0006] To achieve this technical objective, the present invention adopts the following technical solution:
[0007] On the one hand, this invention provides the application of the receptor kinase gene MdCIK2 (abbreviated as gene MdCIK2) in regulating apple disease resistance, including:
[0008] a) Silencing the receptor-like kinase gene MdCIK2 enhances apple resistance to rot; or
[0009] b) Silencing a specific gene fragment of the receptor kinase gene MdCIK2 enhances the resistance of apples to rot.
[0010] The CDS sequence of the receptor kinase gene MdCIK2 is shown in SEQ ID NO:1.
[0011] Preferably, the nucleotide sequence of the specific gene fragment of the receptor kinase gene MdCIK2 is shown in SEQ ID NO:2.
[0012] Preferably, the amino acid sequence of the protein encoded by the receptor kinase gene MdCIK2 is shown in SEQ ID NO:3.
[0013] Preferably, the rot disease is caused by fungi of the genus *Scleroderma* in the phylum Ascomycota.
[0014] On the other hand, the present invention provides resistance to Ascomycota genus *Heterophyllum* fungi. Valsa mali Methods for breeding apple varieties, including steps to silence the receptor kinase gene MdCIK2;
[0015] The CDS sequence of the receptor kinase gene MdCIK2 is shown in SEQ ID NO:1.
[0016] Preferably, the amino acid sequence of the protein encoded by the receptor kinase gene MdCIK2 is shown in SEQ ID NO:3.
[0017] Preferably, the receptor-like kinase gene MdCIK2 is effective against *Ascomycota* var. *mairei* fungi. Valsa mali It plays a negative regulatory role in the immune response.
[0018] Preferably, silencing the receptor-like kinase gene MdCIK2 enhances the resistance of apples to rot.
[0019] Preferably, overexpression of the receptor-like kinase gene MdCIK2 reduces the resistance of apples to rot disease.
[0020] Furthermore, this invention provides the receptor-like kinase gene MdCIK2 for cultivating fungi resistant to the genus *Ascomycota*. Valsa mali Application in apple varieties, wherein the CDS sequence of the receptor kinase gene MdCIK2 is shown in SEQ ID NO:1.
[0021] SEQ ID NO:1 is shown below:
[0022]
[0023] SEQ ID NO:2 is as follows:
[0024] "TATGAGCCTCGCAACCATGAAGTGGAGGCTTTGATAAGCTTAAGGGTAGGTTTGAATGATCCGCATGGGGTGTTAAACAACTGGGATGAGGACTCAGTGGACCCTTGTAGCTGGGCTATGATCACCTGCTCCCCTGATAATCTCGTCATTGGCCTGGGAGCTCCAAGCCAGTCTCTGTCTGGAACTCTGTCCGGGG".
[0025] SEQ ID NO:3 is as follows:
[0026] "MLPLKLLIFFLSSCSLCLSYEPRNHEVEALISLRVGLNDPHGVLNNWDEDSVDPCSWAMITCSPDNLVIGLGAPSQSLSGTLSGAFANLTNLRQVLLQNNNICGKLPSELGTLPKLQTLDLSNNRFSGLVPDSLAHLNTLQYLRLNNNSLSGPFPVSLAKIPDLAFLDLSYNNLSGPIPKFPARTFNVVGNPLICASSSTEGCSGSATPVPLSLSLKTSPGKHNSKTVAIALGLSLSCVLVIVLLLGILWHRKKQKTQSILNISDIQEEGIVSLGNLRSFTFKQLQLATDNFSSKHILGAGGFGNVYKGKLPDGTMVAVKRLKDVTGTAGESQFRTELEMISLAVHRNLLRLIGFCATFSERLLVYPYMSNGSVAARLRGKPALDWNTRKRIAIGAARGLLYLHEQCDPKIIHRDVKAANVLLDDYCEAIVGDFGLAKLLDHADSHVTTAVRGTVGHIAPEYLSTGQSSEKTDVFGFGILLIELITGMRALEFGKTVNQKGAILEWVKKIQQEKKVEVLVDRELGNNYDRIEVGEMLQVALLCTQYLPAHRPKMSEVVRMLEGDGLAEKWAASHNQSNSSMDRFQSHNSNKSSSHTDGIHSKHDGNERDRGSMFSAWIDEDEDENSLDSYAMELSGPR".
[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0028] (1) This invention provides a receptor-like kinase gene MdCIK2 that negatively regulates apple disease resistance, providing an important gene resource for molecular breeding of apple disease resistance and targeted gene editing.
