Primer pair and probe for specific detection of navicula navicula
The use of real-time quantitative PCR technology with specific primer pairs and probe combinations has solved the speed and quantification problems of traditional algae identification methods, enabling rapid, specific and highly sensitive detection and quantitative analysis of Navicula.
Patent Information
- Application Number
- CN202510998351.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-10-24
AI Technical Summary
Traditional algae identification methods are slow, time-consuming, and highly susceptible to subjective factors. Existing molecular detection methods are difficult to use for quantitative analysis of algae abundance, and conventional PCR technology cannot specifically detect Navicula.
Using specific primer pairs and probe combinations, *Novoidea* was amplified and detected by real-time PCR. The nucleic acid sequences of the primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleic acid sequence of the probe is shown in SEQ ID NO.3. Signal determination was performed by combining fluorescent and quenching groups, and the detection limit reached 10⁻⁶ ng/μL.
It achieves highly specific and sensitive detection of Navicula, accurately identifies Navicula at extremely low concentrations, and enables quantitative analysis.
Smart Images

Figure BDA0005508658070000061 
Figure BDA0005508658070000062 
Figure BDA0005508658070000063
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology, and particularly relates to a primer pair and a probe for specifically detecting Navicula. BACKGROUND
[0002] Algae are considered to be one of the oldest forms of life, and are a kind of primitive plants that can perform photosynthesis even without roots, stems and leaves. The simple structure of algal cells enables them to adapt to different environmental conditions and survive for a long time, and they are one of the primary producers with the longest history on earth. Marine algae mainly include multiple phyla such as Cyanophyta, Chlorophyta, Bacillariophyta and Chrysophyta. Among them, Bacillariophyta is a diverse aquatic organism, and the monomer cell ranges from several microns to several millimeters. Navicula, as a representative group of Bacillariophyta, plays multiple key roles in ecological systems such as freshwater and marine ecosystems, and their traces can be found in waters from the tropics to the frigid zone, covering different altitudes, river terraces and river slopes. The role of Navicula runs through multiple dimensions such as material circulation, energy flow, environmental regulation and biological interaction, and it plays an irreplaceable role in the assessment of ecosystem health due to its high sensitivity to environmental changes and predictability of community structure.
[0003] The traditional method for identifying the species of marine algae is morphological observation under a microscope. However, due to the small size of some algae, it is difficult to observe them under a general optical microscope, and an electron microscope is needed for identification; in addition, different life cycles of algae have different morphologies, which can easily lead to incorrect identification. The traditional morphological observation method is difficult to meet the needs of algal resource identification and monitoring due to its slow speed, long time consumption and large influence of subjective factors.
[0004] In recent years, with the maturation of molecular biology techniques, molecular detection methods are the main technical methods for detection and diagnosis. Molecular detection methods based on polymerase chain reaction (PCR) are continuously developed and applied in the field of algae detection. Molecular detection methods are based on a specific gene sequence of the target organism for sequence amplification or specific probe binding, and positive results are determined by electrophoresis, color development or fluorescence. Conventional PCR technology can only identify the target species, but cannot quantify the abundance. qPCR (Quantitative Polymerase Chain Reaction) is a technology that monitors the product in real time during the PCR reaction, thereby realizing the quantitative analysis of the target sequence. It combines the high sensitivity of PCR with the high specificity of fluorescence detection, and is widely used in gene expression analysis, pathogen detection, gene mutation analysis and other fields. According to the different principles of fluorescence group combination, qPCR method can be divided into SYBR Green I dye method and TaqMan probe method. SUMMARY
[0005] In order to solve the problems existing in the prior art, the purpose of the present application is to provide a method for specifically detecting Navicula trivialis.
[0006] In one aspect, the present application provides a method for specifically detecting Navicula trivialis, which comprises using an upstream primer and a downstream primer to perform an amplification reaction on a sample to be tested,
[0007] The nucleic acid sequence of the upstream primer is shown in SEQ ID NO. 1,
[0008] The nucleic acid sequence of the downstream primer is shown in SEQ ID NO. 2.
[0009] Preferably, the method further comprises the step of embodying the amplification result of the amplification reaction by a probe, and the nucleic acid sequence of the probe is shown in SEQ ID NO. 3.
