Application of recombinant human copper / zinc superoxide dismutase in preparation of medicine for preventing and treating allergic rhinitis

Abstract

The invention relates to the technical field of biological medicines, in particular to application of recombinant human copper / zinc superoxide dismutase in preparation of drugs for preventing and treating allergic rhinitis, and the nucleotide sequence of the recombinant human copper / zinc superoxide dismutase is shown as SEQ ID NO.1. The medicine for treating allergic rhinitis contains recombinant human copper / zinc superoxide dismutase. The medicine prepared from the recombinant human copper / zinc superoxide dismutase has the effect of remarkably relieving the clinical symptoms of allergic rhinitis, effectively reduces the inflammatory infiltration level of nasal mucosa tissues and the content of serum IgE, and has a remarkable prevention and treatment effect on allergic rhinitis. The medicine prepared by the invention can obviously reduce the sensitization of mast cells in nasal tissues of mice with allergic rhinitis, inhibit the lipid peroxidation reaction of the cells, reduce the oxidative stress level and enhance the content of catalase and glutathione oxidase so as to enhance the oxidation resistance of the organism, and has a very positive effect on the treatment of allergic rhinitis.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of a recombinant modified human copper / zinc superoxide dismutase in the preparation of drugs for the prevention and treatment of allergic rhinitis. Background Technology

[0002] Allergic rhinitis (AR) is a chronic disease caused by the nasal mucosa's reaction to allergens, belonging to IgE-mediated type I hypersensitivity reactions. Typical clinical symptoms of AR include sneezing, nasal itching, nasal congestion, and runny nose, which are particularly pronounced upon exposure to pollen or other allergens, or during seasonal changes. There are approximately 250 million AR patients in China, and this number continues to rise, creating a significant socioeconomic burden and severely impacting patients' sleep, work, and mental health. However, the pathogenesis of allergic rhinitis is highly complex, involving the interaction of genetic factors, environmental factors, and individual immune characteristics. The inflammatory response of immune cells and the balance of the body's antioxidant system play a central role in the development and progression of allergic rhinitis.

[0003] When an individual is exposed to allergens, various immune cells in the nasal mucosa, such as mast cells, eosinophils, T lymphocytes, and B lymphocytes, are activated, secreting cytokines such as IL-4, IL-5, and IL-13, and releasing inflammatory mediators such as histamine, leukotrienes, and prostaglandins. This leads to an imbalance and dysfunction of the immune cell population, resulting in a chronic inflammatory response that is difficult to eradicate. To date, there is no way to completely cure allergic rhinitis.

[0004] When the nasal mucosal epithelial barrier integrity of patients with allergic rhinitis is compromised, re-exposure to allergens triggers oxidative stress responses in epithelial and inflammatory cells. The Nrf2 and NF-κB pathways are common signaling pathways in oxidative stress and play important roles in allergic rhinitis. Research indicates that treatment of OVA-induced allergic mouse models with antioxidants enhances the expression and synthesis of downstream heme oxygenase-1 (HO-1) activated after Nrf2 transcription factor translocation into the nucleus, inhibits the degradation of the tight junction protein ZO-1, and reduces epithelial cell permeability, thereby enhancing the integrity of the nasal mucosal epithelial barrier. Studies in children with allergic rhinitis have shown a high oxidative stress state in their eosinophils, further demonstrating the close relationship between immune cell oxidative stress levels and the development of allergic rhinitis (AR).

[0005] Currently, traditional treatments for allergic rhinitis mainly rely on budesonide, fluticasone, montelukast, and loratadine. These drugs relieve allergic rhinitis symptoms by suppressing the inflammatory response and reducing nasal mucosal symptoms. However, most of these drugs are steroids, which only relieve symptoms. Some patients do not respond well to treatment, and long-term use can lead to drug tolerance and side effects. The limitations and potential side effects of these drugs highlight the urgent need for new treatment strategies. Therefore, developing non-steroidal drugs with high safety, better efficacy, lower cost, fewer side effects, and novel mechanisms of action is crucial for improving the treatment outcomes for patients with allergic rhinitis.