[0029] (2) This invention provides an apple receptor kinase gene, MdCIK2, and further clarifies its expression pattern at different time points during apple canker infection. Using Agrobacterium-mediated transient transformation, MdCIK2 was transiently overexpressed in *Nicotiana benthamiana* leaves, and its subcellular localization was clarified by laser confocal microscopy. MdCIK2 was transiently silenced and overexpressed in apple tissue culture leaves using the vacuum infiltration Agrobacterium method. After achieving the silencing and overexpression requirements, apple canker pathogens were inoculated. V. mali By statistically analyzing the diseased area of leaves and the expression of immune genes, the role of this gene in apple resistance to rot was clarified, laying the foundation for subsequent research on its function.
[0030] (3) This invention clarifies that MdCIK2 in apples and V. mali The function of the interaction process, transiently silencing MdCIK2 in apple leaves can enhance the apple's response to... V. mali The disease resistance of apples was significantly reduced by transient overexpression of MdCIK2. V. mali It enhances disease resistance and inhibits the expression of immune marker genes in apples. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0032] Figure 1 This is a gel electrophoresis image of the gene MdCIK2 provided in Example 2 of the present invention.
[0033] Figure 2 This is an evolutionary analysis diagram of MdCIK2 homologous proteins in different species provided in Example 3 of the present invention.
[0034] Figure 3 The MdCIK2 provided in Embodiment 4 of the present invention in Apple response V. mali An analysis diagram of expression patterns at different time points of infection.
[0035] Figure 4This is a diagram showing the subcellular localization of the MdCIK2 gene-encoded protein in plant cells, as provided in Example 5 of the present invention. A is a schematic diagram of the green fluorescence of the MdCIK2-GFP fusion protein in plant cells; B is a schematic diagram of the red fluorescence of the membrane-localized TaWPI6-mCherry fusion protein in plant cells; C is a cell field of view under bright field; and D is a subcellular localization diagram of the protein under a superimposed light field of green and red fluorescence.
[0036] Figure 5 Apple response after transient silencing of gene MdCIK2 provided in Example 6 of the present invention V. mali Phenotypic analysis of infection. A represents the MdCIK2 silencing efficiency test results; B represents the inoculation results after MdCIK2 silencing. V. mali Phenotypic results of lesion area; C represents inoculation after silencing MdCIK2. V. mali The statistical results of the lesion area.
[0037] Figure 6 Apple response after transient overexpression of gene MdCIK2 as provided in Example 6 of this invention V. mali Phenotypic analysis of infection. A represents the analysis of MdCIK2 overexpression results; B represents the results of inoculation after MdCIK2 overexpression. V. mali Phenotypic results of lesion area; C represents inoculation after MdCIK2 overexpression. V. mali The statistical results of the lesion area.
[0038] Figure 7 Analysis of the expression of apple defense-related genes MdPR1, MdPR2, MdPR5, MdWRKY33, and MdRBOHD after transient overexpression of gene MdCIK2 provided in Example 7 of the present invention.
[0039] Note: Figure 5 In this context, CK refers to the control pK7 empty vector, and RNAi::MdCIK2 refers to pK7-MdCIK2. Figure 6 In this context, CK refers to the control pCAMBIA1302-GFP, and OE::MdCIK2 refers to pCAMBIA1302-MdCIK2. Figure 7 In this context, CK refers to pCAMBIA1302-GFP, and OE::MdCIK2 refers to pCAMBIA1302-MdCIK2. Detailed Implementation
[0040] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially. Unless otherwise specified, the percentages in the following embodiments refer to mass percentages.
[0041] Table 1 below shows the primer information involved in the embodiments of the present invention.
[0042] Table 1 Primer information involved in the embodiments of the present invention
[0043]
[0044]
[0045] The pCAMBIA1302 and pK7GWIWG2D(II) vectors, Gala apple tissue culture seedling leaves, and apple tree rot pathogens involved in the embodiments of this invention are described. V. mali ( Valsa mali The Gala apple branches were provided by the Fruit Tree Diseases Research Team Laboratory of the College of Plant Protection, Northwest A&F University, and were collected from the Xintiandi Orchard of Northwest A&F University. All other reagents and consumables were commercially available.
[0046] The formulation of the LB medium (1 L) involved is as follows: Add 10 g tryptone, 5 g yeast extract, 10 g NaCl, and 15 g agar powder (added when preparing solid medium) to a 1 L measuring cup, add water to make up to 1 L, and autoclave at 121℃ for 20 min.