[0010] Preferably, the 5' end of the probe is connected to a quenching group or a fluorescent group.
[0011] Preferably, the 3' end of the probe is connected to a quenching group or a fluorescent group.
[0012] Preferably, the 5' end of the probe is connected to a fluorescent group. Preferably, the 5' end of the probe is connected to FAM.
[0013] Preferably, the 3' end of the probe is connected to a quenching group. Preferably, the 3' end of the probe is connected to BHQ1.
[0014] Preferably, the nucleotides in the upstream primer, downstream primer or probe can have nucleic acid modifications, including base modifications, ribose modifications and / or phosphate backbone modifications.
[0015] In a specific embodiment, detection of the fluorescent signal emitted by the fluorescent group represents a positive detection result, indicating the presence of the target sequence in the sample to be tested.
[0016] More preferably, a cq value ≤ 40 is determined to be a positive detection result.
[0017] Preferably, the amplification reaction comprises PCR (Polymerase Chain Reaction).
[0018] Preferably, the PCR comprises conventional PCR, fluorescent quantitative PCR, reverse transcription PCR, nested PCR, multiplex PCR, digital PCR, etc.
[0019] Preferably, the amplification reaction is fluorescent quantitative PCR (qPCR).
[0020] Preferably, the sample to be tested is suspected to contain Navicula; specifically, the sample to be tested comprises water samples, algal samples and sediment samples, etc.
[0021] Preferably, the detection limit of the method is 10 -6 ng / μL.
[0022] Preferably, the method comprises the following steps:
[0023] (1) obtaining a sample to be tested,
[0024] (2) preparing a reaction system and performing qPCR,
[0025] (3) determining whether the sample to be tested contains Navicula according to whether a fluorescent signal is detected.
[0026] Specifically, the reaction system contains an upstream primer, a downstream primer, a probe and a sample to be tested.
[0027] Preferably, the reaction system further contains a DNA polymerase.
[0028] Preferably, the DNA polymerase comprises any one or more of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4, Klenow.
[0029] More specifically, the reaction system further contains a buffer and / or a PCR reaction solution for activating the DNA polymerase.
[0030] In another aspect, the present application provides a pair of primers for specifically detecting Navicula, the pair of primers comprising an upstream primer and a downstream primer,
[0031] The nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1,
[0032] The nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 2.
[0033] Preferably, the nucleotides in the upstream primer or the downstream primer can have nucleic acid modifications, which include base modifications, ribose modifications and / or phosphate backbone modifications.
[0034] In another aspect, the present application provides a primer probe combination for specifically detecting Navicula, the primer probe combination comprising an upstream primer, a downstream primer and a probe,
[0035] The nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1,
[0036] The nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 2.
[0037] The nucleic acid sequence of the probe is shown as SEQ ID NO. 3.
[0038] Preferably, the 5' end of the probe is connected with a quencher group or a fluorescent group.
[0039] Preferably, the 3' end of the probe is connected with a quencher group or a fluorescent group.
[0040] Preferably, the 5' end of the probe is connected with a fluorescent group. Preferably, the 5' end of the probe is connected with FAM.
[0041] Preferably, the 3' end of the probe is connected with a quencher group. Preferably, the 3' end of the probe is connected with BHQ1.
[0042] Preferably, the nucleotides in the upstream primer, the downstream primer or the probe can have nucleic acid modifications, which include base modifications, ribose modifications and / or phosphate backbone modifications.
[0043] In another aspect, the present application provides a kit for specifically detecting Navicula, the kit comprising the aforementioned pair of primers and / or primer probe combination.
[0044] Preferably, the pair of primers, the primer probe combination in the kit is a freeze-dried product or dissolved in a liquid.
[0045] Preferably, the kit further comprises a DNA polymerase.
[0046] Preferably, the DNA polymerase comprises Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4, Klenow, etc.
[0047] Preferably, the kit further comprises a PCR reaction solution.
[0048] Preferably, the PCR reaction solution comprises a dNTP mixture, a PCR enzyme, Mg 2+ solution, and nuclease-free water.
[0049] Preferably, the kit further comprises a buffer solution for activating the DNA polymerase.
[0050] Preferably, the kit can further comprise instruments required for performing the PCR reaction.