[0006] Currently, there is no specific medicine for allergic rhinitis. Although traditional hormone drugs can relieve symptoms in a short period of time, they have significant side effects and are prone to causing drug tolerance and adverse reactions that can damage health. There are no reports on the mechanism of action of Cu / Zn superoxide dismutase in the treatment of allergic rhinitis. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of recombinant modified human copper / zinc superoxide dismutase in the preparation of drugs for the prevention and treatment of allergic rhinitis. The recombinant modified human copper / zinc superoxide dismutase (rmh Cu / Zn-SOD) provided by this invention is not an ordinary superoxide dismutase, but a modified superoxide dismutase with high safety, good water solubility, high enzyme activity, and resistance to high temperature and acid and alkali. The drugs prepared by this invention using this superoxide dismutase can significantly reduce the clinical symptoms and serum specific IgE levels in OVA-induced AR mouse models, inhibit nasal mucosal inflammatory response, reduce the body's oxidative stress level, enhance the body's antioxidant capacity, and inhibit the occurrence and development of allergic rhinitis.

[0008] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides the application of recombinant human copper / zinc superoxide dismutase in the preparation of drugs for the prevention and treatment of allergic rhinitis, wherein the nucleotide sequence of the recombinant human copper / zinc superoxide dismutase is shown in SEQ ID NO.1: ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAATTTCGAGCAGCAGGAAAGTAATGGACCAGTGACCGTGTGGGGAAGCATTACTGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCCTGACCCACGGTGGGCCAGGCGATGA AGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACGCCGATGGTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATAGCATCATTTGGCCGCACACTGGTGGTCCATGAACTGGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAACCACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA.

[0009] The aforementioned recombinant human copper / zinc superoxide dismutase and its preparation method are both published under Chinese invention patent number CN119082055A and invention title: A Recombinant Human Copper / Zinc Superoxide Dismutase and its Preparation and Application.

[0010] The present invention also provides a medicament for treating allergic rhinitis, the medicament containing the above-mentioned recombinant modified human copper / zinc superoxide dismutase lyophilized powder.

[0011] Furthermore, the lyophilized powder of the recombinant human copper / zinc superoxide dismutase has an enzyme activity of 1,000,000 U to 5,000,000 U.

[0012] Furthermore, the drug also includes pharmaceutically acceptable excipients (the superoxide dismutase is used in combination with the excipients to treat allergic rhinitis).

[0013] Furthermore, the excipients are at least one of stabilizers, flavor enhancers, preservatives, humectants, or antibacterial agents.

[0014] Furthermore, the dosage form of the drug is tablets, capsules, nasal sprays (i.e., nasal sprays), powders, or injections.

[0015] The above-mentioned drugs can reduce inflammatory infiltration of nasal mucosa, reduce nasal mucus secretion, and alleviate the clinical symptoms of allergic rhinitis, showing significant efficacy in the treatment of allergic rhinitis.

[0016] The above-mentioned drugs can reduce serum IgE levels, significantly reduce the intensity of allergic reactions, reduce the content of malondialdehyde (MDA), a lipid peroxidation product, increase the content of total superoxide dismutase (T-SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) in serum, reduce the body's oxidative stress level, and enhance the body's antioxidant capacity, thus playing a positive role in resisting allergic rhinitis.

[0017] Furthermore, when the drug is a nasal spray, the proportions of each ingredient are shown in Table 1 below: Table 1 Furthermore, in the drug, the enzyme activity of the recombinant modified human copper / zinc superoxide dismutase is 10000 U / mL-50000 U / mL.

[0018] Furthermore, in the drug, the rmh Cu / Zn-SOD enzyme activity is 50000 U / mL, the concentration of glycerol is 1.0%, the concentration of propylene glycol is 0.05%, the concentration of trehalose is 0.5%, the concentration of potassium sorbate is 0.1%, and the concentration of sodium hyaluronate is 0.1%.

[0019] The density of the medication for treating allergic rhinitis was measured to be 1.08 g / mL.

[0020] The above-mentioned medication is in the form of a nasal spray. The method of use for treating allergic rhinitis is as follows: Spray the medication into the nasal cavity 2-3 times a day.