[0047] The formula for the PDA medium (1 L) involved is as follows: Peel and cut 200 g of potatoes into pieces, boil them in double-distilled water for 30 min, filter them through gauze into a 1 L measuring cup, add 20 g of glucose and 15 g of agar powder, stir well, and then bring the volume to 1 L with double-distilled water. Autoclave at 121℃ for 20 min.
[0048] The MS medium (1 L) formulation involved is as follows: Add 30 g sucrose, 4.43 g MS medium (PhytoTechnology, catalog number: M519), 8 g agar powder, 200 µL 1 mg / mL IAA, and 200 µL 1 mg / mL 6-BA to a 1 L measuring cup, and autoclave at 121℃ for 20 min.
[0049] Example 1
[0050] This embodiment describes a method for obtaining the sequence of the MdCIK2 gene, which negatively regulates apple rot resistance.
[0051] The nucleotide sequence of the MdCIK2 gene, which negatively regulates apple disease resistance, as disclosed in this embodiment is shown in SEQ ID NO:1. It was obtained from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), with gene number XM_070815479.1 and a full length of 1917 bp. It encodes 638 amino acids (as shown in SEQ ID NO:3). The specific sequence for silencing the MdCIK2 gene is shown in SEQ ID NO:2.
[0052] Example 2
[0053] This embodiment provides a method for cloning the MdCIK2 gene.
[0054] RNA was extracted from Gala apple leaves using an RNA kit (Beijing Huayueyang Biotechnology Co., Ltd., catalog number 0416-50) following the manufacturer's instructions. Apple cDNA was obtained by reverse transcription using a reverse transcription kit (ThermoFisher Scientific, catalog number K1162) following the manufacturer's instructions. Primers for the full-length MdCIK2 gene with homologous arms to the pCAMBIA1302 vector were designed using snapgene software (see Table 1). Using cDNA as a template, the target fragment was amplified by PCR using a high-fidelity enzyme (Shanghai Yisheng Biotechnology, catalog number: 10154ES03). The reaction mixture consisted of 25 μL of 2×HieffCanace... ® Plus PCR Master Mix (With Dye); 2 μL 1302-MdCIK2-F and 2 μL 1302-MdCIK2-R; 3 μL cNDA; 18 μL ddH2O. The PCR reaction program was: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 20 s, 72℃ extension for 1 min, 35 cycles, followed by a final extension at 72℃ for 5 min. Agarose gel electrophoresis results are shown below. Figure 1 As shown, this conforms to the size of the gene CDS fragment.
[0055] Example 3
[0056] This embodiment provides a homology analysis of the protein encoded by the MdCIK2 gene.
[0057] The NCBI database was searched for homologs of this gene in different plants, including the grass maize (Maize). Zea mays ), rice ( Oryza sativ ),wheat( Triticum aestivum ); Solanaceae plant Nicotiana benthamiana ( Nicotiana benthamiana ),potato( Solanum tuberosum ); Rosaceae plant apple ( Malus domestica ),pear( Pyrus bretschneideri ),Peach( Prunus persica ); peanut (a legume) Arachis hypogaea ), soybeans Glycine max Brassicaceae plant rapeseed ( Brassica napus Arabidopsis thaliana ( ) Arabidopsis thaliana ); Malvaceae plant cotton ( Gossypium hirsutum ); grape (Vitaceae family) Vitis vinifera ) and cucumber (Cucurbitaceae) Cucumis sativus A phylogenetic tree of MdCIK2 was constructed using MEGA11 software based on the maximum likelihood method. The results showed that this gene is closely related to the XP_004146714.1 protein of cucumber (Cucurbitaceae). Figure 2 However, no research reports have been found on the association between this gene and negative regulation of disease resistance in cucumber. Currently, there are research reports on the function of CIK family receptor kinases in Arabidopsis thaliana, a cruciferous plant, regarding their regulation of plant growth and development, but the function of this family of genes in negatively regulating plant disease resistance has not been reported.
[0058] Example 4
[0059] This embodiment provides an analysis of the expression pattern of the MdCIK2 gene in response to infection by apple tree rot fungus.