[0051] In another aspect, the present application provides the use of the aforementioned primer pair, primer probe combination, and kit in detecting and / or identifying Navicula.
[0052] Advantages:
[0053] The primer probe combination of the present application has high specificity and can only amplify Navicula, but cannot amplify other algae such as Cymbella, Nitzschia, Synedra, Cyclotella, Gomphonema, Cocconeis, and Skeletonema, and can be used for specific detection and identification of Navicula.
[0054] The primer probe combination of the present application has high sensitivity, and a fluorescence signal can still be detected when the nucleic acid of Navicula is diluted to 10 -1 ng / μL, 10 -2 ng / μL, 10 - 3 ng / μL, 10 -4 ng / μL, 10 -5 ng / μL, 10 -6 ng / μL. BRIEF DESCRIPTION OF DRAWINGS
[0055] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present specification and serve to explain the principles of the present specification, together with the description.
[0056] Figure 1 The number of detection cycles for different dilution templates is shown. DETAILED DESCRIPTION
[0057] For the purposes of the present disclosure, technical solutions and advantages, the following will be further described in detail through specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present disclosure, rather than all the embodiments. Based on the embodiments in the present disclosure, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present disclosure.
[0058] The present disclosure can be implemented in other specific forms without departing from the essential attributes of the present disclosure. It should be understood that any and all embodiments of the present disclosure can be combined with the technical features in any other embodiment or multiple other embodiments to obtain another embodiment without conflict, so as to obtain another embodiment. The present disclosure includes the additional embodiments obtained by the combination.
[0059] (I) Definitions and explanations
[0060] In order to more easily understand the present disclosure, certain technical and scientific terms are specifically defined below. In the present disclosure, unless otherwise specified, the scientific and technical terms used in the present disclosure have the meanings commonly understood by those skilled in the art. It should be understood that the present disclosure is not limited to specific methods, reagents, compounds, compositions or biological systems, which can of course be varied. Also, the molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory operation steps used in the present disclosure are the terms and conventional steps widely used in the corresponding field. It should also be understood that the terms used in the present disclosure are only for the purpose of describing specific embodiments and are not intended to be limiting.
[0061] All publications and patents mentioned in the present disclosure are hereby incorporated by reference in their entirety into the present disclosure. If the use or terminology used in any publication or patent incorporated by reference conflicts with the use or terminology used in the present disclosure, the use and terminology in the present disclosure shall prevail. The section headings used in the present disclosure are only for the purpose of organizing the article and should not be interpreted as limiting the subject matter.
[0062] In the present disclosure, the conjunction term "and / or" between various elements means to include both "and" and "or", for example, the phrase "A, B and / or C" is intended to cover each of the following aspects: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0063] In the present disclosure, the term "comprising" or "including" generally means including the recited features but not excluding other elements.
[0064] In the present disclosure, the term "about" generally means a range of variation above or below the specified value of 0.5-10%, for example, a range of variation above or below the specified value of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.
[0065] In the present disclosure, the term "amplification reaction" refers to any in vitro means for amplifying or increasing the copies of a target sequence, mainly including two major categories of thermocycling amplification reaction and isothermal amplification reaction. The thermocycling amplification reaction mainly includes Polymerase Chain Reaction (PCR) and Ligase Chain Reaction (LCR), and the isothermal amplification reaction includes Strand displacement amplification (SDA), Rolling Circle amplification (RCA), Loop Mediated Amplification (LAMP), Helicase-dependent Isothermal DNA Amplification (HDA), Nucleic acid sequence based amplification (NASBA), and Transcription-based Amplification System (TAS). Preferably, the amplification reaction is Polymerase Chain Reaction (PCR).
[0066] In the present disclosure, the term "Polymerase Chain Reaction (PCR)" refers to a method for preparing a nucleic acid (e.g., a target sequence) by using multiple cycles of denaturation (template DNA double strands are separated), annealing (single-stranded oligonucleotide hybridizes with single-stranded template DNA strand), and DNA synthesis (DNA polymerase catalyzes the synthesis of a new DNA strand from the 3' end of the hybridized oligonucleotide using the template DNA strand as a template), amplifying or increasing the number of copies thereof.