[0021] The principle of this invention: Copper-zinc superoxide dismutase (Cu / Zn-SOD), as an antioxidant protein, catalyzes the conversion of intracellular superoxide anions or oxygen free radicals into H2O2. H2O2 can then be decomposed into non-toxic H2O and O2 by catalase. Therefore, Cu / Zn-SOD can reduce intracellular oxidative stress levels, maintain the balance of the body's antioxidant system, participate in the regulation of various diseases, and play a vital role in maintaining health.

[0022] The present invention found that the prepared drug can significantly reduce the clinical symptoms and serum specific IgE levels in an OVA-induced mouse AR model, inhibit nasal mucosal inflammatory response, reduce the body's oxidative stress level, enhance the body's antioxidant capacity, and inhibit the occurrence and development of allergic rhinitis.

[0023] The beneficial effects of this invention are: This invention presents a nasal spray prepared using recombinant human copper / zinc superoxide dismutase (rmh Cu / Zn-SOD) that has therapeutic effects on allergic rhinitis. The invention proposes that this nasal spray can significantly reduce the levels of oxidative stress products in the serum of mice with allergic rhinitis and increase the expression level of antioxidant enzymes, thereby enhancing the body's antioxidant capacity, anti-inflammatory capacity, and therapeutic effect. The rmh Cu / Zn-SOD proposed in this invention is essentially a protein, possessing advantages such as high safety, no toxic side effects on humans, no hormonal drug side effects, and low cost, making it suitable for industrial production. The prepared nasal spray drug has broad application value. Attached Figure Description

[0024] Figure 1 This is a schematic diagram illustrating the statistical analysis of the weight of mice in each group and the number of times they scratched their nose, sneezed, and had runny nose within 15 minutes after the allergic rhinitis modeling treatment in the example. Figure 2 This is a schematic diagram illustrating the statistical analysis of the levels of specific immunoglobulin E (OVA-IgE), interleukin 4, and interleukin 5 in the serum of mice in each group in the examples. Figure 3 This is a statistical analysis chart showing the levels of oxidative stress and antioxidants in the serum of mice in each group, as illustrated in the examples. In this figure, A represents the content analysis of malondialdehyde (MDA), a lipid peroxidation product. B represents the total superoxide dismutase content. C is the catalase (CAT) content analysis chart. D is a graph showing the content analysis of glutathione peroxidase (GSH-PX); Figure 4 The figures show the HE staining results and statistical results of inflammation levels in the nasal tissues of mice in each group in the examples; In this image, A represents the HE staining result. B is a graph showing the statistical results of the inflammatory cell infiltration area. C is a statistical result of the percentage of inflammatory infiltration area in the nasal tissue section; Figure 5 The figures shown are the toluidine blue staining results and mast cell count results of the nasal tissues of mice in each group in the examples; In this image, A shows the results of toluidine blue staining, and B shows the results of mast cell count. Figure 6 The figures shown are AB-PAS staining results and goblet cell counts of mouse nasal tissue in each group, as illustrated in the examples. A shows AB-PAS staining images of tissue sections from the four groups of mice; B shows the staining of goblet cells in the nasal mucosal epithelium of mice in the four groups; C is a statistical analysis of the number of goblet cells in the nasal mucosal epithelium; D is a graph showing the changes in the proportion of goblet cells in the nasal mucosal epithelium of the four groups of mice. In the picture, This indicates that p < 0.05. This indicates that p < 0.01. This indicates that p < 0.001. This means p < 0.0001. Detailed Implementation