[0060] One-year-old Gala apple branches were collected from the orchard. Uniformly sized branches were cut into sections approximately 10 cm long. The branches were disinfected with 0.7% sodium hypochlorite solution, and both ends were sealed with paraffin wax. A 5 mm diameter hole punch was used to create a wound in the middle of the branch, and the branch was inoculated with pre-activated PDA medium. V. mali Plant tissue was cultured at 25℃ with humidity, and the boundary between diseased and healthy tissue was scraped at 0, 6, 12, 24, 36, 48 and 72 h after inoculation with pathogens.
[0061] Total RNA was extracted from the above plant tissues using an RNA extraction kit, and cDNA was obtained by reverse transcription using a reverse transcription kit. Using cDNA from different infection stages obtained by reverse transcription as templates, apple... ActinThe gene was used as an internal reference gene. qPCR analysis was conducted to determine the expression pattern of MdCIK2 at different time points during the interaction between apples and the pathogen. First, a 20 μL qPCR system was established: 10 μL of 2×ChamQ SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number Q311) was added sequentially to ice; 0.5 μL of qRT-MdCIK2-F and qRT-MdCIK2-R; 1 μL of cDNA; and 8 μL of ddH2O. The qPCR reaction was performed according to the following system and procedure: pre-deformation: 95℃ for 30 seconds; cycling reaction: 95℃ for 10 seconds, 60℃ for 30 seconds, 40 cycles. Three biological replicates and three experimental replicates were performed for each treatment. Through 2... –ΔΔCT The method analyzed the qPCR results, and the results showed that the MdCIK2 gene, which negatively regulates apple rot resistance, plays a role in apple response. V. mali Expression was significantly upregulated at 12, 24, and 36 hours after infection, and downregulated at 48 and 72 hours after infection. Figure 3 ).
[0062] Example 5
[0063] This embodiment provides a subcellular localization analysis of the protein encoded by the MdCIK2 gene.
[0064] The MdCIK2 gene was constructed into the pCAMBIA1302 vector containing a GFP tag. First, the vector was linearized using the following reaction mixture: 5 μL pCAMBIA1302 plasmid; 5 μL 10× QuickCut Buffer; 2.5 μL Spe I; 2.5 μL Nco I; 35 μL ddH2O. The PCR reaction program was: 37℃ for 30 min; 80℃ for 10 min. After the reaction, the sample was removed and placed on ice. Then, the MdCIK2 gene fragment cloned in Example 2 was homologously recombinated with the linearized pCAMBIA1302 vector using a homologous recombinase (Novizan, catalog number C112). The product was transformed into competent *E. coli* cells Trelief according to the manufacturer's instructions. ®5α (Beijing Qingke Biotechnology Co., Ltd.). Transformed competent cells were plated on LB solid medium containing 50 μg / mL Kanamycin resistance and incubated upside down at 37°C for 12 h. Single colonies were picked for colony PCR detection. Single colonies with PCR band sizes matching the target gene were added to liquid LB medium containing the corresponding antibiotic and further incubated with shaking for 16 h. Plasmids were extracted from *E. coli* using a plasmid extraction kit and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing comparison. The correctly sequenced recombinant plasmid vector was transformed into *Agrobacterium* EHA105 competent cells (Shanghai Weidi Biotechnology Co., Ltd.) according to the instructions. The transformed competent cells were plated on LB medium containing kanamycin (50 μg / mL) and rifampin (25 μg / mL) and incubated at 28°C for 48-72 h until single colonies grew. Single colonies of Agrobacterium obtained after transformation were picked and cultured in LB liquid medium containing kanamycin (50 μg / mL) and rifampin (25 μg / mL) at 220 rpm for 48-72 h with shaking. After colony expansion, the cells were centrifuged at 5000 rpm for 3 minutes and then resuspended in infection solution (10 mM MgCl2·6H2O, 10 mM MES, 100 μM acetylsyl syringone) and the OD was adjusted. 600 After reaching a concentration of 0.6-0.8, the culture was allowed to stand at room temperature in the dark for 2-3 hours. The Agrobacterium suspension, after standing in the dark, was then injected into 4-5 week old tobacco leaves using a needle-free syringe. After two days of incubation in a greenhouse, fluorescence was observed using an FV3000 laser confocal microscope (Olympus, Japan). The results showed that the green fluorescence of the MdCIK2-GFP fusion protein overlapped with the red fluorescence of the membrane-localizing protein TaWP16-mCherry fusion protein. Figure 4 This indicates that MdCIK2 (the protein encoded by the MdCIK2 gene) is located on the plant cell membrane, consistent with its localization characteristics as a receptor-like kinase.