[0067] wherein the term "cycle" refers to a single round of: Step 1, denaturation: template DNA strands are unzipped, Step 2, annealing: primers are hybridized to the single stranded DNA from Step 1 by the rules of base pairing, and Step 3, amplification: new DNA strands are synthesized from the 3' end of the primers in the 5' to 3' direction. Typically, polymerization uses a DNA polymerase (e.g., Taq polymerase) to catalyze the formation of phosphodiester bonds between adjacent deoxynucleotide triphosphates ("dNTPs") by placing dNTPs along the exposed single stranded template DNA by hydrogen bonds according to the rules of base pairing. The temperature of denaturation and annealing and the ionic strength of the reaction buffer control the stringency of hybridization and the fidelity of DNA replication.
[0068] To perform the amplification reaction, at least two different primers are used in PCR, a "forward primer" hybridizes to the anti-sense strand of the target sequence and forms the 5' end of the newly synthesized sense strand, and a "reverse primer" hybridizes to the sense strand of the target sequence and forms the 5' end of the newly synthesized anti-sense strand during amplification. In each cycle, each of the two template strands of the target sequence is copied to form a new double stranded DNA molecule, which is called an "amplicon".
[0069] In the present disclosure, the PCR includes conventional PCR and Quantitative Real-time PCR (qPCR), reverse transcription PCR (RT-PCR), nested PCR, multiplex PCR, digital PCR (dPCR), and other amplification reactions based on the principle of PCR. In specific embodiments, qPCR is used as an example of the amplification reaction, but is not the only example.
[0070] In the present disclosure, the term "Quantitative Real-time PCR (qPCR)" is a PCR that can monitor the formation of amplicons during the PCR cycle process. qPCR can be used to quantify the amount of specific template DNA in a sample to be tested. In addition to the forward primer and the reverse primer, qPCR introduces at least one probe (detection probe) into the reaction mixture.
[0071] wherein the term "probe" generally has a fluorescent group attached and a quencher group. In most cases, the fluorescent group is attached at or near the 5' end of the oligonucleotide and the quencher group is attached at or near the 3' end of the oligonucleotide. However, any workable configuration can be used in the practice of the present invention. When the probe is intact, the fluorescent group and the quencher group are in close proximity such that the quencher group absorbs light emitted by the excited fluorescent group, thereby significantly reducing the detectable fluorescent group emission. When the probe is cleaved or degraded, the fluorescent group and the quencher group are released and thus spatially separated. The quencher group is no longer sufficient to quench the fluorescent emission of the fluorescent group. The probe is a single-stranded oligonucleotide that hybridizes to the sense or antisense strand of the target sequence somewhere between the forward primer binding site and the reverse primer binding site. During the annealing step, the probe anneals to the single-stranded template. When polymerization occurs, the probe is cleaved and degraded by the 5' nuclease activity of the DNA polymerase. As more amplicons are formed, more probes are cleaved, more fluorescent groups and quencher groups are released, such that more fluorescent group / quencher group pairs are separated, and the magnitude of the fluorescent emission increases. The fluorescent group is, for example, FAM, FITC, TET, JOE, R110, CY-5, HEX, or CY-3; and the quencher group is, for example, BHQ1, TAMRA, Dabcyl, or MGB. In a specific embodiment, FAM and BHQ1 are used in combination.
[0072] In the present disclosure, the term "specifically detecting" means that the probe will detect the target sequence at a statistically significant level compared to non-target sequences. For example, primers and probes that specifically amplify and detect the target sequence produce a Cq value that can be readily distinguished from non-target sequences, for example, a Cq value that is at least 2, 3, 4, 5, 5-10, 10-20, or 10-30 cycles lower than that of non-target sequences.
[0073] In the present disclosure, the term "Cq value (Cycle Quantification)" or "Ct value (Cycle Threshold)" refers to the number of cycles at which the fluorescence signal intensity reaches a set threshold in a qPCR reaction. Preferably, a cq value ≤ 40 is determined as a positive result, indicating that the target sequence is present in the sample to be tested, and at least 10-6 ng / μL of navicula nucleic acid is present in the sample to be tested; otherwise, it is determined as negative.