[0025] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0026] Example 1 The preparation method of a nasal spray containing rmh Cu / Zn-SOD for treating allergic rhinitis is as follows: (1) Prepare 2× aqueous phase components: Add glycerol and propylene glycol to deionized water that has been autoclaved at 121°C for 15 minutes and make their concentrations 2.0% and 1.0% respectively, and label it as “component A”; (2) Prepare 10× trehalose component: Dissolve trehalose in deionized water that has been autoclaved at 121°C for 15 minutes to make its concentration 5%, and label it as “component B”; (3) Prepare a 100× potassium sorbate component: Dissolve potassium sorbate in deionized water that has been autoclaved at 121°C for 15 minutes to make the concentration of potassium sorbate 10%, and label it as “component C”. (4) Prepare 100× sodium hyaluronate component: Dissolve sodium hyaluronate in deionized water that has been autoclaved at 121°C for 15 minutes to make the concentration of sodium hyaluronate 10%, and label it as “component D”. (5) After filtration using a 0.22 μm filter membrane, the resulting rmh Cu / Zn-SOD solution had a concentration of 500,000 U / mL and was labeled as “Component E”. (6) Under aseptic conditions, taking a 1L solution as an example, mix the components according to the following volumes: A500 mL B100 mL C10 mL D10 mL E100 mL 280 mL of sterile deionized water The mixed liquid is thoroughly mixed in an ATS high-pressure homogenizer at a pressure of 200 - 500 bar, filled aseptically, and stored for use at room temperature. In the obtained nasal spray, the enzyme activity of rmh Cu / Zn-SOD is 50000 U / mL, the concentration of glycerol is 1.0%, the concentration of propylene glycol is 0.05%, the concentration of trehalose is 0.5%, the concentration of potassium sorbate is 0.1%, and the concentration of sodium hyaluronate is 0.1%.

[0027] Example 2 The establishment of an allergic rhinitis mouse model and the preparation method of recombinant modified human copper / zinc superoxide dismutase for drug treatment are as follows: SPF-grade C57BL / 6 female mice aged 6 - 8 weeks (n = 24) with a body weight of 18 - 22 g (from the Experimental Animal Center of Huazhong Agricultural University) were used. They were raised in an SPF animal house. All experimental protocols were approved by the Scientific Ethics Committee of Huazhong Agricultural University (HZAUMO - 2025 - 0223), and the animal experiment ethics license was SYXK E 2020 - 0084.

[0028] The 24 mice were randomly divided into 4 groups: normal control group (Ctrl group), allergic rhinitis group (AR group), SOD nasal drop group (AR + SOD group), and dexamethasone group (AR + DXM group) (6 mice in each group, n = 6).

[0029] Pretreatment: The AR group, AR + SOD group, and AR + DXM group were intraperitoneally injected with 300 μl of physiological saline suspension containing 100 μg OVA (ovalbumin) and 2 mg aluminum hydroxide on days 0, 2, 4, 6, 8, 10, and 12 (basic sensitization); The normal control group (Ctrl group) was intraperitoneally injected and nasally dripped with physiological saline, and the treatment dose and time were the same as those of the AR group.

[0030] After the injection, from day 14 to day 27, the mice after basic sensitization were nasally dripped bilaterally with 10% OVA physiological saline (once a day, 10 μL per side each time) for excitation (nasal dripping was performed using a 20 μL micropipette).

[0031] The allergic rhinitis group (AR group) was nasally dripped with an equal volume of physiological saline 1 hour before each OVA nasal drip excitation, The SOD nasal drop group (AR + SOD group) was administered nasal drops (the nasal spray prepared in Example 1) once 1 hour before each OVA nasal drip excitation, 20 μL per side of the nasal cavity.

[0032] The dexamethasone group (AR + DXM group) was intraperitoneally injected with 1 mg / kg (dexamethasone) every day.

[0033] After the last OVA nasal instillation, the symptoms of nose scratching, sneezing, and runny nose in mice were recorded within 15 minutes and scored according to the following criteria: 2 < nose scratching ≤ 5 times (mild, 1 point), 5 < nose scratching ≤ 10 times (repeated nose scratching, 2 points), nose scratching > 10 times (violent and persistent nose scratching, 3 points); 1-3 sneezes were scored as 1 point, 4-10 sneezes as 2 points, and more than 10 sneezes as 3 points; clear nasal discharge flowing to the anterior nasal cavity was scored as 1 point, clear nasal discharge flowing beyond the anterior nasal cavity as 2 points, and clear nasal discharge flowing all over the face as 3 points; the scores of the three indicators were summed and integrated, and a total score ≥ 5 indicated that the model was successful.

[0034] Symptoms in mice from each group were recorded to assess the severity of allergic rhinitis. Results are shown in Table 2. Figure 1 .