[0065] Example 6
[0066] This example presents an analysis of transient silencing and overexpression of the MdCIK2 gene in apple tissue culture seedlings.
[0067] 6.1 First, construct the MdCIK2 gene silencing vector.
[0068] The MdCIK2 gene was cloned into the pK7GWIWG2D(II) vector to construct a gene silencing vector. This was achieved using Gateway BP Clonase and Gateway LR Clonase (Invitrogen, USA) via Gateway recombination cloning technology. First, BP Clonase catalyzed in vitro recombination of DNA fragments from the clone (containing the attB site) and the donor vector (pDONR222 vector, containing the attP site) to generate an entry clone, which was then sequenced using M13-F primers. Subsequently, LR Clonase catalyzed in vitro recombination of the correctly sequenced entry clone (containing the target gene with the attL site) and the pK7GWIWG2D(II) vector (containing the attR site) to generate an expression clone. The reaction system was as follows: 1 µL DNA fragment / entry clone; 0.5 µL donor vector / target vector; 1 µL TE buffer (pH 8.0); 0.5 µL BP / LR Clonase II. The mixture was incubated overnight at 25°C. The next day, it was transformed into competent *E. coli* cells DH5α. After single colonies grew, colony PCR was performed. Single colonies that met the expected results were further cultured by shaking. Plasmids were extracted from *E. coli* using a plasmid extraction kit and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing comparison. The correctly sequenced vector was transformed into *Agrobacterium* EHA105 competent cells using the method described in Example 5 for subsequent transient silencing experiments. Overexpression experiments were performed using *Agrobacterium* pCAMBIA1302-MdCIK2 constructed in Example 5.
[0069] Agrobacterium carrying the target plasmid was inoculated into LB medium containing kanamycin (50 μg / mL) and rifampin (25 μg / mL) and cultured overnight at 220 rpm with shaking at 28°C. The cells were then collected by centrifugation at 6000 rpm for 3 min at room temperature, and washed three times with MES buffer. The cells were resuspended in MES buffer and the OD was adjusted. 600 Incubate at room temperature (0.6-0.8°C) in the dark for 2-3 hours. Immerse 4-5 week old apple tissue culture seedlings in Agrobacterium tumefaciens culture carrying the target plasmid and place them in a sealed vacuum chamber for vacuum permeation, 5 minutes each time, twice. Subsequently, insert the apple tissue culture seedlings back into MS medium and continue culturing for 3 days to silence the target gene or overexpress the target gene in the apple tissue culture seedlings.
[0070] 6.2 Analysis of MdCIK2 gene silencing and overexpression in apple leaves
[0071] Total RNA was extracted from apple leaves infected with pK7 empty vector, pK7-MdCIK2, pCAMBIA1302-GFP, and pCAMBIA1302-MdCIK2 for 3 days. After reverse transcription, cDNA was obtained from different samples. The expression level of gene MdCIK2 in different samples was detected using the method in Example 4. Three biological replicates and three experimental replicates were taken for each treatment.
[0072] Quantitative results showed that, compared with the control pK7 empty vector, the expression level of the MdCIK2 gene was downregulated by 53% three days after infection of apple leaves by pK7-MdCIK2. Figure 5 (A), reaching the silencing requirement. Compared with the control pCAMBIA1302-GFP, the expression level of pCAMBIA1302-MdCIK2 was upregulated by 23.8 times after 3 days of infection in apple leaves (A). Figure 6 (A) meets the overexpression requirements.
[0073] 6.3 MdCIK2 gene response V. mali Functional analysis of infection
[0074] After determining the conditions for silencing and overexpressing the target gene, an apple leaf inoculation experiment was conducted. First, the gene was activated on PDA agar plates. V. mali Incubate at 25℃ in the dark for 2 days for later use. Infect apple leaves with pK7 empty vector, pK7-MdCIK2, pCAMBIA1302-GFP, and pCAMBIA1302-MdCIK2 vectors in water agar to maintain humidity. Use a sterile syringe needle to make one incision on each leaf. Introduce the activated... V. mali Using a 2mm diameter punch, collect mycelial cakes from the edge of the colony and place them on the wound. Spray with water and keep moist. Take photos of the leaves 24-36 hours after inoculation to assess disease incidence, and use ImageJ software to calculate the lesion area. Each treatment should have at least six biological replicates, and the experiment should be repeated three times.