[0074] In the present disclosure, the term "target sequence" refers to a nucleic acid sequence that is desired to be amplified or increased in copy number, and in the present disclosure, it particularly refers to a specific nucleic acid sequence in navicula, and more particularly refers to a nucleic acid sequence between the upstream primer and the downstream primer as shown in SEQ ID NO. 1-2.
[0075] In the present disclosure, the aforementioned kit can further comprise a positive control (C. paricalum DNA) and / or a negative control (free of C. paricalum DNA, such as sterilized double distilled water, sterile deionized water).
[0076] In the present disclosure, the aforementioned primer pair, primer probe combination can be supplied in solid (e.g. lyophilized, i.e. freeze-dried) or liquid form. In one embodiment, the primers, probes and other reagents are lyophilized.
[0077] The various components of the primer pair, primer probe combination, kit of the present disclosure can optionally be contained in different containers (e.g. vials, ampoules, test tubes, flasks or bottles). Each component is generally suitably aliquoted in its respective container or provided in concentrated form. Other containers suitable for carrying out certain steps of amplification / detection can also be provided.
[0078] (II) Specific Embodiments
[0079] For the purpose of clarity and brevity, features described herein as part of the same or separate embodiments can be described as part of the same or separate embodiments, however, it will be understood that the scope of the present disclosure can include embodiments having combinations of all or some of the features described.
[0080] Example 1, Establishment and verification of the system of the probe method fluorescent quantitative PCR method
[0081] 1. Reagents
[0082] The reagents used in this example include:
[0083] Upstream primer (SEQ ID NO. 1: CTATGGGCTCTGCCTAAGTTAC);
[0084] Downstream primer (SEQ ID NO. 2: CAAAGTGAGCTACAGGAGAGATT);
[0085] Probe (FAM-TGCTTATTAGGGCTTCTATCACGCGC (SEQ ID NO. 3)-BHQ1);
[0086] 2x Taq DNA Polymerase MIX enzyme (Nanjing Novozyme, ChamQ Geno-SNP Probe Master Mix, Q811-02);
[0087] Positive control: template containing C. paricalum gene fragment, concentration gradient of 10 -1 ~ 10 -7 ng / μL;
[0088] Negative control: sterile deionized water;
[0089] Tested sample, treatment method: collect water sample and Navicula trivialis standard, extract and purify DNA.
[0090] 2. Reaction system, procedure and result determination standard
[0091] Table 1, amplification reaction system
[0092]
[0093] The amplification reaction system is shown in Table 1, the fluorescence quantitative PCR procedure is shown in Table 2, and the principle of result determination is: Cq value ≤ 40 and the amplification curve shows obvious exponential growth period, which is determined as positive; 40 < Cq value or the sample Cq value cannot be detected, which is determined as negative.
[0094] Table 2, fluorescence quantitative PCR procedure
[0095]
[0096] 3. Specificity test
[0097] The Navicula trivialis standard is used as positive control, sterile deionized water is used as negative control, human blood DNA, E. coli DNA and other algal DNA are used as samples to verify the specificity of the primer. The amplification reaction system is prepared according to Table 1, and the amplification is carried out according to the procedure shown in Table 2.
[0098] Table 3, specificity test results
[0099]
[0100]
[0101] The amplification results are shown in Table 3, and the results show that: the negative control and non-target samples have no amplification signal, and the positive control Cq value ≤ 40, indicating that the specificity of the fluorescence quantitative PCR detection is 100%.
[0102] 4. Sensitivity test
[0103] Table 4, sensitivity test results
[0104] Template concentration (ng / pL) Cq value Copy number (copies / pL) <![CDATA[10 -1 ng / μL]]> 13.61 3.255 x 10 7 ]]> 10 -2 ng / μL 17.77 3.255 x 10 6 ]]> <![CDATA[10 -3 ng / μL]]> 21.60 3.255 x 10 5 ]]> 10 -4 ng / μL 25.39 3.255 x 10 4 ]]> 10 -5 ng / μL 29.27 3.255 x 10 3 ]]> 10 -6 ng / μL 32.64 3.255 x 10 2 ]]> 10 -7 ng / μL 33.58 3.255 x 10 1 ]]>
[0105] To determine the detection limit of the method, the standard of Navicula trivialis is diluted in a series of 10 -1 ng / μL, 10 -2 ng / μL, 10 -3 ng / μL, 10 -4 ng / μL, 10 -5ng / μL, 10 -6 ng / μL, 10 -7 ng / μL) and perform real-time fluorescence PCR in triplicate at each concentration. The lowest template concentration at which a stable fluorescence signal can be detected is recorded as the detection limit of the method.