[0035] Table 2 The results showed that, compared with the normal control group, the body weight of mice in the allergic rhinitis group (AR group) decreased significantly in the later stages, while the body weight of mice in the SOD nasal drop group and dexamethasone group fluctuated less after treatment than that in the allergic rhinitis group. Compared with the normal control group, the total score of the allergic rhinitis group was significantly higher, with all scores reaching 5 points indicating successful model establishment. After treatment with SOD nasal drops or dexamethasone, the symptom scores of allergic rhinitis mice were significantly lower than those in the AR group.

[0036] like Figure 1 As shown, the results indicate that the rmh Cu / Zn-SOD enzyme in the nasal spray has a therapeutic effect on allergic rhinitis and can improve behavioral symptoms such as itching, sneezing, and runny nose induced by OVA in allergic mice.

[0037] Example 3 Serum IgE levels and inflammatory factor contents were measured in mice with allergic rhinitis treated with the above-mentioned nasal spray containing rmh Cu / Zn-SOD. Mice were euthanized on day 28 after anesthesia with sodium pentobarbital. Blood was collected from the mice's eyes, and the blood samples were incubated at 4°C for 30 min, centrifuged at 2000 rpm for 10 min, and the serum was carefully aspirated and collected. The serum IgE level was detected using an enzyme-linked immunosorbent assay (ELISA) kit. The levels of interleukin-4 (IL-4) and interleukin-5 (IL-5) in the serum were also detected.

[0038] The results are as follows Figure 2 As shown, the serum IgE level of mice in the AR group was significantly higher than that in the Ctrl group, indicating that mice in the AR group had a high allergic reaction. The serum IgE level of mice in the SOD nasal spray group and the dexamethasone group was significantly lower than that in the AR group, indicating that the above nasal spray treatment can effectively inhibit allergic reactions.

[0039] Example 4 Detection of oxidative stress and antioxidant capacity indicators in the serum of mice in each group in Example 2 The levels of the above indicators in the serum samples of mice in each group were detected using a malondialdehyde (MDA), total superoxide dismutase (T-SOD), catalase (CAT), and glutathione peroxidase (GSH-PX) assay kit (Nanjing Jiancheng Bioengineering Institute).

[0040] The results are as follows Figure 3 As shown, the serum malondialdehyde (MDA) level (lipid peroxidation level) in AR group mice was significantly higher than that in Ctrl group, indicating a significant lipid peroxidation state. The antioxidant indicators T-SOD, CAT, and GSH-PX showed no significant difference compared to the normal control group, indicating an imbalance in the oxidative-antioxidant system in the allergic rhinitis group mice. Compared to the AR group, the serum MDA level in the SOD nasal spray group mice was significantly reduced to near-normal levels, demonstrating better antioxidant stress resistance than dexamethasone. Simultaneously, the serum levels of antioxidant enzymes T-SOD, CAT, and GSH-PX in the SOD nasal spray group mice were significantly increased, all superior to the antioxidant capacity of the dexamethasone group. These results indicate that the rmh-Cu / Zn-SOD nasal spray used in this invention can significantly enhance the antioxidant capacity of mice and reduce oxidative stress levels, showing a better advantage than dexamethasone in antioxidant stress resistance and demonstrating excellent efficacy in the treatment of allergic rhinitis.

[0041] Example 5 Example 1: The nasal spray containing rmh Cu / Zn-SOD prepared improved the pathological changes in nasal tissue of mice with allergic rhinitis. Experimental Methods: Mouse nasal tissue was fixed in 4% paraformaldehyde for 48 hours, and then decalcified in EDTA solution for 2 weeks. After treatment, the nasal tissue was embedded in paraffin and sectioned to 3 μm. The sections were stained with hematoxylin and eosin (HE), toluidine blue, alicin blue, and periodic acid-Schiff (AB-PAS). The structure, mast cell infiltration, and goblet cell proliferation of the mouse nasal tissue were observed under a light microscope, and statistical analysis was performed.

[0042] like Figure 4As shown, the nasal cavity environment of AR group mice contained a large number of inflammatory cells, resulting in a very small cavity space for normal air exchange in the nasal cavity of AR group mice. Extensive damage to the nasal mucosal epithelium and necrosis of epithelial cells led to their detachment and entry into the nasal cavity, resulting in a more severe inflammatory response. Compared with the AR group, the inflammatory infiltration area in the nasal cavity of the SOD nasal drop group (AR+SOD) and the dexamethasone group (AR+DXM) was significantly reduced, and the percentage of inflammatory cell infiltration in the nasal cavity section was significantly lower than that in the AR group. This indicates that rmhCu / Zn-SOD and dexamethasone treatment can significantly inhibit the inflammatory response in the development of allergic rhinitis and reduce inflammatory damage to the nasal mucosa.