[0075] The results showed that silencing the MdCIK2 gene significantly reduced leaf disease in apple tissue culture seedlings compared to the empty vector control. Figure 5 In the control group (B), the lesion area was significantly smaller compared to the control group. Figure 5 (C). Overexpression of the MdCIK2 gene significantly increased leaf disease severity in apple tissue culture seedlings compared to the control group overexpressing GFP. Figure 6 In the control group (B), the lesion area was significantly larger than that in the control group (B). Figure 6 (C)
[0076] Example 7
[0077] This example presents an analysis of the expression of apple defense-related genes after overexpression of the gene MdCIK2.
[0078] Using apple leaf cDNA overexpressing pCAMBIA1302-GFP and pCAMBIA1302-MdCIK2 as templates, the expression of apple defense-related genes MdPR1, MdPR2, MdPR5, MdWRKY33, and MdRBOHD was detected by RT-qPCR. The results showed that, compared with the control, the expression of all five apple defense-related genes was significantly downregulated after overexpression of MdCIK2. Figure 7 ).
[0079] It should be noted that the apple receptor kinase gene MdCIK2, located on the cell membrane, plays a crucial role in the apple response. V. mali Upregulated expression during the early stages of infection and negatively regulating resistance to apple rot. Example 1 clarified the gene's origin. Example 2 provided the cloning method for this gene. Example 3, through phylogenetic analysis with 15 plants from 8 common families, revealed that MdCIK2 is evolutionarily closely related to the Cucurbitaceae plant cucumber XP_004146714.1 protein. However, while studies on the function of CIK family receptor kinases in regulating plant growth and development have been reported in the Brassicaceae plant Arabidopsis thaliana, the negative regulation of plant disease resistance by this family of genes has not been reported. Example 4 clarified the role of this gene in apple response. V. mali MdCIK2 expression was upregulated in the early stages of infection. Example 5 confirmed that MdCIK2 is located on the plant cell membrane, consistent with its localization characteristics as a receptor-like kinase. In Example 6, MdCIK2 was silenced and overexpressed, respectively, before inoculation. V. mali The statistical results of pathogenic phenotype and lesion area indicate that this gene negatively regulates the resistance of apples to rot disease. Example 7 shows that after overexpression of MdCIK2, the expression of apple defense-related genes was significantly downregulated, indicating that this gene negatively regulates apple immunity.
[0080] In conclusion, the discovery of the MdCIK2 gene, which negatively regulates apple canker, provides an important genetic resource for apple disease resistance breeding and a crucial material basis for the green and sustainable control of apple tree canker.
[0081] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but rather to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art through related deductions and substitutions based on the inventive concept, without inventive effort, are within the scope of protection of the present invention.
Claims
1. The application of the receptor-like kinase gene MdCIK2 in regulating apple disease resistance, characterized in that, Silencing the receptor-like kinase gene MdCIK2 enhances the resistance of apples to rot; among which, The CDS sequence of the receptor-like kinase gene MdCIK2 is shown in SEQ ID NO:1; The rot disease is caused by fungi belonging to the genus *Hymenopstomiae* of the phylum Ascomycota. Valsa mali cause.
2. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the receptor kinase gene MdCIK2 is shown in SEQ ID NO:
3.
3. Anti-Ascomycota fungi and Black Rot Skin Fungi Valsa mali The method for cultivating apple varieties is characterized by, This includes steps to silence the receptor-like kinase gene MdCIK2 in apples; The CDS sequence of the receptor kinase gene MdCIK2 is shown in SEQ ID NO:
1.
4. The cultivation method according to claim 3, characterized in that, The amino acid sequence of the protein encoded by the receptor kinase gene MdCIK2 is shown in SEQ ID NO:
3.
5. The cultivation method according to claim 3, characterized in that, The receptor-like kinase gene MdCIK2 is used in apples to resist black rot fungi in the Ascomycota phylum. Valsa mali It plays a negative regulatory role in the immune response.
6. The cultivation method according to claim 3, characterized in that, Silencing the receptor kinase gene MdCIK2 enhances apple resistance to rot.
7. Silencing the receptor kinase gene MdCIK2 in the cultivation of fungi resistant to Ascomycota genus *Cynodon dactylon*. Valsa mali Its application in apple varieties is characterized by, The CDS sequence of the receptor kinase gene MdCIK2 is shown in SEQ ID NO:1.
Citation Information
Patent Citations
Apple receptor-like kinase as well as expression gene and application thereof
CN117230092A
Application of receptor-like kinase MdRLK2 in apple comprehensive resistance breeding
CN120555484A