[0106] Amplification curves such as Figure 1 The Cq value results are shown in Table 4. The above experimental results demonstrate that the primers, probes and detection methods provided by the present disclosure can rapidly, specifically and quantitatively detect Navicula.
Claims
1. A method for specifically detecting Navicula trivialis, comprising performing an amplification reaction on a sample to be tested using an upstream primer and a downstream primer, wherein the nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1, and the nucleic acid sequence of the downstream primer is shown as SEQ ID NO.
2. 2.The method of claim 1, further comprising a step of embodying the amplification result of the amplification reaction by a probe, wherein the nucleic acid sequence of the probe is shown as SEQ ID NO.
3. Preferably, the 5’ end of the probe is connected with a quencher group or a fluorescent group. Preferably, the 3’ end of the probe is connected with a quencher group or a fluorescent group. Preferably, the 5’ end of the probe is connected with a fluorescent group; preferably, the 5’ end of the probe is connected with FAM. Preferably, the 3’ end of the probe is connected with a quencher group; preferably, the 3’ end of the probe is connected with BHQ1. 3.The method of claim 1 or 2, wherein the amplification reaction comprises PCR. Preferably, the PCR comprises conventional PCR, fluorescent quantitative PCR, reverse transcription PCR, nested PCR, multiplex PCR, digital PCR. Preferably, the amplification reaction is fluorescent quantitative PCR. Preferably, the sample to be tested is suspected to contain Navicula trivialis. Specifically, the sample to be tested comprises water sample, algae sample and sediment sample. Preferably, the method has a limit of detection of 10 -6 ng / μL. 4.The method of any one of claims 1-3, comprising the following steps: (1) obtaining a sample to be tested, (2) preparing a reaction system and performing qPCR, (3) determining whether the sample to be tested contains Navicula trivialis according to whether a fluorescent signal is detected or not. Specifically, the reaction system contains the upstream primer, the downstream primer, the probe and the sample to be tested. Preferably, the reaction system further contains a DNA polymerase. Preferably, the DNA polymerase comprises any one or more of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4, Klenow. 5.A pair of primers for specifically detecting Navicula trivialis, comprising an upstream primer and a downstream primer, wherein the nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1, and the nucleic acid sequence of the downstream primer is shown as SEQ ID NO.
2. 6.A primer-probe combination for specifically detecting Navicula trivialis, comprising an upstream primer, a downstream primer and a probe, wherein the nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1, the nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 2, and the nucleic acid sequence of the probe is shown as SEQ ID NO.
3. 7.The primer-probe combination of claim 6, wherein the 5’ end of the probe is connected with a quencher group or a fluorescent group. Preferably, the 3’ end of the probe is connected with a quencher group or a fluorescent group. Preferably, the 5’ end of the probe is connected with a fluorescent group; preferably, the 5’ end of the probe is connected with FAM. Preferably, the 3’ end of the probe is connected with a quencher group; preferably, the 3’ end of the probe is connected with BHQ1. Preferably, the 3' end of the probe is linked to a quenching group; preferably, the 3' end of the probe is linked to BHQ1.
8. A kit for specifically detecting Skeletonema, comprising the primer pair of claim 5 and / or the primer probe combination of claim 6 or 7; Preferably, the primer pair, the primer probe combination in the kit is lyophilized or dissolved in liquid.
9. The kit of claim 8, further comprising a DNA polymerase; Preferably, the DNA polymerase comprises any one or more of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4, Klenow; Preferably, the kit further comprises a PCR reaction solution; Preferably, the PCR reaction solution comprises: a dNTP mixture, a PCR enzyme, Mg 2+ solution and nuclease-free water; Preferably, the kit further comprises the instruments required for performing the PCR reaction.
10. Use of the primer pair of claim 5, the primer probe combination of claim 6 or 7, the kit of claim 8 in detecting and / or identifying Skeletonema.