[0043] To determine the cell types associated with allergic inflammation in nasal tissue, statistical analysis of mast cells and goblet cells was performed.

[0044] like Figure 5 As shown, compared with the normal control group, the AR group had a significantly increased number of mast cells and exhibited pathological changes associated with hypersensitivity reactions. Compared with the AR group, the number of mast cells in both the SOD nasal spray group and the dexamethasone group was significantly reduced, indicating that nasal spray containing rmh Cu / Zn-SOD can significantly inhibit the sensitization effect caused by mast cells and alleviate the sensitization reaction of allergic rhinitis.

[0045] like Figure 6 As shown, AB-PAS staining analysis revealed that, compared to the normal control group, the allergic rhinitis group showed significant goblet cell proliferation in the nasal mucosa epithelium, with a marked increase in the number of goblet cells and mucin secretion. Compared to the allergic rhinitis group, both the SOD nasal drop group and the dexamethasone group showed a significant decrease in the number of goblet cells in the epithelium, with the SOD nasal drop group exhibiting the lowest degree of goblet cell proliferation. This indicates that the prepared formulation effectively inhibits goblet cell proliferation and alleviates nasal mucosal allergic reactions. Statistical analysis of the percentage of AB-PAS-positive cells revealed that both rmh Cu / Zn-SOD treatment and dexamethasone treatment significantly reduced the content of mucinous secretion proteins and improved allergic rhinitis symptoms. Furthermore, rmh Cu / Zn-SOD treatment showed a better inhibitory effect on mucin secretion, demonstrating that the nasal spray containing rmh Cu / Zn-SOD prepared in this invention can effectively prevent and treat the development of allergic rhinitis and has a good therapeutic effect.

[0046] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a recombinant modified human copper / zinc superoxide dismutase in the preparation of drugs for the prevention and treatment of allergic rhinitis, characterized in that: The nucleotide sequence of the recombinant human copper / zinc superoxide dismutase is shown in SEQ ID NO.

1.

2. A medication for treating allergic rhinitis, characterized in that: The drug contains the lyophilized powder of the recombinant human copper / zinc superoxide dismutase as described in claim 1.

3. The drug according to claim 2, characterized in that: The lyophilized powder of the recombinant human copper / zinc superoxide dismutase has an enzyme activity of 1,000,000 U to 5,000,000 U.

4. The drug according to claim 2 or 3, characterized in that: The drug also includes pharmaceutically acceptable excipients.

5. The drug according to claim 4, characterized in that: The excipients are at least one of stabilizers, flavor enhancers, preservatives, humectants, or antibacterial agents.

6. The drug according to claim 5, characterized in that: The dosage form of the drug is tablets, capsules, sprays, powders, or injections.

7. The drug according to claim 6, characterized in that: When the drug is a spray, the proportions of the raw materials are as follows: Superoxide dismutase lyophilized powder 1,000,000U-5,000,000U Glycerin 0.1-1% Propylene glycol 0.1-0.5% Trehalose 0.05%-0.5% Potassium sorbate 0.05%-0.1% Sodium hyaluronate 0.05%-0.1% The remaining volume is 100 mL of sterile deionized water.

8. The drug according to claim 7, characterized in that: In the drug, the enzyme activity of the recombinant human copper / zinc superoxide dismutase is 10000 U / mL-50000 U / mL.

9. The medicament according to claim 8, characterized in that: The drug contains rmh Cu / Zn-SOD enzyme activity of 50000 U / mL, glycerol concentration of 1.0%, propylene glycol concentration of 0.05%, trehalose concentration of 0.5%, potassium sorbate concentration of 0.1%, and sodium hyaluronate concentration of 0.1%.

10. The medicament according to claim 9, characterized in that: The density of the medication for treating allergic rhinitis is 1.08 g / mL.

Images